<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2180-8-139</ui>
   <ji>1471-2180</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Inducible Siphoviruses in superficial and deep tissue isolates of <it>Propionibacterium acnes</it></p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Lood</snm>
               <fnm>Rolf</fnm>
               <insr iid="I1"/>
               <email>rolf.lood@med.lu.se</email>
            </au>
            <au id="A2">
               <snm>M&#246;rgelin</snm>
               <fnm>Matthias</fnm>
               <insr iid="I1"/>
               <email>matthias.morgelin@med.lu.se</email>
            </au>
            <au id="A3">
               <snm>Holmberg</snm>
               <fnm>Anna</fnm>
               <insr iid="I1"/>
               <email>anna.holmberg@med.lu.se</email>
            </au>
            <au id="A4">
               <snm>Rasmussen</snm>
               <fnm>Magnus</fnm>
               <insr iid="I1"/>
               <email>magnus.rasmussen@med.lu.se</email>
            </au>
            <au id="A5">
               <snm>Collin</snm>
               <fnm>Mattias</fnm>
               <insr iid="I1"/>
               <email>mattias.collin@med.lu.se</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden</p>
            </ins>
         </insg>
         <source>BMC Microbiology</source>
         <issn>1471-2180</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>139</fpage>
         <url>http://www.biomedcentral.com/1471-2180/8/139</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18702830</pubid>
               <pubid idtype="doi">10.1186/1471-2180-8-139</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>10</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>15</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>15</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Lood et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p><it>Propionibacterium acnes </it>is a commensal of human skin but is also known to be involved in certain diseases, such as acne vulgaris and infections of orthopaedic implants. Treatment of these conditions is complicated by increased resistance to antibiotics and/or biofilm formation of <it>P. acnes </it>bacteria. <it>P. acnes </it>can be infected by bacteriophages, but until recently little has been known about these viruses. The aim of this study was to identify and characterize inducible phages from <it>P. acnes </it>on a genetic and morphological basis.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>More than 70% (65/92) of <it>P. acnes </it>isolates investigated have inducible phages, classified morphologically as Siphoviruses. The phages have a head of 55 nm in diameter and a tail of 145&#8211;155 nm in length and 9&#8211;10 nm in width. There was no difference in carriage rate of phages between <it>P. acnes </it>isolates from deep infections and isolates from skin. However, there was a significant lower carriage rate of phages in <it>P. acnes </it>biotype IB, mostly attributed to the low carriage rate of inducible phages in biotype IB isolated from deep tissue. Most phages have a strong lytic activity against all <it>P. acnes </it>isolates with inducible phages, but have less lytic activity against isolates that have no prophages. Phages only infected and lysed <it>P. acnes </it>and not other closely related propionibacteria. All phages could infect and lyse their non-induced parental host, indicating that these prophages do not confer superinfection immunity. The phages have identical protein pattern as observed on SDS-PAGE. Finally, sequencing of two phage genes encoding a putative major head protein and an amidase and showed that the phages could be divided into different groups on a genetic basis.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our findings indicate that temperate phages are common in <it>P. acnes</it>, and that they are a genetically and functionally homogeneous group of Siphoviruses. The phages are specific for <it>P. acnes </it>and do not seem to confer superinfection immunity.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Propionibacterium acnes </it>is regarded as a commensal of human skin, but is also known to be involved in different infections such as acne vulgaris <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> and infections with orthopaedic implants <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Treatment of acne vulgaris is complicated by bacterial resistance to commonly used antibiotics <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. <it>P. acnes </it>infections of joint prostheses are probably much more common than previously thought <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, and treatment is complicated by biofilm formation on the foreign material <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. The complete genome of a <it>P. acnes </it>isolate was recently sequenced by Br&#252;ggemann <it>et al </it>2004 <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, showing that <it>P. acnes </it>possesses several putative virulence genes including hemolysins and co-hemolysins (CAMP factors) <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. The sequenced genome only contains one cryptic prophage, and in general there is limited knowledge about phages from <it>P. acnes</it>.</p>
         <p>Bacteriophages can enter two principally different life cycles, lytic or lysogenic. In the lytic life cycle a bacteriophage attaches to the bacterial cell and injects its genetic material. This genetic material is directly replicated, early and late phage genes are transcribed, proteins are translated, new phage particles are formed, and the bacterium is ultimately lysed to release the progeny. In the lysogenic life cycle, most known phages integrate their genome into the host genome by specific attachment and recombination events. There have been reports about phages existing as extrachromosomal circular or linear plasmid prophages, as a part of their lysogenic cycle <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. These so called prophages become integrated parts of the genome and are replicated together with the bacterial genome during cell division. Prophages account for much of the genetic diversity seen in bacteria and often carry genes that are beneficial for the bacteria, including toxins and other virulence factors <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>.</p>
         <p>Almost 30 years ago, it was reported that 18% of <it>P. acnes </it>isolates are carriers of bacteriophages <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, but little is known about these phages and their potential impact on virulence. Studies of <it>P. acnes </it>phages have been undertaken to establish a phage typing system to distinguish between different types of <it>P. acnes </it><abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp> as an alternative to use fermentative and serological methods <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Many studies on phages have been done on other propionibacteria as <it>Propionibacterium freudenreichii </it>mainly due to the research impact for dairy industry <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>.</p>
         <p>Recently Farrar <it>et al </it>sequenced the first genome of a <it>P. acnes </it>lytic phage <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. The phage was classified as a Siphovirus with a genome of 29,739 bp encoding 48 putative genes. Characterization of phages from <it>P. acnes </it>gives a deeper understanding of the relationship between phages and bacteria, and may eventually lead to a new therapy to treat <it>P. acnes </it>infections. In this study, we have induced, isolated, and characterized 65 temperate bacteriophages from different <it>P. acnes </it>isolates. The phages are all classified as Siphoviruses and can be divided into different groups based on dissimilarities in two genes encoding a putative major head protein and an amidase.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Carriage of phages</p>
            </st>
            <p>Since not much is known about the presence and carriage rate of bacteriophages in <it>P. acnes</it>, we investigated this in relation to both the site of isolation (superficial or deep infections) and to biotype. To investigate if <it>P. acnes </it>had prophages that could be induced to enter the lytic life cycle, we stimulated 92 different <it>P. acnes </it>isolates (see table <tblr tid="T1">1</tblr>) with 2 &#956;g/ml mitomycin C to induce prophages, followed by analysis of the plaque forming capacity of lysates on the noninduced parental isolates. Plaques were clear with well-defined edges and had a diameter of 6&#8211;7 mm. Bacteriophages could be induced in more than 70% of the isolates examined. In this study, we have used different isolates of <it>P. acnes </it>(Holmberg <it>et al</it>, unpublished) from deep tissue (AD-isolates, mainly isolated from infections of foreign material as hip prosthesis and sternal wires), and from the skin (AS-isolates, from the skin of healthy individuals). AD-isolates and AS-isolates had a carriage-rate of 70.5% respectively 70.8% (see Figure <figr fid="F1">1A</figr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p><it>P. acnes </it>isolates used, result of biotyping and obtained phage isolates.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Isolate</p>
                     </c>
                     <c ca="left">
                        <p>Biotype</p>
                     </c>
                     <c ca="left">
                        <p>Phage</p>
                     </c>
                     <c ca="left">
                        <p>Major Head</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD1</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD2</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD2*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302613">EU302613</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD3</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD4</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD4*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302614">EU302614</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD5</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD5*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302615">EU302615</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD6</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD6*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302616">EU302616</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD7</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD7*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302617">EU302617</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD8</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD8*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302618">EU302618</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD9</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD9*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302619">EU302619</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD10</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD10*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302620">EU302620</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD11</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD11*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302621">EU302621</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD12</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD13</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD13*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302622">EU302622</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD14</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD14*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302623">EU302623</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD15</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD16</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD17</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD17*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302624">EU302624</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD18</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD19</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD19*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302625">EU302625</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD20</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD20*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302626">EU302626</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD21</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD21*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302627">EU302627</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD22</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD22*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302628">EU302628</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD23</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD23*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302629">EU302629</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD24</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAD24*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302630">EU302630</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD25</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD25*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302631">EU302631</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD26</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD27</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD28</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD28*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302632">EU302632</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD29</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD30</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD30*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302633">EU302633</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD31</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD33</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD35</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD35</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302634">EU302634</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD36</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD36*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302635">EU302635</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD38</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD38</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302636">EU302636</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD39</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD40</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD40*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302637">EU302637</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD41</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD41*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302638">EU302638</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD42</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD42*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302639">EU302639</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD43</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD44</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD44</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302640">EU302640</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD45</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD45</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302641">EU302641</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD47</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD47</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302642">EU302642</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AD48</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAD48</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302643">EU302643</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS1</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS2</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302610">EU302610</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS3</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS3</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302611">EU302611</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS4</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS4</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302651">EU302651</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS5</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS6</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS6</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302612">EU302612</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS7</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS7</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302652">EU302652</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS8</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS8</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302653">EU302653</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS9</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS9</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302654">EU302654</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS10</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS10</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302655">EU302655</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS11</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS11</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302656">EU302656</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS12</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS12</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302657">EU302657</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS13</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS13</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302658">EU302658</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS14</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS16</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS16</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302659">EU302659</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS18</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS20</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS21</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS22</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS22</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302660">EU302660</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS23</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS23</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302661">EU302661</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS24</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS24</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302662">EU302662</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS25</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS25</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302663">EU302663</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS26</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS26</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302664">EU302664</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS27</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS27</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302665">EU302665</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS28</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS29</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS29</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302666">EU302666</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS30</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS30</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302667">EU302667</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS31</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS31</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302668">EU302668</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS32</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS33</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS34</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS35</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS35</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302669">EU302669</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS37</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS37</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302670">EU302670</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS38</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS39</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS39</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302671">EU302671</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS40</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS40</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302644">EU302644</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS41</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS41</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302645">EU302645</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS42</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS42</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302646">EU302646</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS43</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS43</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302647">EU302647</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS44</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS44</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302607">EU302607</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS45</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS46</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS46</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302608">EU302608</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS47</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS47*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302648">EU302648</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS48</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS49</p>
                     </c>
                     <c ca="left">
                        <p>IB</p>
                     </c>
                     <c ca="left">
                        <p>PAS49</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302649">EU302649</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS50</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>PAS50*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302609">EU302609</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS51</p>
                     </c>
                     <c ca="left">
                        <p>IA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS52</p>
                     </c>
                     <c ca="left">
                        <p>II</p>
                     </c>
                     <c ca="left">
                        <p>PAS52</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="EU302650">EU302650</ext-link>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* phages from which high quality TEM micrographs were obtained.</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Carriage rate of phages in different groups and biotypes of <it>P. acnes</it></p>
               </caption>
               <text>
                  <p><b>Carriage rate of phages in different groups and biotypes of <it>P. acnes</it></b>. Phages were induced with 2 &#956;g/ml mitomycin C, lysate sterile filtered and stored for seven days to screen out unstable phages. The lysate was then applied at different concentrations to an overlay plate with the host isolate. If plaques were observed after two days, the sample was regarded positive for phages. (A) A comparison in carriage rate of inducible phages between deep isolates (AD), skin isolates (AS) and biotype IA, IB and II. (B) A comparison of carriage rate of inducible phages in biotype IB between deep isolates and isolates from skin induced by 2 &#956;g/ml mitomycin C.</p>
               </text>
               <graphic file="1471-2180-8-139-1"/>
            </fig>
            <p>Bacterial isolates that did not have any inducible phages using mitomycin C were screened for prophages using a PCR-based approach by amplification of the gene encoding a putative major head protein and <it>recA </it>as a positive control. Only one of the isolates, AS14, was positive in the major head PCR, indicating that only 1/9 of these isolates has phages with similarities to the known major head gene (data not shown).</p>
            <p>The carriage rate of inducible temperate phages in the different biotypes was also examined. Biotypes had previously been determined by sequencing of <it>recA </it>(Holmberg <it>et al</it>, unpublished). Biotype IA had a higher carriage rate than IB (p &lt; 0.01), as did biotype II (p &lt; 0.05). Since biotype IB had a lower carriage rate compared to the other two biotypes, we compared the carriage rate of phages in the isolates determined as biotype IB between deep and superficial isolates of <it>P. acnes</it>. The carriage rate in biotype IB was significantly higher in superficial isolates as compared with isolates from deep infections, since none of the deep tissue isolates biotyped as IB had inducible phages (p &lt; 0.05, see Figure <figr fid="F1">1B</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Bacteriophage morphology and classification</p>
            </st>
            <p>The classification of bacteriophages is mainly based on phage morphology and the nature of the nucleic acid <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. Though other classification systems such as sequence similarities within genes encoding structural proteins have been proposed, classification based on morphology and the nature of the nucleic acid is still the most accepted system <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Forty-nine of the bacteriophages were examined using negative staining and transmission electron microscopy. All examined phages have an icosahedral head of approximately 55 nm in diameter, and a tail composed of 33 segments with a total length of 145&#8211;155 nm and a width of 9&#8211;10 nm. The tail is non-contractile and appears flexible. Most phages have a visible base plate on the tail with attached spikes (see Figure <figr fid="F2">2</figr>, <figr fid="F3">3</figr>). These morphological attributes warrant classification of the phages as <it>Siphoviridae</it>. Thus, this morphology is identical to PA6 <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> and very similar to the <it>P. acnes </it>phages studied by Zierdt <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Also, the phages are very similar morphologically to Siphoviruses isolated from other propionibacteria <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr></abbrgrp>. This classification was further strengthen by amino acid sequence comparison of a part of a putative major head protein with other known phage proteins, using a BLASTp search against GenBank. The best hit was on gp6 from PA6, and the second and third best hit on gp7 from <it>Mycobacterium </it>phage Che9d and gp7 from <it>Mycobacterium </it>phage Halo. All these phages are classified as <it>Siphoviridae</it>.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Electron micrographs of bacteriophages from <it>P. acnes</it></p>
               </caption>
               <text>
                  <p><b>Electron micrographs of bacteriophages from <it>P. acnes</it></b>. Phages were negatively stained with 0.75% uranyl formate and subjected to transmission electron microscopy. The phages have a head of approximately 55 nm in diameter, loaded with genetic material. Their tails have a size of 150 &#215; 10 nm and are flexible and non-contractile. In the lower micrograph, PAD25 is adhering to bacterial cell debris, and two phages have lost their heads. At the attachment site between the phage and the cell debris, a base plate with attached spikes can be observed. All phages were classified as Siphoviruses based on their morphology.</p>
               </text>
               <graphic file="1471-2180-8-139-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p><it>P. acnes </it>bacteriophages classified as Siphoviruses</p>
               </caption>
               <text>
                  <p><b><it>P. acnes </it>bacteriophages classified as Siphoviruses</b>. Phages were negatively stained with 0.75% uranyl formate. All phages were classified as Siphoviruses based on their morphology. No difference in morphology could be observed between the different phages. Several of the phages have empty heads and adhere to bacterial cell debris.</p>
               </text>
               <graphic file="1471-2180-8-139-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Phage specificity</p>
            </st>
            <p>Bacteriophages are generally quite restricted in their host range. There are phages that can infect over bacterial species boundaries, but some phages are species specific and in many cases also specific for certain subgroups (subspecies, serotypes or biotypes, strains) within a species. To determine how specific the isolated phages are, different <it>P. acnes </it>isolates were infected with 48 different phages (see additional file <supplr sid="S1">1</supplr>). Bacterial isolates with inducible phages were generally easy to lyse, with plaque production in nearly 99% (2278/2304) of cases. <it>P. acnes </it>isolate AS12 was significantly more difficult to lyse than other isolates with inducible phages, and only 73% (35/48) of the examined phages caused plaque formation. Similarly, phage PAD8 failed to lyse 19% (9/48) of the examined isolates. In <it>P. acnes </it>isolates without any inducible phages, we could only observe plaque formation in 30% (144/480) of the cases. We also examined the ability of phages to cause lysis in the recently sequenced <it>P. acnes </it>strain KPA171202 (DSM no. 16379) of biotype IB <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. This strain was lysed only by 40% (19/48) of the phage lysates. The different phages are not specific to certain biotypes, but seem to be less lytic against biotype II in isolates with inducible phages, since 23/26 failures to infect and lyse the bacterial isolates were in isolates of biotype II.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Host range analysis</b>. <it>Propionibacterium acnes </it>isolates were plated on TSBA as an overlay assay. Phages isolated from these strains were added to each <it>P. acnes </it>isolate and incubated for two days at anaerobic conditions and were analyzed for plaques. A plus (+) indicates that the bacterial isolate was lysed, and the number of + indicates the quality and extent of the lysis in the bacteria. A minus (-) indicates that no plaques were observed. <it>P. acnes </it>strain KPA171202 is the recently sequenced <it>P. acnes </it>strain. Bacterial isolates AD2-AS52 have inducible phages while bacterial isolates AD1-KPA171202 do not have inducible phages.</p>
               </text>
               <file name="1471-2180-8-139-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Since all of the examined phages have identical morphology, protein pattern and in most cases very high similarity in genes encoding the putative major head protein and an amidase (see Figure <figr fid="F4">4</figr>), we examined if phage host-range could be used as a possible tool to differentiate the phages. Based on the host-range analysis we choose <it>P. acnes </it>isolates KPA171202, AD7, AS1 and AS5 to differentiate the phages and to divide them into different groups. By using these four isolates, we could divide the phages into 9 separate groups (see Fig <figr fid="F5">5</figr>). Sixteen of the examined phages could infect and lyse all four bacterial isolates (host-range group PA I). There is a tendency that phages isolated from biotype II and from skin can infect and lyse all four bacterial isolates, and are classified as host-range group PA I. Also, the only phages that can lyse the prophage-free isolates AD26 and AD27 (PAD21, PAS7 and PAS11) are classified as belonging to the host-range group PA I. Furthermore, none of nine selected phages (PAS2, PAS10, PAS12, PAS40, PAS50, PAD9, PAD20, PAD21 and PAD42) were able to infect and lyse <it>P. avidum</it>, <it>P. granulosum </it>or <it>P. freudenreichii </it>(data not shown). Our results show that isolates lacking inducible temperate phages are more difficult to lyse using phages, than isolates carrying inducible temperate phages and that the phages are specific to <it>P. acnes</it>.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Phylogenetic trees of phages from <it>P. acnes</it></p>
               </caption>
               <text>
                  <p><b>Phylogenetic trees of phages from <it>P. acnes</it></b>. A gene encoding a putative major head protein and a gene encoding a putative amidase were sequenced in nine <it>P. acnes </it>phages and aligned using MacVector ClustalW alignment. Phylogenetic trees were constructed using neighbor joining with best tree mode. The putative major head protein (A) was similar between all <it>P. acnes </it>phages examined and showed the highest similarity to <it>Mycobacterium </it>phage Che9d gp7, but did also have high similarity to <it>Lactococcus </it>phage phiLC3 MHP and <it>Streptococcus </it>phage SM1 gp40. If outgroups were removed (B) four separate groups of major head proteins could be observed. One group with PA6, another with PAS2 and PAS50, a third group with PAD21 and a forth group with PAS10, PAS12, PAS40, PAD9, PAD20 and PAD42. The putative amidase (C) showed similar patterning among the phages with phages PAS2 and PAS50 representing one group closely related to PA6, while the other phages PAS10, PAS12, PAS40, PAD9, PAD20, PAD21 and PAD42 formed a second group. The closest known phage protein with similarity to the putative amidase is represented by <it>Mycobacterium </it>phage PG1 gp49, but more related is <it>P. acnes </it>own amidase.</p>
               </text>
               <graphic file="1471-2180-8-139-4"/>
            </fig>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p><it>P. acnes </it>bacteriophages host-range groups</p>
               </caption>
               <text>
                  <p><b><it>P. acnes </it>bacteriophages host-range groups</b>. The host-range for phages isolated from <it>P. acnes </it>was determined by using a bacterial overlay of different <it>P. acnes </it>isolates and adding phages. Four bacterial isolates (KPA171202, AD7, AS1 and AS5) were used to divide the phages into different host-range groups. Phages in host-range group PA I could infect and lyse all four isolates, PA II all except for KPA171202, PA III (AD7, AS1), PA IV (AD7), PA V (AD7, AS5), PA VI (PAD7, PAS42), PA VII (AS1, AS5), PA VIII (AS1, AS5, KPA171202) and PA IX could not infect and lyse any of the isolates used.</p>
               </text>
               <graphic file="1471-2180-8-139-5"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic analysis of phage genes and proteins</p>
            </st>
            <p>A part of a putative major head gene was sequenced in all isolated phages. The nucleotide sequence was aligned and a phylogenetic tree was reconstructed. The phages could be divided in two distinctly divided groups with the already sequenced phage PA6 forming a third group (see additional file <supplr sid="S2">2</supplr>). The whole gene encoding a putative major head protein was sequenced in nine of these phages, selected based on their partial sequencing and site of isolation (AD/AS), and the amino acid sequences were aligned and a phylogenetic tree was reconstructed (see Figure <figr fid="F4">4</figr>). The <it>P. acnes </it>phage putative major head protein show high similarity to phages isolated from <it>Mycobacterium</it>, <it>Lactococcus </it>and <it>Streptococcus</it>. The already sequenced phage PA6 forms its own group, while PAD9, PAD42, PAS10, PAS12, PAS40 and PAD20 form a large group with similar sequences, even though PAD20 is slightly different. Phages PAS2 and PAS50 form a third group and PAD21 forms a fourth separated group. This pattern is similar to the pattern seen when only using partial sequencing, except that PAD21 now seems to form its own group.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Phylogenetic tree of <it>P. acnes </it>phages based on partial sequencing on a gene encoding a putative major head protein</b>. A part of the gene encoding the putative structural protein major head protein was amplified and sequenced. Obtained nucleotide sequences were compared using MacVector ClustalW Alignment and a phylogenetic tree was constructed using UPGMA and uncorrected p-values with 1000 replications for bootstrap. The phages were divided into two distinct groups, with the recently sequenced phage PA6 forming a third group.</p>
               </text>
               <file name="1471-2180-8-139-S2.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>We further sequenced the gene encoding a putative amidase in these nine phages (see Figure <figr fid="F4">4C</figr>). The phage pattern is similar to what could be seen when aligning the major head protein. However, PA6 is more closely related to PAS2 and PAS50 in this protein, and PAD21 do not form its own group, but have high similarity to the large group of phages. The closest phage similarity is to <it>Mycobacterium </it>phage PG1 gp49, but more closely related is a chromosomally encoded <it>P. acnes </it>amidase.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>We show that more than 70% of the investigated <it>P. acnes </it>isolates are carriers of inducible phages, which is a significantly higher carriage rate of inducible phages than that reported by Webster <it>et al </it>(18%) <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> despite that similar methods were used and isolates were from both skin and deeper infections. This is most likely due to differences in the geographic origin of isolates, and may reflect a difference in <it>P. acnes </it>susceptibility to mitomycin C or strain acquired resistance to phages. There was no overall difference in carriage rate of inducible phages between <it>P. acnes </it>isolated from skin or deep infections, indicating that carriage of phage not necessary leads to an increased virulence of the host strain. Thus it appears that the phages studied here do not carry virulence factors, which is in concordance with the lack of putative virulence factors on the recently published genome of a <it>P. acnes </it>phage <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. It should be noted that at present, we only have information on the presence or absence of inducible phages. However, future studies may very well reveal differences in the gene composition of phages isolated from skin and deep isolates.</p>
         <p>We found that isolates of biotype IB have significantly lower rate of inducible phages as compared to isolates of IA and II. Interestingly, none of the isolates of biotype IB in isolates from deep infections are carriers of inducible phages (0/7), while isolates from skin of biotype IB have a carriage rate of almost 73%. The low carriage rate of inducible phages in AD-isolates typed as IB is further strengthen by the fact that none of these isolates have similarities to the phage major head gene as judged by failure of amplifying this gene in these isolates (data not shown), thus indicating that these isolates do not have any inducible phages and not any prophages with similarities to known <it>P. acnes </it>phages. Thereby it seems like either only biotype IB without phages can cause infections, or that biotype IB loses their phages during infection. If this is the case, it is uncertain why this only happens in biotype IB and not in biotype IA and II. The lower carriage rate in biotype IB is neither due to an increased resistance to phage entrance into the bacterial cell, since biotype IB is equally sensitive to phages as the other biotypes, as judged by additional file <supplr sid="S1">1</supplr>. More research in this specific area is needed to understand this phenomenon.</p>
         <p>When we examined the host isolate specificity of the phages, we found that isolate AS12 was significantly more difficult to lyse than the other isolates with inducible phages. However, AS12 is still highly susceptible to PAS12, indicating that AS12 might differ in a protein or receptor essential for most phages to be able to infect and lyse the bacterial cell. Opposite to this, we found that phage PAD8 did not lyse other isolates as efficiently as other phages. This difference could be caused by the phage favouring a lysogenic state, or that the phage receptor binding to the bacterial cell is less efficient compared to other <it>P. acnes </it>phages. When we added phages to <it>P. acnes </it>isolates without inducible phages, we found that most of these isolates were resistant to phage-mediated lysis. This is not surprising, since these isolates do not have inducible phages and thereby could have a mechanism that makes them resistant against phage infection. The different phages were not specific to certain biotypes. However, most of the failures to infect and cause lysis in the bacterial isolates were in biotype II, possibly indicating that these isolates generally are more resistant to phages, or adapt more easily to them. Grouping of the phages based on host-range did not correlate with biotype, even though there is a tendency that phages from isolates of biotype II are classified as host-range group PA I, thus indicating that phages from isolates of biotype II may have broader infective capacity as compared to biotype IA and IB. The phages also seem to be specific to <it>P. acnes </it>isolates, since none of the examined phages were able to infect and lyse <it>P. avidum</it>, <it>P. granulosum </it>or <it>P. freudenreichii</it>. All phages examined were able to infect and lyse their non-induced parental host, thus indicating that the prophages do not confer superinfection immunity as many other known prophages do <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. This is in concordance with the fully sequenced phage PA6 that does not seem to have a repressor-like protein <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. This may benefit <it>P. acnes </it>phage evolution by more efficient gene transfer between prophages and free phages.</p>
         <p>The phages examined could be divided into three-four groups using phylogenetic analysis of the gene encoding a putative major head protein and an amidase. This differences in sequence stress the fact that the phages in the different groups very well may have other genetic dissimilarities, providing advantages for the phages. It is also obvious that several phages have identical nucleotide sequences and perhaps should be considered as subspecies to certain groups of <it>P. acnes </it>phages. The changes in the gene encoding the major head do not lead to a changed morphology, as seen when comparing PAS50 with the other phage micrographs (see Figure <figr fid="F3">3</figr>). When examining the phage proteins on an SDS-PAGE, all phages have identical protein patterns with four protein bands (17 kDa, 29 kDa, 52 kDa and 54 kDa, data not shown). This indicates that the phages have very similar structural proteins, even though some substitution in amino acids occur, and may reflect an evolutionary pressure to retain the structural proteins.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have induced, identified, and characterized 65 temperate <it>P. acnes </it>phages, classified as Siphoviruses on a morphological basis. These phages are species specific and do not confer superinfection immunity. These results give new insight into the relation between <it>P. acnes </it>and its phages, and contribute to a better understanding of the phage-host interaction.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bacterial isolates</p>
            </st>
            <p>A total of 92 <it>P. acnes </it>isolates were used. These were divided into two groups: 44 isolates from deep infections (AD-isolates, mainly isolated from prosthesis and sternal wires) and 48 isolates from skin from healthy individuals (AS-strain), described in Holmberg <it>et al</it>, unpublished. All isolates from healthy individuals and AD-isolates 1&#8211;16 and 37 are isolated in Lund, Sweden. AD-isolates 17&#8211;32 and 38&#8211;48 are isolated in &#214;rebro, Sweden, and AD-isolate 33&#8211;36 are isolated in Malm&#246;, Sweden. The <it>P. acnes </it>strain KPA171202 (DSM no. 16379), <it>P. avidum </it>(DSM no. 4901), <it>P. granulosum </it>(DSM no. 20458) and <it>P. freudenreichii </it>subsp. <it>freudenreichii </it>(DSM no. 20271) were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany).</p>
         </sec>
         <sec>
            <st>
               <p>Isolation of phages</p>
            </st>
            <p><it>P. acnes </it>isolates were plated from frozen stocks on Tryptic Soy Broth (TSB, Bacto, Mt Pritchard, NSW, Australia) with 1.5% Agar (TSBA, Bacto), and incubated for two days at 37&#176;C under anaerobic conditions. Isolates were inoculated in 10 ml prereduced TSB (rTSB) followed by incubation for three days. TSB was prereduced by 24 h incubation under anaerobic conditions. The cultures were diluted 1:9 in 1 ml rTSB and incubation continued for 8 h. Mitomycin C (Calbiochem EMD Biosciences, San Diego, CA, USA) was added to a final concentration of 2 &#956;g/ml, and incubation continued overnight. Cultures were centrifugated (10 min, 1,500 g, Eppendorf Centrifuge 5415R) and sterile filtered (Millex-GP 33 mm 0.2 &#956;m, Millipore, Billerica, MA, USA) to obtain a phage stock. The phage stock was stored at 4&#176;C for 7 days to clear the stock from unstable phages <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Phages were spotted onto TSBA plates at different concentrations (1:1 &#8211; 1:10,000) after a bacterial overlay of the host <it>P. acnes </it>isolate had been prepared. Plates were incubated for two days at 37&#176;C under anaerobic conditions and examined for plaques. When single plaques were observed, these were picked with a sterile scalpel and transferred to SM-buffer (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 60 mM MgSO<sub>4</sub>(7H<sub>2</sub>O), 0.01% gelatine) followed by elution overnight at 4&#176;C. Phages were propagated by spotting phages on a TSBA plate with a bacterial overlay of its host <it>P. acnes </it>isolate and incubated three days at 37&#176;C under anaerobic conditions. The overlay containing all plaques were transferred to SM-buffer, eluted overnight at 4&#176;C, followed by sterile filtration of the SM-buffer. This method generally generated a concentration of 10<sup>11</sup>&#8211;10<sup>13 </sup>pfu/ml. Phages were named after the host bacterium with a 'P' before the bacterial isolate name. Isolates were regarded as having inducible phages if infectious phages were induced using the method described above. All bacterial isolates that did not have any inducible phages were screened for prophages using a PCR-based amplification of the major head gene (primer pair MHF/MHR) and using <it>recA </it>amplification as a positive control.</p>
         </sec>
         <sec>
            <st>
               <p>Phage host specificity</p>
            </st>
            <p>Forty-eight <it>P. acnes </it>isolates that carried inducible phages and 10 <it>P. acnes </it>isolates that did not carry any inducible phages using mitomycin C were plated on TSBA as an overlay assay. To each plate, 5 &#956;l phage stock (10<sup>10 </sup>pfu/ml) from 48 different phages was added. Plates were incubated for 2 days under anaerobic conditions and examined for plaques. Nine phages (PAS2, PAS10, PAS12, PAS40, PAS50, PAD9, PAD20, PAD21 and PAD42) were also applied to <it>P. avidum</it>, <it>P, granulosum </it>and <it>P. freudenreichii </it>subsp. <it>freudenreichii </it>as an overlay assay.</p>
         </sec>
         <sec>
            <st>
               <p>Electron microscopy</p>
            </st>
            <p>Bacteriophages in a stock concentration of 10<sup>11</sup>&#8211;10<sup>13 </sup>pfu/ml were placed on a carbon coated copper grid and negatively stained (for references see <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>). A 0.75% uranyl formate solution was obtained by dissolving 37.5 mg uranyl formate (BDH Chemicals Ltd., Poole, UK) in 5 ml boiling water, and stabilized with 5 &#956;l 5 M NaOH. Grids were rinsed for 45 sec with 100 &#956;l TBS and blotted off with a filter paper. The sample (5 &#956;l) was added to the grid, left for 45 sec and blotted off with a filter paper. The sample was washed twice with two 100 &#956;l H<sub>2</sub>O drops and blotted off after each wash with a filter paper. The sample was stained for 3 sec with 100 &#956;l 0.75% uranyl formate and then stained for additionally 15&#8211;20 sec with 100 &#956;l 0.75% uranyl formate. Samples were observed using a Jeol JEM 1230 transmission electron microscope operated at 60 kV accelerating voltage, and recorded with a Gatan Multiscan 791 CCD camera.</p>
         </sec>
         <sec>
            <st>
               <p>Phage gene comparison</p>
            </st>
            <p>Phage lysate (10 &#956;l) was boiled for 10 min to release phage DNA from intact phages. A PCR (Eppendorf Mastercycler personal) was run under the following conditions: 95&#176;C 10 min, 35 cycles of 95&#176;C 1 min, annealing temperature 1 min 30 sec and 72&#176;C 1 min 30 sec, ending with 72&#176;C for 10 min. Final concentration in the mixture was 1&#215; buffer, 0.2 mM dNTP mix, 30 mU/&#956;l <it>Taq </it>polymerase, 1.5 mM MgCl<sub>2 </sub>and 1 &#956;M each of the primers. Primers used are described in table <tblr tid="T2">2</tblr>. All samples were run with an annealing temperature of 56.5&#176;C except when using primer pairs PR264/PAR-2 and MHF/MHR where an annealing temperature of 54&#176;C was used. All reagents except for the primers are from Fermentas (Vilnius, Lithuania). PCR products were washed with SpinPrep PCR Clean-up Kit (Novagen, Madison, WI, USA), sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA), and analyzed using an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Sequences were aligned using the Clustal W algorithm <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> and a phylogenetic tree was reconstructed using the MacVector v9.5.2 software package (Cary, NC, USA). The final partial major head gene nucleotide sequences correspond to nucleotides 163&#8211;484 in <it>gp6 </it>from <it>P. acnes </it>bacteriophage PA6. The phylogenetic tree was constructed using UPGMA <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and uncorrected p-values with a bootstrap with 1000 replications. Phylogenetic trees including outgroups with protein comparisons of a putative major head and an amidase were constructed using neighbor joining and poisson-correction with a best tree mode, while phylogenetic trees without outgroups were analysed using uncorrected p-values.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers used</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>Sequence (5'-3')</p>
                     </c>
                     <c ca="left">
                        <p>Reference</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PR264</p>
                     </c>
                     <c ca="left">
                        <p>GCAGGCAGAGTTTGACATCC</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B38">38</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PAR-2</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCCTCATACCACTGGTCATC</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B39">39</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MHF</p>
                     </c>
                     <c ca="left">
                        <p>TCCTGGTTCTATGATTGGTGCG</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MHR</p>
                     </c>
                     <c ca="left">
                        <p>CGGAGACCCCTTCGGATACAC</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MH1F</p>
                     </c>
                     <c ca="left">
                        <p>CGTTTGTGGATGCTCTTGTCA</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MH1R</p>
                     </c>
                     <c ca="left">
                        <p>CCTTCGGATACACCTCAGTAGACA</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MH2F</p>
                     </c>
                     <c ca="left">
                        <p>GCTCTTGGTGCTTCGATTGGT</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MH2R</p>
                     </c>
                     <c ca="left">
                        <p>GATACCCATCAACACCACCCC</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ami1F</p>
                     </c>
                     <c ca="left">
                        <p>GGTTTGAATGGTGTGAAAGGTC</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ami1R</p>
                     </c>
                     <c ca="left">
                        <p>TTTCGGAACATTATATTTGTCACAC</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ami2F</p>
                     </c>
                     <c ca="left">
                        <p>TATCGAGATTTGCGCGGAT</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ami2R</p>
                     </c>
                     <c ca="left">
                        <p>ACCACGAAACGACTCCGC</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Statistical methods</p>
            </st>
            <p>All statistical tests were calculated using the Chi-Square test. All tests were also run with Fischer's exact test with similar results.</p>
         </sec>
         <sec>
            <st>
               <p>Nucleotide sequence accession number</p>
            </st>
            <p>All partial sequences of the gene encoding a putative major head were submitted to GenBank. Accession numbers (<ext-link ext-link-type="gen" ext-link-id="EU302607">EU302607</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU302671">EU302671</ext-link>) are shown in table <tblr tid="T1">1</tblr>. Whole sequences of the gene encoding a putative major head for phages PAS2, PAS10, PAS12, PAS40, PAS50, PAD9, PAD20, PAD21 and PAD42 have accession numbers <ext-link ext-link-type="gen" ext-link-id="EU784673">EU784673</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU784681">EU784681</ext-link> and the gene encoding a putative amidase have accession numbers <ext-link ext-link-type="gen" ext-link-id="EU784682">EU784682</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU784690">EU784690</ext-link>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RL participated in the design of the study and performed the isolation of phages, genetic and protein based characterization of phages, host specificity observations and drafted the manuscript. Electron microscopically examinations were done by MM. AH performed the initial characterization of the <it>P. acnes </it>strains. MR assisted in statistical analysis and revision of the manuscript. MC designed the study and revised the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>Maria Baumgarten is acknowledged for excellent technical assistance. This work was supported by grants from the Swedish Research Council (project 2005-4791), the Foundations of Crafoord, Kock, Jeansson, Zo&#233;gas, Bergvall, &#214;sterlund, Groschinsky, the Scandinavian Society for Antimicrobial Chemotherapy, the Swedish Society for Medicine, and the Royal Physiographic Society. M.C. is the recipient of an Assistant Professorship from the Swedish Research Council.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Acne vulgaris</p>
            </title>
            <aug>
               <au>
                  <snm>Webster</snm>
                  <fnm>GF</fnm>
               </au>
            </aug>
            <source>BMJ</source>
            <pubdate>2002</pubdate>
            <volume>325</volume>
            <fpage>475</fpage>
            <lpage>479</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1123998</pubid>
                  <pubid idtype="pmpid" link="fulltext">12202330</pubid>
                  <pubid idtype="doi">10.1136/bmj.325.7362.475</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Improved detection of infection in hip replacements. A currently underestimated problem</p>
            </title>
            <aug>
               <au>
                  <snm>Tunney</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Patrick</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gorman</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Nixon</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Hanna</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ramage</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Bone Joint Surg Br</source>
            <pubdate>1998</pubdate>
            <volume>80</volume>
            <fpage>568</fpage>
            <lpage>572</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1302/0301-620X.80B4.8473</pubid>
                  <pubid idtype="pmpid" link="fulltext">9699813</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p><it>Propionibacterium acnes</it>: an agent of prosthetic joint infection and colonization</p>
            </title>
            <aug>
               <au>
                  <snm>Zeller</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Ghorbani</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Strady</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Leonard</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mamoudy</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Desplaces</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Infect</source>
            <pubdate>2007</pubdate>
            <volume>55</volume>
            <fpage>119</fpage>
            <lpage>124</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jinf.2007.02.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17418419</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Antibiotic resistance in <it>Propionibacterium acnes</it>. Microbiological and clinical aspects</p>
            </title>
            <aug>
               <au>
                  <snm>Nord</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Oprica</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Anaerobe</source>
            <pubdate>2006</pubdate>
            <volume>12</volume>
            <fpage>207</fpage>
            <lpage>210</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.anaerobe.2006.08.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">17000123</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Antibiotic-resistant acne: lessons from Europe</p>
            </title>
            <aug>
               <au>
                  <snm>Ross</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Snelling</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Carnegie</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Coates</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cunliffe</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Bettoli</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Tosti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Katsambas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Galvan Perez Del Pulgar</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Rollman</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Torok</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Eady</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Cove</snm>
                  <fnm>JH</fnm>
               </au>
            </aug>
            <source>Br J Dermatol</source>
            <pubdate>2003</pubdate>
            <volume>148</volume>
            <fpage>467</fpage>
            <lpage>478</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2133.2003.05067.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12653738</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Genetic basis of resistance in <it>Propionibacterium acnes </it>strains isolated from diverse types of infection in different European countries</p>
            </title>
            <aug>
               <au>
                  <snm>Oprica</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>L&#246;fmark</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lund</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Edlund</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Emtestam</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nord</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Anaerobe</source>
            <pubdate>2005</pubdate>
            <volume>11</volume>
            <fpage>137</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.anaerobe.2005.01.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">16701544</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Detection of prosthetic hip infection at revision arthroplasty by immunofluorescence microscopy and PCR amplification of the bacterial 16S rRNA gene</p>
            </title>
            <aug>
               <au>
                  <snm>Tunney</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Patrick</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Curran</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Ramage</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Hanna</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nixon</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Gorman</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1999</pubdate>
            <volume>37</volume>
            <fpage>3281</fpage>
            <lpage>3290</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">85548</pubid>
                  <pubid idtype="pmpid" link="fulltext">10488193</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Formation of <it>Propionibacterium acnes </it>biofilms on orthopaedic biomaterials and their susceptibility to antimicrobials</p>
            </title>
            <aug>
               <au>
                  <snm>Ramage</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tunney</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Patrick</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gorman</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Nixon</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Biomaterials</source>
            <pubdate>2003</pubdate>
            <volume>24</volume>
            <fpage>3221</fpage>
            <lpage>3227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0142-9612(03)00173-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">12763449</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>The complete genome sequence of <it>Propionibacterium acnes</it>, a commensal of human skin</p>
            </title>
            <aug>
               <au>
                  <snm>Br&#252;ggemann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Henne</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hoster</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Liesegang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wiezer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Strittmatter</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hujer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Durre</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gottschalk</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2004</pubdate>
            <volume>305</volume>
            <fpage>671</fpage>
            <lpage>673</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1100330</pubid>
                  <pubid idtype="pmpid" link="fulltext">15286373</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Insights in the pathogenic potential of <it>Propionibacterium acnes </it>from its complete genome</p>
            </title>
            <aug>
               <au>
                  <snm>Br&#252;ggemann</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Semin Cutan Med Surg</source>
            <pubdate>2005</pubdate>
            <volume>24</volume>
            <fpage>67</fpage>
            <lpage>72</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.sder.2005.03.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">16092793</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Identification, cloning, and expression of the CAMP factor gene (cfa) of group A streptococci</p>
            </title>
            <aug>
               <au>
                  <snm>Gase</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ferretti</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Primeaux</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>McShan</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1999</pubdate>
            <volume>67</volume>
            <fpage>4725</fpage>
            <lpage>4731</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">96801</pubid>
                  <pubid idtype="pmpid" link="fulltext">10456923</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>CAMP factor homologues in <it>Propionibacterium acnes</it>: a new protein family differentially expressed by types I and II</p>
            </title>
            <aug>
               <au>
                  <snm>Valanne</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McDowell</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ramage</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tunney</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Einarsson</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>O'Hagan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wisdom</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Fairley</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bhatia</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Maisonneuve</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Lodes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Persing</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Patrick</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Microbiology</source>
            <pubdate>2005</pubdate>
            <volume>151</volume>
            <fpage>1369</fpage>
            <lpage>1379</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/mic.0.27788-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">15870447</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>f20, a temperate bacteriophage isolated from <it>Bacillus anthracis </it>exists as a plasmidial prophage</p>
            </title>
            <aug>
               <au>
                  <snm>Inal</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Karunakaran</snm>
                  <fnm>KV</fnm>
               </au>
            </aug>
            <source>Curr Microbiol</source>
            <pubdate>1996</pubdate>
            <volume>32</volume>
            <fpage>171</fpage>
            <lpage>175</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s002849900030</pubid>
                  <pubid idtype="pmpid" link="fulltext">8867457</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The LE1 bacteriophage replicates as a plasmid within <it>Leptospira biflexa</it>: construction of an <it>L. biflexa-Escherichia coli </it>shuttle vector</p>
            </title>
            <aug>
               <au>
                  <snm>Girons</snm>
                  <fnm>IS</fnm>
               </au>
               <au>
                  <snm>Bourhy</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ottone</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Picardeau</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yelton</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hendrix</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Glaser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Charon</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2000</pubdate>
            <volume>182</volume>
            <fpage>5700</fpage>
            <lpage>5705</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">94690</pubid>
                  <pubid idtype="pmpid" link="fulltext">11004167</pubid>
                  <pubid idtype="doi">10.1128/JB.182.20.5700-5705.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Bacteriophages of spirochetes</p>
            </title>
            <aug>
               <au>
                  <snm>Eggers</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Casjens</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hayes</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Garon</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Damman</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Oliver</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Samuels</snm>
                  <fnm>DS</fnm>
               </au>
            </aug>
            <source>J Mol Microbiol Biotechnol</source>
            <pubdate>2000</pubdate>
            <volume>2</volume>
            <fpage>365</fpage>
            <lpage>373</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11075907</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Bacteriophage association of streptococcal pyrogenic exotoxin type C</p>
            </title>
            <aug>
               <au>
                  <snm>Goshorn</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Schlievert</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1989</pubdate>
            <volume>171</volume>
            <fpage>3068</fpage>
            <lpage>3073</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">210016</pubid>
                  <pubid idtype="pmpid" link="fulltext">2566595</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Phage-conversion of cytotoxin production in <it>Pseudomonas aeruginosa</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hayashi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Terawaki</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1990</pubdate>
            <volume>4</volume>
            <fpage>1703</fpage>
            <lpage>1709</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.1990.tb00547.x</pubid>
                  <pubid idtype="pmpid">2127632</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Characterization of a bacteriophage that carries the genes for production of Shiga-like toxin 1 in <it>Escherichia coli</it></p>
            </title>
            <aug>
               <au>
                  <snm>Huang</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Friesen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Brunton</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1987</pubdate>
            <volume>169</volume>
            <fpage>4308</fpage>
            <lpage>4312</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">213745</pubid>
                  <pubid idtype="pmpid" link="fulltext">3040688</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Staphylococcal enterotoxin A is encoded by phage</p>
            </title>
            <aug>
               <au>
                  <snm>Betley</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Mekalanos</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1985</pubdate>
            <volume>229</volume>
            <fpage>185</fpage>
            <lpage>187</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.3160112</pubid>
                  <pubid idtype="pmpid" link="fulltext">3160112</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Use of bacteriophage typing to distinguish <it>Propionibacterium acne </it>types I and II</p>
            </title>
            <aug>
               <au>
                  <snm>Webster</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Cummins</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1978</pubdate>
            <volume>7</volume>
            <fpage>84</fpage>
            <lpage>90</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">274863</pubid>
                  <pubid idtype="pmpid" link="fulltext">624772</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Studies on bacteriophages of <it>Propionibacterium acnes</it></p>
            </title>
            <aug>
               <au>
                  <snm>Jong</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Ko</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Pulverer</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Med Microbiol Immunol</source>
            <pubdate>1975</pubdate>
            <volume>161</volume>
            <fpage>263</fpage>
            <lpage>271</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02122714</pubid>
                  <pubid idtype="pmpid">1196261</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Bakteriophagen von <it>Propionibacterium acnes</it></p>
            </title>
            <aug>
               <au>
                  <snm>Pulverer</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sorgo</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Ko</snm>
                  <fnm>HL</fnm>
               </au>
            </aug>
            <source>Zentralbl Bakteriol Parasitenk Infektionskr Hyg 1 Abt Orig A</source>
            <pubdate>1973</pubdate>
            <volume>225</volume>
            <fpage>353</fpage>
            <lpage>363</lpage>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Fermentative and serological studies on <it>Propionibacterium acnes</it></p>
            </title>
            <aug>
               <au>
                  <snm>Pulverer</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ko</snm>
                  <fnm>HL</fnm>
               </au>
            </aug>
            <source>Appl Microbiol</source>
            <pubdate>1973</pubdate>
            <volume>25</volume>
            <fpage>222</fpage>
            <lpage>229</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">380776</pubid>
                  <pubid idtype="pmpid">4632849</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>First evidence of lysogeny in <it>Propionibacterium freudenreichii </it>subsp. <it>shermanii</it></p>
            </title>
            <aug>
               <au>
                  <snm>Herv&#233;</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Coste</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rouault</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fraslin</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Gautier</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>67</volume>
            <fpage>231</fpage>
            <lpage>238</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">92553</pubid>
                  <pubid idtype="pmpid" link="fulltext">11133450</pubid>
                  <pubid idtype="doi">10.1128/AEM.67.1.231-238.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Bacteriophages infecting dairy propionibacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Gautier</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rouault</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sommer</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Briandet</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cassin</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Lait</source>
            <pubdate>1995</pubdate>
            <volume>75</volume>
            <fpage>427</fpage>
            <lpage>434</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1051/lait:19954-532</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Filamentous phage active on the gram-positive bacterium <it>Propionibacterium freudenreichii</it></p>
            </title>
            <aug>
               <au>
                  <snm>Chopin</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Rouault</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ehrlich</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Gautier</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <fpage>2030</fpage>
            <lpage>2033</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">134938</pubid>
                  <pubid idtype="pmpid" link="fulltext">11889111</pubid>
                  <pubid idtype="doi">10.1128/JB.184.7.2030-2033.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Isolation of a virulent bacteriophage from a <it>Propionibacterium </it>species in the sheep rumen</p>
            </title>
            <aug>
               <au>
                  <snm>Cheong</snm>
                  <fnm>JPE</fnm>
               </au>
               <au>
                  <snm>Brooker</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Aust J Agric Res</source>
            <pubdate>2000</pubdate>
            <volume>51</volume>
            <fpage>119</fpage>
            <lpage>123</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1071/AR99069</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>A phage of propionic bacteria (Russian)</p>
            </title>
            <aug>
               <au>
                  <snm>Borisova</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Baranova</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Vorobyeva</snm>
                  <fnm>LI</fnm>
               </au>
               <au>
                  <snm>Trusova</snm>
                  <fnm>ZM</fnm>
               </au>
               <au>
                  <snm>Istomina</snm>
                  <fnm>IB</fnm>
               </au>
               <au>
                  <snm>Gavrina</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Terebkova</snm>
                  <fnm>LS</fnm>
               </au>
            </aug>
            <source>Prikl Biokhim Mikrobiol</source>
            <pubdate>1973</pubdate>
            <volume>9</volume>
            <fpage>246</fpage>
            <lpage>249</lpage>
            <xrefbib>
               <pubid idtype="pmpid">4771039</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Genome sequence and analysis of a <it>Propionibacterium acnes </it>bacteriophage</p>
            </title>
            <aug>
               <au>
                  <snm>Farrar</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Howson</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Bojar</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>West</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Towler</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Parry</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pelton</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Holland</snm>
                  <fnm>KT</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2007</pubdate>
            <volume>189</volume>
            <fpage>4161</fpage>
            <lpage>4167</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1913406</pubid>
                  <pubid idtype="pmpid" link="fulltext">17400737</pubid>
                  <pubid idtype="doi">10.1128/JB.00106-07</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <aug>
               <au>
                  <snm>Fauquet</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Mayo</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Maniloff</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Desselberger</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Ball</snm>
                  <fnm>LA</fnm>
               </au>
            </aug>
            <source>Virus Taxonomy: Eight Report of the International Committee on Taxonomy of Viruses</source>
            <publisher>London: Elsevier Academic Press</publisher>
            <pubdate>2005</pubdate>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Phage taxonomy: we agree to disagree</p>
            </title>
            <aug>
               <au>
                  <snm>Nelson</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2004</pubdate>
            <volume>186</volume>
            <fpage>7029</fpage>
            <lpage>7031</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">523225</pubid>
                  <pubid idtype="pmpid" link="fulltext">15489416</pubid>
                  <pubid idtype="doi">10.1128/JB.186.21.7029-7031.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Properties of <it>Corynebacterium acnes </it>bacteriophage and description of an interference phenomenon</p>
            </title>
            <aug>
               <au>
                  <snm>Zierdt</snm>
                  <fnm>CH</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1974</pubdate>
            <volume>14</volume>
            <fpage>1268</fpage>
            <lpage>1267</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">355644</pubid>
                  <pubid idtype="pmpid" link="fulltext">4431080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Lactococcus lactis lytic bacteriophages of the P335 group are inhibited by overexpression of a truncated CI repressor</p>
            </title>
            <aug>
               <au>
                  <snm>Durmaz</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Madsen</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Israelsen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Klaenhammer</snm>
                  <fnm>TR</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <fpage>6532</fpage>
            <lpage>6544</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">135409</pubid>
                  <pubid idtype="pmpid" link="fulltext">12426341</pubid>
                  <pubid idtype="doi">10.1128/JB.184.23.6532-6543.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Characterization of the lysogeny DNA module from the temperate Streptococcus thermophilus bacteriophage fSF21</p>
            </title>
            <aug>
               <au>
                  <snm>Bruttin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Desiere</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lucchini</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Foley</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Br&#252;ssow</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1997</pubdate>
            <volume>233</volume>
            <fpage>136</fpage>
            <lpage>148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1997.8603</pubid>
                  <pubid idtype="pmpid" link="fulltext">9201223</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Negative staining and image classification &#8211; powerful tools in modern electron microscopy</p>
            </title>
            <aug>
               <au>
                  <snm>Ohi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Walz</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Biol Proced Online</source>
            <pubdate>2004</pubdate>
            <volume>6</volume>
            <fpage>23</fpage>
            <lpage>34</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">389902</pubid>
                  <pubid idtype="pmpid">15103397</pubid>
                  <pubid idtype="doi">10.1251/bpo70</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>A statistical method for evaluating systematic relationships</p>
            </title>
            <aug>
               <au>
                  <snm>Sokal</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Michener</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>The University of Kansas Sci Bull</source>
            <pubdate>1958</pubdate>
            <volume>28</volume>
            <fpage>1409</fpage>
            <lpage>1438</lpage>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Polymerase chain reaction-based identification of <it>Propionibacterium acnes </it>types isolated from the male urinary tract: evaluation of adolescents, normal adults and men with prostatic pathology</p>
            </title>
            <aug>
               <au>
                  <snm>Shannon</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>BJU Int</source>
            <pubdate>2006</pubdate>
            <volume>98</volume>
            <fpage>388</fpage>
            <lpage>392</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1464-410X.2006.06273.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16879683</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p><it>Propionibacterium acnes </it>types I and II represent phylogenetically distinct groups</p>
            </title>
            <aug>
               <au>
                  <snm>McDowell</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Valanne</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ramage</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tunney</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Glenn</snm>
                  <fnm>JV</fnm>
               </au>
               <au>
                  <snm>McLorinan</snm>
                  <fnm>GC</fnm>
               </au>
               <au>
                  <snm>Bhatia</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Maisonneuve</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Lodes</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Persing</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Patrick</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2005</pubdate>
            <volume>43</volume>
            <fpage>326</fpage>
            <lpage>334</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">540145</pubid>
                  <pubid idtype="pmpid" link="fulltext">15634990</pubid>
                  <pubid idtype="doi">10.1128/JCM.43.1.326-334.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
