The MTR analog trifluormethylthioribose (3F-MTR) is toxic if the methyl sulfur moiety of the molecule is recycled 9. This molecule was therefore an excellent candidate to explore the steps needed for MTR recycling to methionine. Mutants were obtained by transformation of a wild type strain with a random transposon library, selecting for growth in the presence of 3F-MTR in the presence of sulfate as sulfur source. The mutants were subsequently tested for growth on plates lacking sulfur source but supplemented with MTR: only those that could not grow were retained for further study. In order to ascertain that the resistant phenotype was not coming from secondary mutations but was directly related to the transposon insert, the chromosome DNA was extracted from each putative mutant and back transformed into a wild type strain selecting for the transposon antibiotic marker. The 3F-MTR and MTR phenotypes were subsequently tested and only those mutants that passed the test were retained. The insertion positions of the transposons were then sequenced. As shown in Figure 1 we recovered mutants in several genes located in the close vicinity of each other. One mutant was located at the mtnK locus (previously named ykrT6), four were located into ykrW and six into the ykrY gene. One clone with transposon insertion into the ykrW gene (strain BSHP7064, insertion situated 353 bp downstream of ykrW translation start point) and one into the ykrY gene (strain BSHP7065, insertion situated 556 bp downstream of ykrY translation start point) were retained for further studies.

Using the collection of the lacZ transcriptional fusion mutants constructed during the Bacilllus subtilis functional analysis program (http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl and http://bacillus.genome.ad.jp, 10) and constructing mutants which were not available in the collection, we tested all genes in the region for their phenotype of growth on MTR as the sole sulfur source. Table 1 displays the results obtained. As we can see, mutants in mtnK (previously identified as coding for MTR kinase 6, strain BFS1850), mtnS (strain BSHP7010 6), ykrU (renamed mtnU, strain BFS1851), ykrW (renamed mtnW, strain BSHP7014 allowing the expression of downstream genes) and ykrY (renamed mtnY, strain BSHP7016) failed to grow on the substrate. In the absence of IPTG ykrX (renamed mtnX, strain BFS1852) also failed to grow, but it recovered its growth properties when IPTG was added to the medium, suggesting some polar effect of the transposon insertion. The mutant of ykrZ (renamed mtnZ, strain BFS1853) presented only a very weak (residual) growth on MTR, suggesting the presence in the cell of some other enzymatic activity able to partially complement the lack of mtnZ gene product. Disruption of ykrV (renamed mtnV, strain BSHP7020) had no visible effect on growth on MTR as the sulfur source.

Several genes in the region have been shown by Henkin and co-workers to be expressed from promoters regulated by the S-box attenuation system 7. This is the case of mtnKS and mtnWXYZ transcription units. Some of the genes, however, are not regulated in this way. Expression of the mtnU and mtnV genes is not subject to that regulation since no S-box is present in their leader transcript. As shown in Figure 2A the promoter of mtnU is located 35 nt from the translation start point. Its start was found to lie 5 nt downstream from a putative -10 box identified in the sequence (TTAAAT). Upstream from this box separated by 18 nt is a -35 box (ATGATA) with sequence similar to the consensus sequence TTGACA that is typical of B. subtilis sigmaA-dependent promoters 11.

The promoter of mtnV is located 42 nt upstream from the translation start point. Its start lies 8 nt downstream from a putative -10 box identified in the sequence (TATGAT) separated by 17 nt from -35 box (TTTACT) (see Fig. 2.B). The mtnU and mtnV genes share the same promoter region (94 nt) but are transcribed in divergent orientation from overlapping promoters. Thus, the -10 box of the mtnV promoter is situated between the -10 and -35 boxes of the mtnU promoter and the -10 box of the mtnU promoter is situated between the -10 and -35 boxes of the mtnV promoter.

The mtnKS promoter region is 326 nt long. Its start was found to lie 7 nt downstream from a putative -10 box identified in the sequence (TACCAT) (see Fig. 2.C). Upstream from this box and separated by 18 nt is a -35 box (TTGACA), a typical B. subtilis sigmaA-dependent promoter. Downstream of this promoter lies an S-box regulatory sequence.

Genes mntWXYZ are expressed from two overlapping promoters that are situated in a 195 nt long region. The upstream P1 promoter's start was found to lie 7 nt downstream from a putative -10 box identified in the sequence (GATAAT) separated by 17 nt from a consensus -35 box (TTGACA). The P2 promoter's start was found to lie 7 nt downstream from a putative -10 box identified in the sequence (TAAAAT) upstream from which is a -35 box (ATGGGA) (see Fig. 2.D). This promoter region is also reminiscent of regions recognized by the developmental sigmaH transcriptional regulator. The -10 box of the P1's promoter and the -35 box of P2 are partly overlapping. The relative intensity of the signals indicates that transcription from the P1 promoter is more abundant than from P2 (see Fig. 2.D).

To further investigate transcription of the mtnVWXYZ genes, RNA synthesis was analyzed by Northern blotting. RNA was extracted from exponentially growing cells, in minimal medium containing either sulfate or methionine as sulfur source. As shown in Figure 3.A, a band of about 1200 nt, corresponding to the expected length of a transcript initiated at the mtnV promoter and terminating near its stop codon, was observed for the mtnV gene probe. An equal intensity of the signal was observed for mtnV transcripts prepared from cells either grown with sulfate or with methionine as sulfur source (lanes 1 and 2, Fig. 3.A).

When mtnW and mtnZ gene specific probes were used, two bands were revealed: one of about 2.5 kb and second of about 3.2 kb (Fig. 3.B and 3.C)). The larger band corresponds to the expected length of a transcript initiated at the mtnW promoter and terminating in a stem and loop structure at the end of the mtnWXYZ transcriptional unit. The smaller band can possibly be the result of RNA processing at the end of the S-box regulatory sequence of the 5' extremity of the transcript. The intensity of bands when hybridizing RNA from cells grown with sulfate as sulfur source was higher than when using RNA from cells grown in the presence of methionine (lane 1 and 2 in Fig. 3.B and 3.C).

As shown previously, mtnK and mtnS are expressed as an operon, while mtnU is expressed independently 6.

To substantiate the results obtained with RNA analysis and further investigate the expression of genes from the mtn region, we constructed mutants carring lacZ transcriptional fusions as well as used some mutants constructed during the functional analysis program (also corresponding to lacZ transcription fusions). Table 2 shows the results obtained with these strains when using sulfate or methionine as sulfur source. The mtnU gene (strain BFS1851, mtnU::lacZ) is expressed constitutively at a fairly low level and its expression is independent of the sulfur source used (62 U/mg of protein in the exponential growth phase in presence of sulfate and 53 U/mg of protein in the exponential growth phase in presence of methionine). In contrast, the mtnV gene (strain BSHP7020, mtnV::lacZ) although expressed in the similar way (constitutive and sulfur source independent expression) is expressed at a significantly higher level (217 U/mg of protein in the exponential growth phase in presence of sulfate and 181 U/mg of protein in the exponential growth phase in presence of methionine).

The genes from the mtnWXYZ transcriptional unit (strains BSHP7014, BFS1852, BSHP7016 and BFS1853 for mtnW::lacZ, mtnX::lacZ, mtnY::lacZ and mtnZ::lacZ, respectively) are expressed in a coordinated and sulfur source-dependent way. The expression of the first gene in the operon (mtnW) is higher than that of the last one (mtnZ) with intermediary values for intermediary genes mtnX and mtnY. This suggests the effect of some transcription polarity during the process of transcription (see Table 2). A 5-fold difference is observed between the expression of the mtnWXYZ genes in the presence of sulfate and that in the presence of methionine (579 U/mg of protein in the exponential growth phase in the presence of sulfate and 113 U/mg of protein in the exponential growth phase in the presence of methionine for the mtnW::lacZ transcriptional fusion and 280 U/mg of protein in the exponential growth phase in presence of sulfate and 57 U/mg of protein in the exponential growth phase in presence of methionine for mtnZ::lacZ transcriptional fusion). This observation is in accordance with the presence of S-box regulatory element in the promoter region of mtnWXYZ operon which modulates gene expression as a function of methionine availability 7.

In order to identify the methionine salvage pathway we made constructs allowing us to decipher the order of the gene products in the pathway, together with in silico, physiologic and genetic analysis of the effect of metabolites of the pathway. This is reminiscent of the way advocated by Koonin et al. for the use of in silico approaches as complement to in vivo experiments 12.

As a first goal we showed that the end product of the pathway is indeed methionine. This was demonstrated by showing that MTR, which is a good sulfur source, can be used as the methionine source in methionine auxotrophs (Fig. 4, Fig. 5 and data non shown).

Two genes in the pathway are dispensable, mtnV and mtnX. The first one encodes a transaminase of which there are nine putative paralogs in the genome of B. subtilis (YwfG, AlaT, AspB, PatA, YhdR, YdfD, PatB, YisV, and HisC). In the same way, MtnX (YkrX) is a member of the phosphatase family pfam00702 (13, Fig. 6), and therefore of a ubiquitous class of hydrolases (several phosphatase genes in particular are present in the genome of B. subtilis). This is likely to account for the lack of phenotype under our growth conditions. Inactivation of mtnZ provides only a very weak, residual growth on MTR. Inactivation of mtnK, mtnS, mtnY and mtnW result in resistance to 3F-MTR and lack of growth on MTR. Inactivation of mtnW with a polar effect on the distal genes (by insertion of a disrupting plasmid) has a phenotype similar to that of mtnY (i.e. lack of growth on MTR, and lack of influence of MTR on sulfate supplemented plates). In contrast, we discovered that MTR is toxic when the distal genes are present (when used as sole sulfur source or even in the presence of sulfate, see Fig. 7). Because of the weak phenotype of a mtnZ mutant and the absence of phenotype of a mtnX mutant, we can be confident that MtnY acts before MtnW (this is a regular feature in operons, where it is often observed that the more distal genes code for proteins acting in the more proximate steps of the pathway).

The methionine salvage pathway has been deciphered in K. pneumoniae. It is possible, combining this knowledge to the genetic and physiologic results just described, to use it at the basis for reconstructing in silico the corresponding metabolic pathway in B. subtilis. The first steps are similar in both organisms: methylthioadenosine is converted into MTR by a nucleosidase (MtnA, 5). Subsequently, MTR is phosphorylated into MTR-1-phosphate by MtnK 6. On the other end of the pathway, methionine is synthesized directly from its keto acid precursor, 2-keto-4-methylthiobutyrate, by a transaminase. MtnV is the likely preferred enzyme for this activity. In K. pneumoniae a dioxygenase is converting 2,3-diketo-5-methylthio-1-phosphopentane into 2-keto-4-methylthiobutyrate 2. Using dynamic programming (FASTA) we compared the sequence of the corresponding protein to the complete proteome of B. subtilis. YkrZ comes out as the first hit, as the most similar enzyme present in the proteome. Furthermore, it displays a strong consensus similarity with the dioxygenases of the family pfam03079 (Fig. 8) 13. In order to check whether dioxygen was indeed involved in the case of B. subtilis we grew the cells anaerobically, with nitrate as an electron acceptor, and tested for growth on MTR: while the wild type strain grew well when sulfate was the carbon source, it failed to grow with MTR (Table 1).

Since this dioxygenase is coded in the mtn operon we can infer that it indeed displays the corresponding activity 12, and we therefore renamed it MtnZ. In K. pneumoniae, the immediate precursor activity is that of a coupled phosphatase. The presence of MtnX, which belongs to family pfam00702 comprising phosphatases is strongly suggestive of its involvement at this step 13. We are thus left with two enzymes, and two steps. We also know, from the genetic data, that the steps are catalyzed in the order MtnY, MtnW. Finally, the reaction needed upstream of MtnZ is active on a molecule phosphorylated in position 1. MtnW is very similar to ribulosephosphate carboxylase oxygenase (Rubisco). It is therefore likely to be active on a ribulose-1-phosphate derivative. Hence MtnY, which is similar to the araD gene product of E. coli (ribulose-5-phosphate epimerase) is most likely to be an epimerase that converts MTR-1-P into 5-thiomethyl-ribulose-1-phosphate, which is the substrate of MtnW. This is strongly supported by the list of similarities found about this gene at the SubtiList database http://genolist.pasteur.fr/Subtilist.

At this stage it is difficult to explicitly identify the activity of MtnW. Even in the case of the paradigmatic Rubisco, with many crystal structures known, the exact mechanism of catalysis is still a matter of controversy. However we can note (as did 8, at a time when they could not propose a function for the protein) that all the residues involved in catalysis have been conserved, the only residues modified being those involved in the binding of the phosphate at position 5 of ribulose diphosphate. The reaction is that of a dehydratase, but the pathway of the reaction is not yet known. Further work will establish the details of the reaction.

Finally MtnU is also defective for MTR recycling. However, this protein is synthesized at a level much lower that that of the other components of the pathway. We can therefore surmise that it is involved in a regulatory step in the pathway.

E. coli and B. subtilis strains as well as plasmids used in this work are listed in Table 3. E. coli TG1 and XL1-Blue were used for cloning experiments (TG1 for single cross-over recombination and XL1-Blue for double cross-over recombination). Despite the fact that there are no public regulations yet in this domain in China, all experiments were performed in accordance with the European regulation requirements concerning the contained use of Genetically Modified Organisms of Group-I (French agreement N° 2735). E. coli and B. subtilis were grown in Luria-Bertani (LB) medium 18 and in ED minimal medium: K₂HPO₄, 8 mM; KH₂PO₄, 4,4 mM; glucose, 27 mM; Na₃-citrate, 0.3 mM; L-glutamine, 15 mM; L-tryptophan, 0.244 mM; ferric citrate, 33.5 μM; MgSO₄, 2 mM; MgCl₂, 0.61 mM; CaCl₂, 49.5 μM; FeCl₃, 49.9 μM; MnCl₂, 5.05 μM; ZnCl₂, 12.4 μM; CuCl₂, 2.52 μM; CoCl₂, 2.5 μM; Na₂MoO₄, 2.48 μM. When methionine was used as sulfur source (1 mM), MgSO₄ was replaced by MgCl₂ at the same magnesium concentration (2 mM). For assaying growth on plates, either the MgSO₄ containing medium or the sulfur-free basal medium was used (MgSO₄ was replaced by MgCl₂ as decribed above). In the latter case, 10 μl of the sulfur source under investigation was applicated onto paper discs (MTR, 200 mM stock solution and methionine, 100 mM stock solution) deposited at the center of the plate, after bacteria had been uniformly spread at the surface of the plate, and growth was measured around the disk. In some cases MTR was used directly in the plate as sulfur source (0.2 mM). When necessary IPTG was included at 1 mM concentration. When xylose was added to the medium (0.5%) in order to trigger the expression of genes under the control of Pxyl inducible promoter, fructose was used as carbon source instead of glucose. LB and ED plates were prepared by addition of 17 g/liter Bacto agar or Agar Noble (Difco), respectively, to the medium. When included, antibiotics were added to the following concentrations: ampicillin, 100 mg/liter; chloramphenicol, 50 mg/liter; spectinomycin, 100 mg/liter; erythromycin plus lincomycin, 1 mg/liter and 25 mg/liter. Bacteria were grown at 37°C. The optical density (OD) of bacterial cultures was measured at 600 nm. MTR was prepared from MTA (Sigma, D5011) by acid hydrolysis as described by Schlenk 19. 3-fluoromethythiorybose (3F-MTR, 5-thio-5-S-trifluoromethyl-D-ribose) was synthesised accordingly to 620. For mutant selection, 3F-MTR was used at 100 mg/liter concentration in the ED minimal medium plates containing magnesium sulfate as sulfur source and glucose as carbon source. When applicated onto paper discs 10 μl of 100 mM stock solution of 3F-MTR was used. For anaerobic growth on plates, the Anaerocult A (Merck) within an anaerobiosis jar for CO2 production with simultanious O2 absorbtion was used. Sulfur-free ED minimal medium plates were supplemented to 1% glucose final concentrtion and with 0.5% sodium pyruvate and 20 mM sodium nitrate as electron acceptor. Plates were incubated at 37°C for 4 days with the sulfur source under investigation.

Standard procedures were used to transform E. coli21 and transformants were selected on LB plates containing ampicillin, spectinomycin or ampicillin plus spectinomycin. B. subtilis cells were transformed with plasmid DNA following the two-step protocol described previously 22. Transformants were selected on LB plates containing erythromycin plus lincomycin or spectinomycin or chloramphenicol.

Plasmid DNA was prepared from E. coli by standard procedures 21. B. subtilis chromosomal DNA was purified as described by Saunders 23. Restriction enzymes and T4 DNA ligase were used as specified by manufacturers.

DNA fragments used for cloning experiments were prepared by PCR using PfuTurbo DNA polymerase (Stratagene). Amplified fragments were purified by QIAquick PCR Purification Kit (Qiagen). DNA fragments were purified from a gel using Spin-X columns from Corning Costar by subsequent centrifugation and precipitation.

The mtnXYZ region (nucleotides -31 relative to the mtnX translation start point and ending 3 bp after the stop codon of mtnZ) was amplified by PCR using primers introducing a SpeI cloning site at the 5' end and a BamHI cloning site at the 3' end of the fragment. This fragment was then inserted into the SpeI and BamHI sites of xylose-inductible pX plasmid 24 producing plasmid pHPP7015. Prior to transformation, this plasmid was linearised at its unique ScaI site. Complete integration of the plasmid was obtained by a double cross-over event at the amyE locus, giving strain BSHP7015.

The DNA downstream from the mtnW gene (nucleotides +41 to +257 relative to the translation start point) was amplified by PCR using primers introducing an EcoRI cloning site at the 5' end and a BamHI cloning site at the 3' end of the fragment, then inserted into the EcoRI and BamHI sites of plasmid pJM783 25 producing plasmid pHPP7014. To introduce an additional antibiotic resistance gene into plasmid pHPP7014, a SmaI restricted spectinomycin resistance cassette 26 was inserted into the ScaI restriction site of the bla gene producing plasmid pHPP7014bis. The plasmid in which the mtnW gene was disrupted as well as fused (transcriptional fusion) with the lacZ gene was introduced into the chromosome of BSHP7015 strain by a single cross-over event, giving strain BSHP7014.

For transcriptional fusion of mtnY with the lacZ gene, a DNA segment downstream from the mtnY gene (nucleotides + 57 to + 264 relative to the translation start point) was amplified by PCR using primers introducing an EcoRI cloning site at the 5' end and a BamHI cloning site at the 3' end of the fragment, then inserted into the EcoRI and BamHI sites of plasmid pJM783 producing plasmid pHPP7016. The plasmid in which the mtnY gene was disrupted as well as fused (transcriptional fusion) with the lacZ gene was introduced into the chromosome by a single cross-over event, giving strain BSHP7016.

To construct a mtnV transcriptional fusion with the lacZ gene, a DNA fragment downstream from the mtnV gene (nucleotides + 44 to + 259 relative to the translation start point) was amplified by PCR using primers introducing an EcoRI cloning site at the 5' end and a BamHI cloning site at the 3' end of the fragment, then inserted into the EcoRI and BamHI sites of plasmid pJM783 producing plasmid pHPP7011. The plasmid in which the mtnV gene was disrupted as well as fused (transcriptional fusion) with the lacZ gene was introduced into the chromosome by a single cross-over event, giving strain BSHP7020.

Within the framework of a European Union and Japanese projects for the functional analysis of the genome of B. subtilis, more than 2000 genes have been disrupted by fusion with the lacZ reporter gene (http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl and http://bacillus.genome.ad.jp). The strains from the collection used in this study, constructed by Dr S. Krogh, are listed in Table 3.

A transposon bank was constructed by introduction of the mini-Tn10 delivery vector pIC333 27 into the B. subtilis 168 strain as described previously 28. Several thousand independent clones were pooled together and 5 samples of chromosomal DNA were prepared for further use. To obtain 3F-MTR resistant clones, B. subtilis 168 was transformed with chromosomal DNA containing previously prepared transposon banks and clones were selected on LB plates containing spectinomycin. Then, using velvets replicas, clones were transferred onto minimal medium plates containing 3F-MTR at 100 μM concentration and allowed to grow for 24 hrs. The single transposon insertion event was confirmed by back-cross into strain 168 and check for 3F-MTR resistance. To determine the location of the transposon insertion, chromosomal DNA was prepared, followed by subsequent digestion with HindIII, self ligation in E. coli XL1-Blue strain and plasmid sequencing. The primers used for sequencing of transposon insertions were the followings: Tn10 left: 5'GGCCGATTCATTAATGCAGGG3' and Tn10 right: 5'CGATATTCACGGTTTACCCAC3'.

Total RNA was obtained from cells growing on ED1 minimal medium with sulfate or methionine as sulfur source to an OD₆₀₀ of 0.5 using "High Pure RNA Isolation Kit" from Roche. The RNA concentration was determined by light absorption at 260 nm and 280 nm. 2 μg of RNA were loaded onto 1.2% agarose gel to check the RNA purity and integrity.

RNA molecules were separated on 1% agarose gels and transfered to nylon membranes (Hybond-N, Amersham). Efficiency of transfer was monitored by analysis of ethidium bromide-stained material. Membranes were prehybridized at 50°C for 1 hr in DIG Easy Hyb buffer from Roche. Hybridization was performed under the same conditions with mtnV, mtnW or mtnZ specific probes using a non-radioactive DNA labeling and detection kit "Dig-UTP labeling" from Roche.

Primer extension analysis using reverse transcriptase AMV (Roche) was performed as described by 29 with two oligonucleotides for each promoter identification. For mtnKS promoter the followings primers were used: 5'ACCAGCGTCTCGGCGCGAAAAAAATGCGCCCC3' and 5'TCACAATGGAATTACGGTCGGTTGCTTTTGG3' (+137 to +169 and +172 to +203 with respect to the translation start point, respectively); for the mtnU promoter the followings primers were used: 5'AGTTCATCAAGATTGGCCAGATCATATCCG3' and 5'CAGGCAGAACAAGAACATCAGCATGTTTGC' (-133 to -103 and -90 to -60 with respect to translation start point, respectively); for the mtnV promoter the followings primers were used: 5'GTTTCATCTCCTCAACAATATGCTCAGGAG' and 5'TCCCAGATTGATAACGTCATGTCCTTCTGC' (-166 to -146 and -114 to -84 with respect to the translation start point, respectively); for the mtnWXYZ promoter the followings primers were used: 5'CGTTTCTCGTCCGAATCTTATCTCTCAGCC' and 5'AGCTGCAAGAATTAGCACCGTGCTTTATAAG' (+43 to +73 and +76 to +107 with respect to the translation start point, respectively). The same primers were used for the generation of sequence ladders. Reaction products were separated on 7% denaturing polyacrylamide gel containing 8 M urea. DNA sequences were determined using Sanger's dideoxy chain-termination method with "Thermo Sequenase radiolabeled terminator cycle sequencing kit" from Amersham Pharmacia Biotech.

B. subtilis cells containing lacZ fusions were assayed for β-galactosidase activity as described previously 30. Specific activity was expressed in Units per mg protein. The Unit used is equivalent to 0.28 nmols min-1 at 28°C. Protein concentration was determined by Bradford's method using a protein assay Kit (Bio-Rad Laboratories). At least two independent cultures were monitored.

Amylase activity was detected after growth of B. subtilis strains on Tryptose Blood Agar Base (TBAB, Difco) supplemented with 10 g/liter hydrolyzed starch (Sigma). Starch degradation was detected by sublimating iodine onto the plates.