<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2164-9-248</ui>
   <ji>1471-2164</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Identification and characteristics of microRNAs from <it>Bombyx mori</it></p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>He</snm>
               <fnm>Ping-an</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>pinganhe@yahoo.com.cn</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Nie</snm>
               <fnm>Zuoming</fnm>
               <insr iid="I1"/>
               <email>wuxinzm@126.com</email>
            </au>
            <au id="A3">
               <snm>Chen</snm>
               <fnm>Jianqing</fnm>
               <insr iid="I1"/>
               <email>cjqgqj@126.com</email>
            </au>
            <au id="A4">
               <snm>Chen</snm>
               <fnm>Jian</fnm>
               <insr iid="I1"/>
               <email>chj1999@126.com</email>
            </au>
            <au id="A5">
               <snm>Lv</snm>
               <fnm>Zhengbing</fnm>
               <insr iid="I1"/>
               <email>zhengbingl@yahoo.com.cn</email>
            </au>
            <au id="A6">
               <snm>Sheng</snm>
               <fnm>Qing</fnm>
               <insr iid="I1"/>
               <email>csheng@zstu.edu.cn</email>
            </au>
            <au id="A7">
               <snm>Zhou</snm>
               <fnm>Songping</fnm>
               <insr iid="I2"/>
               <email>szhou@zjip.com</email>
            </au>
            <au id="A8">
               <snm>Gao</snm>
               <fnm>Xiaolian</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>xgao@uh.edu</email>
            </au>
            <au id="A9">
               <snm>Kong</snm>
               <fnm>Lingyin</fnm>
               <insr iid="I1"/>
               <email>lingyin80@163.com</email>
            </au>
            <au id="A10">
               <snm>Wu</snm>
               <fnm>Xiangfu</fnm>
               <insr iid="I1"/>
               <email>xfwu@sunm.shcnc.ac.cn</email>
            </au>
            <au id="A11" ca="yes">
               <snm>Jin</snm>
               <fnm>Yongfeng</fnm>
               <insr iid="I4"/>
               <email>jinyf@zju.edu.cn</email>
            </au>
            <au id="A12" ca="yes">
               <snm>Zhang</snm>
               <fnm>Yaozhou</fnm>
               <insr iid="I1"/>
               <email>yaozhou@zstu.edu.cn</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Institute of Biochemistry, Zhejiang Sci-Tech University, Hangzhou 310018, PR China</p>
            </ins>
            <ins id="I2">
               <p>College of Science, Zhejiang Sci-Tech University, Hangzhou 310018, PR China</p>
            </ins>
            <ins id="I3">
               <p>Department of Biology and Biochemistry, University of Houston, Houston, Texas 77204-5001, USA</p>
            </ins>
            <ins id="I4">
               <p>Institute of Biochemistry, Zhejiang University, Hangzhou 310029, PR China</p>
            </ins>
         </insg>
         <source>BMC Genomics</source>
         <issn>1471-2164</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>248</fpage>
         <url>http://www.biomedcentral.com/1471-2164/9/248</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18507836</pubid>
               <pubid idtype="doi">10.1186/1471-2164-9-248</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>10</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>28</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>28</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>He et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression by targeting messenger RNAs (mRNAs) and causing mRNA cleavage or translation blockage. Of the 355 <it>Arthropod </it>miRNAs that have been identified, only 21 are <it>B. mori </it>miRNAs that were predicted computationally; of these, only <it>let-7 </it>has been confirmed by Northern blotting.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Combining a computational method based on sequence homology searches with experimental identification based on microarray assays and Northern blotting, we identified 46 miRNAs, an additional 21 plausible miRNAs, and a novel small RNA in <it>B. mori</it>. The latter, <it>bmo-miR-100-like</it>, was identified using the known miRNA <it>aga-miR-100 </it>as a probe; <it>bmo-miR-100-like </it>was detected by microarray assay and Northern blotting, but its precursor sequences did not fold into a hairpin structure. Among these identified miRNAs, we found 12 pairs of miRNAs and miRNA*s. Northern blotting revealed that some <it>B. mori </it>miRNA genes were expressed only during specific stages, indicating that <it>B. mori </it>miRNA genes (e.g., <it>bmo-miR-277</it>) have developmentally regulated patterns of expression. We identified two miRNA gene clusters in the <it>B. mori </it>genome. <it>bmo-miR-2b</it>, which is found in the gene cluster <it>bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b</it>, encodes a newly identified member of the <it>mir-2 </it>family. Moreover, we found that methylation can increase the sensitivity of a DNA probe used to detect a miRNA by Northern blotting. Functional analysis revealed that 11 miRNAs may regulate 13 <it>B. mori </it>orthologs of the 25 known <it>Drosophila </it>miRNA-targeted genes according to the functional conservation. We predicted the binding sites on the 1671 3'UTR of <it>B. mori </it>genes; 547 targeted genes, including 986 target sites, were predicted. Of these target sites, 338 had perfect base pairing to the seed region of 43 miRNAs. From the predicted genes, 61 genes, each of them with multiple predicted target sites, should be considered excellent candidates for future functional studies. Biological classification of predicted miRNA targets showed that "binding", "catalytic activity" and "physiological process" were over-represented for the predicted genes.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Combining computational predictions with microarray assays, we identified 46 <it>B. mori </it>miRNAs, 13 of which were miRNA*s. We identified a novel small RNA and 21 plausible <it>B. mori </it>miRNAs that could not be located in the available <it>B. mori </it>genome, but which could be detected by microarray. Thirteen and 547 target genes were predicted according to the functional conservation and binding sites, respectively. Identification of miRNAs in <it>B. mori</it>, particularly those that are developmentally regulated, provides a foundation for subsequent functional studies.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>MicroRNAs (miRNAs) are a class of endogenous, small, non-coding, single-stranded RNA. They comprise approximately 19&#8211;25 nucleotides that are embedded within the stem regions of hairpin transcripts (called "pre-miRNAs") <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. The first miRNA genes, <it>lin-4 </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and <it>let-7 </it><abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, were identified in <it>Caenorhabditis elegans </it>about a decade ago. Many endogenously encoded miRNAs have been detected in mammals, plants, insects, worms, and viruses through cloning, Northern blotting, microarray assay, sequencing of short RNA molecules <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, and computation <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. By December 2007, 5,395 hairpin sequence entries, containing 5,234 mature miRNAs, have been stored in miRBase <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. Sequence analyses have shown that some mature miRNAs are phylogenetically conserved, particularly in the first 8 residues at the 5' end in species of the same kingdom (<it>let-7 </it>miRNAs are present in the human, mouse, rat, cow, dog, pig, chimpanzee, monkey, fish, and various insects, including <it>Bombyx mori </it>(<it>B. mori</it>)) <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. In rare cases, mature miRNA sequences are conserved between animals and plants. For instance, <it>mir-854</it>, which is conserved in <it>C. elegans</it>, mouse, and human, has also been identified in plants <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. However, hairpin sequences of precursor miRNAs are phylogenetically diverse. In addition to these characteristics, the genomic locations of miRNA precursor genes and the folding structures of miRNAs have been used to identify previously unknown miRNAs <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Lai <it>et al. </it>(2003) <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> stated that three characteristics allow miRNA genes to be identified using computational approaches: (i) miRNAs are generally derived from 70&#8211;100 nucleotide precursor transcripts having an extended stem-loop structure; (ii) miRNAs are usually conserved between genomes of related species; and (iii) miRNAs display a characteristic pattern of evolutionary divergence <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Additionally, genomic mapping of known miRNAs has enabled identification of orthologous miRNAs in other species (e.g., <it>B. mori</it>) where genomic annotations are lacking <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>.</p>
         <p>miRNAs are well-studied RNA interference (RNAi) molecules that silence gene expression of sequence-specific targeted messenger RNAs (mRNAs) in all species in which they have been found <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. miRNAs silence gene expression by inducing miRNA-guided mRNA degradation, or by inhibiting translation by forming a miRNA-protein complex that binds to targeted mRNAs <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Some miRNAs target the non-coding region of a RNA gene transcript <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. miRNAs are a class of small RNAs that have temporal and spatial specific expression patterns, and that have important roles in the development, proliferation, differentiation, transformation, and death of cells <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. miRNAs affect cell fate during all stages of life, from renewable, pluripotent embryonic cells to fully differentiated cells; miRNAs can also affect aberrant cell growth in some tumors and carcinomas <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. The ability of miRNAs to silence gene expression through a post-transcriptional mechanism has promoted their use as genetic tools in basic mechanistic studies; miRNAs are also being developed as biomarkers, therapeutic targets and therapeutic agents.</p>
         <p>Based on computational cross-genome comparison predictions and experimental identifications, over 5,000 miRNAs have been identified in various organisms, including 152 miRNAs from <it>Drosophila melanogaster</it>, 73 from <it>Drosophila pseudoobscura</it>, 54 from <it>Apis mellifera</it>, 45 from <it>Anopheles gambiae</it>, 21 from <it>B. mori</it>, 137 from <it>C. elegans</it>, and 541 human miRNAs (miRBase release 10.1, December 2007). <it>B. mori </it>is a species of <it>Arthropod</it>, closely related to <it>Nematodes </it>and <it>Platyhelminthes</it>. MiRBase contains 355 miRNA genes in <it>Arthropods </it>(mosquito, honey bee and fruit flies), 232 in <it>Nematodes </it>(<it>C. elegans </it>and <it>C. briggsae</it>) and 63 in <it>Platyhelminthes </it>(<it>Schmidtea mediterranea</it>) <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Of the 355 <it>Arthropod </it>miRNAs identified, 21 are <it>B. mori </it>miRNAs that were predicted computationally by our research group <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>; of these, only <it>let-7 </it>has been confirmed by Northern blotting <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>.</p>
         <p>In this study, we report the first set of <it>B. mori </it>miRNA genes from larva, moth and pupa. We established our initial computational method for predicting miRNAs by genome-wide miRNA mapping using the available <it>B. mori </it>genomic sequences and <it>Arthropod </it>miRNAs. We further confirmed their identities using comprehensive microarray profiling and Northern blotting. miRNA targeted genes were predicted according to functional conservation and binding sites. Biological classification of predicted targets was determined by GO analysis.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Prediction of <it>B. mori </it>miRNAs</p>
            </st>
            <p>Based on the sequences of all miRNAs previously identified in <it>Arthropoda</it>, we searched the <it>B. mori </it>genome by BLAST. According to the four criteria described in Materials and Methods, we identified 31 potential <it>B. mori </it>miRNAs and their precursor sequences. Information on predicted <it>B. mori </it>miRNAs, including names, lengths, source, and genomic position, are listed in Table <tblr tid="T1">1</tblr>. The length of the 31 predicted <it>B. mori </it>miRNAs ranged from 19 nt to 26 nt. We used the <it>mfold </it>program to fold each of the 31 predicted <it>B. mori </it>pre-miRNA sequences, ranging in length from 70 nt to 102 nt, and allowing G-U pairing, into hairpin structures <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. The free energy of folding for these hairpin structures ranged from -24.3 kcal/mol to -48.4 kcal/mol.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Information for all 46 predicted <it>B. mori </it>miRNA sequences</p>
               </caption>
               <tblbdy cols="10">
                  <r>
                     <c ca="left">
                        <p>
                           <b>miRNAs</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Size (nts)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>miRBase/first prediction</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Predicted in this study</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Northern blot identification</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Source</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Position</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Number of mismatched bp with <it>Drosophila </it>orthologs</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Number of potential targets</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-let-7a</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GAGGUAGUAGGUUGUAUAGU</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01030021</p>
                     </c>
                     <c ca="left">
                        <p>359&#8211;379</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-let-7a*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACUGUAUAGCCUGCUAACUUU</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01030021</p>
                     </c>
                     <c ca="left">
                        <p>404&#8211;424</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGGAAUGUAAAGAAGUAUGGAG</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01105211</p>
                     </c>
                     <c ca="left">
                        <p>2140&#8211;2161</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-1*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UUCCGUGCUUCCUUACUUCCCA</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01105211</p>
                     </c>
                     <c ca="left">
                        <p>2098&#8211;2124</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-2a-1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAUCACAGCCAGCUUUGAUGAGC</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2892&#8211;2870</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-2a-1*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGCAUCAAAGUCGGUUUGUCAUA</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2929&#8211;2907</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-2a-2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAUCACAGCCAGCUUUGAUGAGC</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2476&#8211;2454</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-2b</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAUCACAGCCAGCUUUGUUGAGU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2355&#8211;2334</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-7</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GUAUGGAAGACUAGUGAUUUUGUUGU</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01189120</p>
                     </c>
                     <c ca="left">
                        <p>2066&#8211;2091</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-8</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAAUACUGUCAGGUAAAGAUGUC</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01175925</p>
                     </c>
                     <c ca="left">
                        <p>75&#8211;53</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-8*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GCAUCUUACCGGGCAGCAUUA</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01175925</p>
                     </c>
                     <c ca="left">
                        <p>115&#8211;95</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-9</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UCUUUGGUUAUCUAGCUGUAUGA</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01140220</p>
                     </c>
                     <c ca="left">
                        <p>35&#8211;56</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-9*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UCAUAAAGCUAGGUUACCGGAG</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01140220</p>
                     </c>
                     <c ca="left">
                        <p>69&#8211;90</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-10</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACCCUGUAGAUCCGAAUUUGU</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01187436</p>
                     </c>
                     <c ca="left">
                        <p>558&#8211;538</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-10*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACAAAUUCGGUUCUAGAGAGGU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01187436</p>
                     </c>
                     <c ca="left">
                        <p>524&#8211;503</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-13a*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCUGUCAAAGCGGCGGUGAAA</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2777&#8211;2757</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-13b</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAUCACAGCCAUUUUUGACGAGU</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01090954</p>
                     </c>
                     <c ca="left">
                        <p>2615&#8211;2593</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-14</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UCAGUCUUUUUCUCUCUCCUA</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01082886</p>
                     </c>
                     <c ca="left">
                        <p>457&#8211;437</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-31</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGCAAGAAGUCGGCAUAGCUG</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01205265</p>
                     </c>
                     <c ca="left">
                        <p>3219&#8211;3239</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-34</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGCAGUGUGGUUAGCUGGUUGUGUA</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01147222</p>
                     </c>
                     <c ca="left">
                        <p>1437&#8211;1471</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>197</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-46</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGUCAUGGAGUUGCUCUCUUUA</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01025185</p>
                     </c>
                     <c ca="left">
                        <p>703&#8211;722</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-46*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGAAGAGAGCUAUCCGUCGACA</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01025185</p>
                     </c>
                     <c ca="left">
                        <p>664&#8211;685</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-71</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGAAAGACAUGGGUAGUGA</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01131802</p>
                     </c>
                     <c ca="left">
                        <p>2236&#8211;2218</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-79</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UUCAUAAAGCUAGAUUACCAAAGCAU</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01113362</p>
                     </c>
                     <c ca="left">
                        <p>535&#8211;510</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-87</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGAGCAAACUUUCAGGUGUGU</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01164262</p>
                     </c>
                     <c ca="left">
                        <p>758&#8211;778</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-133</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UUGGUCCCCUUCAACCAGCUGU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01208622</p>
                     </c>
                     <c ca="left">
                        <p>2993&#8211;3014</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-184</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACUGGACGGAGAACUGAUAAGGGC</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01083504</p>
                     </c>
                     <c ca="left">
                        <p>1684&#8211;1661</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-210</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UUGUGCGUGUGACAGCGGCU</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01031372</p>
                     </c>
                     <c ca="left">
                        <p>2309&#8211;2290</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>95</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-263a</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AAUGGCACUGGAAGAAUUCAC</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01106279</p>
                     </c>
                     <c ca="left">
                        <p>2833&#8211;2853</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-263b</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CUUGGCACUGGGAGAAUUCACAG</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01015424</p>
                     </c>
                     <c ca="left">
                        <p>804&#8211;782</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-263b*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CGUGAAUUUCCCGAUGCCUUA</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01015424</p>
                     </c>
                     <c ca="left">
                        <p>764&#8211;744</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-275</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AGUCAGGUACCUGAAGUAGCGCGCG</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01118959</p>
                     </c>
                     <c ca="left">
                        <p>480&#8211;456</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>41</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-276a</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAGGAACUUCAUACCGUGCUCU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01199848</p>
                     </c>
                     <c ca="left">
                        <p>358&#8211;337</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-276a*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>(C)AGCGAGGUAUAGAGUUCCUA(CG)</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01199848</p>
                     </c>
                     <c ca="left">
                        <p>395&#8211;374</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-277</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAAAUGCACUAUCUGGUACGACA</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01014298</p>
                     </c>
                     <c ca="left">
                        <p>12099&#8211;12121</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-279</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGACUAGAUCCACACUCAU</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01102170</p>
                     </c>
                     <c ca="left">
                        <p>714&#8211;732</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-279*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AUGAGUGGAGGUUUAGUGCA</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01102170</p>
                     </c>
                     <c ca="left">
                        <p>679&#8211;698</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-281a</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACUGUCAUGGAGUUGCUCUCUU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01025185</p>
                     </c>
                     <c ca="left">
                        <p>701&#8211;722</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-281a*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AAGAGAGCUAUCCGUCGACAGU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01025185</p>
                     </c>
                     <c ca="left">
                        <p>666&#8211;687</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-282</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAGCCUCUCCUUGGCUUUGUCUG</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01005896</p>
                     </c>
                     <c ca="left">
                        <p>688&#8211;710</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-283</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UAAAUAUCAGCUGGUAAUUCUGGG</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01105947</p>
                     </c>
                     <c ca="left">
                        <p>466&#8211;443</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-305</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGUACUUCAUCAGGUGCUCUGG</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>Yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01118959</p>
                     </c>
                     <c ca="left">
                        <p>386&#8211;365</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-305*</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CAGGCGCUUGUUGGAGUACACU</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01118959</p>
                     </c>
                     <c ca="left">
                        <p>352&#8211;331</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-307</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CAUCACAACCUCCUUGAGUGAGCGAU</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01178566</p>
                     </c>
                     <c ca="left">
                        <p>1478&#8211;1503</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-317</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AGUGAACACAGCUGGUGGUAUC</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01140584</p>
                     </c>
                     <c ca="left">
                        <p>492&#8211;471</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-bantam</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>UGAGAUCAUUGUGAAAGCUAAUU</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01089624</p>
                     </c>
                     <c ca="left">
                        <p>1355&#8211;1373</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>bmo-miR-100-like</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AACCCGUAGAUCCGAACUUGUG</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>no</p>
                     </c>
                     <c ca="center">
                        <p>yes</p>
                     </c>
                     <c ca="left">
                        <p>BAAB01129141</p>
                     </c>
                     <c ca="left">
                        <p>1755&#8211;1776</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>miRNA microarray assay</p>
            </st>
            <p>Using the predicted <it>B. mori </it>miRNAs as guides, we designed probes to hybridize to targets in total RNA isolated from <it>B. mori </it>pupae and moths. Probes were classified into one of three groups, i.e., those designed to detect: 1) the 31 predicted miRNAs and their opposite-strand miRNAs; 2) the 704 known miRNAs in miRBase, which consist of miRNAs from several species, including six worm species, <it>D. melanogaster </it>(78 probes), <it>D. pseudoobscura </it>(4 probes), <it>A. gambiae </it>(14 probes), <it>A. mellifera </it>(7 probes), <it>C. elegans </it>(114 probes), <it>C. briggsae </it>(39 probes), and human (448 probes); and 3) control sequences, including the 5S rRNA of <it>B. mori </it>and <it>D. melanogaster</it>. The chip contained 954 probes in total. Each probe was repeated three times on the chip to ensure assay reproducibility.</p>
            <p>Microarray results are shown in Figure <figr fid="F1">1</figr>. Comparison of the signal strengths for the miRNAs detected by microarray assays of RNA isolated from <it>B. mori </it>pupa and moth stages are shown in Figure <figr fid="F2">2</figr>. In most cases, results between spots for the same miRNA genes were very consistent in RNA isolated from <it>B. mori </it>pupa and moth (k = 0.908, b = 0.3104, R<sup>2 </sup>= 0.8025). However, expression levels of some miRNAs exhibited obvious differences between the two developmental stages. Sequences exhibiting signal strengths of >80 were considered to be detected miRNA sequences. We detected 114 small RNAs from total RNA isolated from <it>B. mori </it>pupae and moths based on this cutoff. We applied a more stringent analysis by excluding miRNAs differing by only one single base in their sequences or by two bases near sequence ends, and identified 67 miRNAs and a novel small RNA. Of these 67 detected miRNAs, 27 miRNAs belonged to the 31 predicted miRNAs and 12 miRNAs were miRNA*s; another 28 miRNAs were detected only in the microarray assay using probes designed to detect known miRNA from other species. We used these 28 miRNA sequences as query sequences to perform BLAST searches against the <it>B. mori </it>genome. Seven of these sequences were identified in the <it>B. mori </it>genome and their precursor sequences could be folded into hairpin structures and, as such, these seven sequences were likely to be <it>B. mori </it>miRNAs. We designated these sequences <it>bmo-miR-13a*</it>, <it>bmo-miR-14</it>, <it>bmo-miR-46</it>, <it>bmo-miR-46*</it>, <it>bmo-miR-71</it>, <it>bmo-miR-277 </it>and <it>bmo-bantam</it>. Although <it>bmo-miR-13a </it>was one of the 31 miRNAs that were predicted, it was not detected by microarray assay, but its opposite-strand miRNA, named <it>bmo-miR-13a*</it>, was detected. The remaining 21 miRNAs were detected by microarray assay, but were not found in the available <it>B. mori </it>genome (possibly because sequencing of the <it>B. mori </it>genome is incomplete). We considered these 21 miRNAs to be plausible <it>B. mori </it>miRNAs. A novel small RNA was found using a probe designed to detect the known miRNA <it>aga-miR-100</it>. This small RNA was detected by microarray and Northern blotting (Figure <figr fid="F3">3A</figr>) and was identified in the <it>B. mori </it>genome, but its precursor sequence failed to fold into a hairpin structure. This novel small RNA was designated <it>bmo-miR-100-like</it>.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>miRNA chip hybridization in <it>B. mori </it>pupa and moth</p>
               </caption>
               <text>
                  <p>
                     <b>miRNA chip hybridization in <it>B. mori </it>pupa and moth.</b>
                  </p>
               </text>
               <graphic file="1471-2164-9-248-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Signal strength of detected miRNAs by microarray assay in <it>B. mori </it>pupa and moth</p>
               </caption>
               <text>
                  <p><b>Signal strength of detected miRNAs by microarray assay in <it>B. mori </it>pupa and moth.</b> a. all detected miRNAs; b. removed redundant miRNAs; c. <it>B. mori </it>miRNAs. N depicts the signal strength of detected miRNAs.</p>
               </text>
               <graphic file="1471-2164-9-248-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Identification of miRNAs by Northern blotting using DNA probes complementary to the miRNA sequences</p>
               </caption>
               <text>
                  <p><b>Identification of miRNAs by Northern blotting using DNA probes complementary to the miRNA sequences.</b> (A). Northern blotting analysis of the miRNAs that belong to the group of 46 miRNAs identified by microarray assay, including the novel small RNA <it>bmo-miR-100-like</it>. (B). Northern blotting analysis of the miRNAs that belong to the group of 21 plausible <it>B. mori </it>miRNAs. The 5S rRNA band was the loading control. L, larva; P, pupa; M, moth.</p>
               </text>
               <graphic file="1471-2164-9-248-3"/>
            </fig>
            <p>In conclusion, combining computational predictions with microarray assays, we identified 46 <it>B. mori </it>miRNAs, 13 of which were miRNA*s. We identified a novel small RNA and 21 plausible <it>B. mori </it>miRNAs that could not be found in the available <it>B. mori </it>genome, but which was detected by microarray. Detailed information for these 46 miRNAs and the novel small RNA are listed in Table <tblr tid="T1">1</tblr>. The 21 plausible <it>B. mori </it>miRNAs are listed in Table <tblr tid="T1">1</tblr> of Additional file <supplr sid="S1">1</supplr>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>Northern blotting analysis of <it>B. mori </it>miRNAs. The data provided show the results of Northern blotting analysis for miRNAs. One table and three figures are in the file. The table shows the 21 plausible miRNAs identified by Northern blotting. Figure <figr fid="F1">1</figr> displayed the result of Northern blotting analysis for <it>bmo-miR-277</it>. Figure <figr fid="F2">2</figr> shows improvement of the detectable level of miRNA using methylated probes. Figure <figr fid="F3">3</figr> shows the multi-alignment of the members of miRNA <it>let-7 </it>family.</p>
               </text>
               <file name="1471-2164-9-248-S1.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Identification and determination of development-specific expression patterns of <it>B. mori </it>miRNAs by Northern blotting</p>
            </st>
            <p>Northern blotting was done based on microarray assay results to confirm the expression of <it>B. mori </it>miRNAs. Expression of the 46 identified miRNAs, the novel small RNA, and another 21 plausible miRNAs was investigated by Northern blotting of small-sized RNAs isolated from the larva, pupa, and moth stages of <it>B. mori</it>. Twenty-six miRNAs were stably expressed in <it>B. mori </it>in at least one developmental stage (Figure <figr fid="F3">3</figr>). Of these 26 miRNAs, 18 belong to the group of 46 miRNAs identified by microarray assay (Figure <figr fid="F3">3A</figr>) and 7 belong to the group of 21 plausible <it>B. mori </it>miRNAs (Figure <figr fid="F3">3B</figr>); the novel small RNA <it>bmo-miR-100-like </it>is shown in Figure <figr fid="F3">3A</figr>.</p>
            <p>Development-specific expression patterns for some <it>B. mori </it>miRNAs were determined by Northern blotting. Some <it>B. mori </it>miRNA genes were expressed only in certain stages (Figure <figr fid="F3">3</figr>). <it>bmo-miR-1</it>, <it>bmo-let-7a</it>, <it>bmo-miR-8</it>, <it>bmo-miR-14</it>, <it>bmo-miR-276a</it>, <it>bmo-miR-279 </it>were strongly expressed in all developmental stages (larva, pupa and moth). They were uniformly expressed, suggesting that these miRNAs may play an important role in the regulation of some constitutive process <it>in B. mori</it>. Of these miRNAs, <it>bmo-miR-8 </it>has an opposite-strand miRNA, <it>bmo-miR-8</it>*, which was detected by Northern blotting (Figure <figr fid="F3">3A</figr>) at very low levels in larva, pupa and moth. <it>bmo-let-7b</it>, <it>bmo-let-7c</it>, <it>bmo-miR-9, bmo-miR-9</it>*, <it>bmo-miR-100-like</it>, <it>bmo-miR-263a</it>, <it>bmo-miR-31 </it>and <it>bmo-bantam </it>were expressed in larva and pupa, but were not detected in moth; of these miRNAs, <it>bmo-miR-9 </it>and <it>bmo-miR-9</it>* are also complementary miRNAs. <it>bmo-miR-281a</it>, <it>bmo-miR-281a</it>*, <it>bmo-miR-281b</it>*, <it>bmo-miR-13b </it>and <it>bmo-miR-2b </it>were expressed most strongly in larva, although they were also expressed in pupa and moth. <it>bmo-mri-2a</it>, <it>bmo-miR-100</it>, <it>bmo-miR-276b </it>and <it>bmo-let-7d </it>were also expressed in larva, pupa and moth; <it>bmo-mri-2a </it>and <it>bmo-miR-100 </it>were expressed most strongly in pupa; <it>bmo-miR-276b </it>was expressed most strongly in moth; <it>bmo-let-7d </it>was expressed most weakly in moth. <it>bmo-miR-277 </it>was expressed only in moth and not detected in larva and pupa; the precursor of <it>bmo-miR-277 </it>was also detected [see Figure S1 of Additional file <supplr sid="S1">1</supplr>]. Similarly, <it>bmo-miR-289 </it>was expressed weakly only in pupa and was not detected in larva and moth. Expression of a miRNA in a specific developmental stage may suggest a role for it in the developmental process.</p>
         </sec>
         <sec>
            <st>
               <p>Computational prediction of <it>B. mori </it>miRNA targets</p>
            </st>
            <p>In the TarBase database, there are 23 miRNAs that regulate 34 targeted genes in <it>D. elanogaster</it>. miRNA functions could be evolutionally conserved between species such as <it>B. mori </it>and <it>D. melanogaster </it><abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. To deduce the function of <it>B. mori </it>miRNAs, we searched for targeted genes of their orthologous miRNAs reported in <it>D. melanogaster </it>in the TarBase database <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. In the 46 <it>B. mori </it>miRNAs identified, we found 11 miRNAs, belonging to 8 miRNA families; <it>Drosophila </it>orthologs of these 11 miRNAs have been reported in TarBase and are known to regulate the expression of at least 25 genes. These 11 miRNAs may regulate 13 <it>B. mori </it>orthologs of the 25 <it>Drosophila </it>miRNA-targeted genes according to binding [see Additional file <supplr sid="S2">2</supplr>]. <it>Bmo-miR-133 </it>may regulate two <it>B. mori </it>orthologs of <it>Mus musculus </it>miRNA targeted genes, SRF and Ptbp2 because of the perfect binding between miRNAs and the complementary sites. GO analysis showed that "nucleus" was over-represented for <it>Drosophila </it>orthologs of the 13 potential targeted genes.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>Functional analysis of miRNAs in <it>B. mori </it>according to functional conservation between silkworm and fruit fly. The data provided show the detailed information regarding predicting targets of miRNAs in <it>B. mori</it>. Targets were predicted according to the binding between miRNAs and <it>B. mori </it>orthologs of known miRNA targets of fruit fly.</p>
               </text>
               <file name="1471-2164-9-248-S2.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>We calculated the potential binding sites between miRNAs and the 3'UTR of mRNAs to determine the potential miRNA targeted genes more globally. With settings hybrid11 and hybridf22 described in Materials and Methods, we obtained 465 and 262 targeted genes, respectively. One hundred and eighty genes were involved in the two settings simultaneously. Removing redundancy, 547 targeted genes including 986 target sites were predicted. Of these binding sites, 338 had perfect base pairing to the seed region of 43 miRNAs. Of the 46 identified miRNAs, <it>bmo-miR-279 </it>was the only one for which we failed to find target sites. Certain miRNAs may have more than one target, and some predicted targets may be regulated by more than one miRNA [see Additional file <supplr sid="S3">3</supplr> and Table <tblr tid="T1">1</tblr>]. Additionally, we found 61 3'UTRs that each contain multiple potential binding sites to a single miRNA [see Additional file <supplr sid="S3">3</supplr>]; these miRNA-mRNA duplexes showed higher specificity than others. Grun <it>et al</it>. (2005) predicted that at least15% of <it>D. melanogaste</it>r genes were regulated by at least one known miRNA <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Using settings hybrid11 (hybridf22), we found that 28% (16%) of annotated 1671 3'UTR sequences (corresponding to 1671 genes) had at least one binding site to miRNAs identified in this study. Compared with hybrid11, hybridf22 showed a significantly higher specificity. Biological classification of predicted miRNA targets was done by GO analysis to obtain insight into the function of <it>B. mori </it>miRNAs. GO analysis was completed by submitting gene sequences online (see Materials and Methods). In the predicted targets with settings hybrid11 (hybridf22), 360 (214) genes were assigned to the GO terms of "molecular function" ontology by BLAST, "binding" and "catalytic activity" of which over-represented for the 360 (214) genes; in the "biological process" ontology, "physiological process" over-represented among the 277(184) genes which were predicted with setting hybrid11 (hybridf22) and assigned to GO terms by BLAST [see Additional file <supplr sid="S3">3</supplr>].</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p>Functional analysis of miRNAs in <it>B. mori </it>according to binding sites between miRNAs and mRNAs. The data provided show the detailed information for miRNA-targeted genes predicted according to binding sites on 3'UTR of mRNAs. There are six sheets in the EXCEL file, including hybrid11, hybridf22, combination with no redundancy, statistics of binding sites, Go analysis, and binding sites of <it>profilin</it>. Sheet hybrid11 shows detailed information of predicted target genes using setting hybrid11; sheet hybridf22 shows detailed information of predicted target genes using setting hybridf22; sheet 3, named "combination with no redundancy", shows the results for the sheet hybrid11 and hybridf22 after removing redundancy; sheet 4, named "statistics of binding sites", shows the results of statistic analysis for all genes that were found to have more than one binding site; sheet 5, named "Go analysis", shows the results of Go analysis of predicted targeted genes; and sheet 6, named "binding sites of <it>profilin</it>", shows information of the potential binding sites between the <it>B. mori profilin </it>gene and miRNAs.</p>
               </text>
               <file name="1471-2164-9-248-S3.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>We identified 46 miRNAs from <it>B. mori </it>using computational analyses and microarray assays. Of these 46 putative miRNAs, 18 were also confirmed by Northern blotting (Figure <figr fid="F3">3</figr>); although the remaining miRNAs were not detected by Northern blotting, they were considered to be miRNAs because they were detected by microarray and their precursors could adopt a hairpin structure. The reason why some miRNAs could not be detected by Northern blotting may be due to expression below the detection limit, or the very narrow temporal expression window for these miRNAs.</p>
         <p>Methylated RNA probes have been employed by some research groups for RNA detection <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>. We found that methylation of the DNA probe used to detect miRNA by Northern blotting could increase sensitivity. Using methylated DNA probes, signal strength was significantly improved in Northern blots for <it>bmo-miR-14 </it>and <it>bmo-miR-8*</it>, which could not be detected using non-methylated DNA probes [see Figure S2 of Additional file <supplr sid="S1">1</supplr>]. Improvement may be due to the effect of methylation on base pairing of the probe with the target, or on the secondary structure of the probe.</p>
         <sec>
            <st>
               <p>Analysis of <it>B. mori </it>miRNAs clusters</p>
            </st>
            <p>miRNA clusters have been reported in many species. A cluster usually contains two or three miRNA genes, although larger clusters have also been identified, such as the six-member <it>hsa-miR-17 </it>cluster <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp> or the <it>D. melanogaster </it>cluster containing eight miRNA genes <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Clustered miRNA genes can share a high degree of similarity in nucleotide composition, but occasionally the miRNA sequences differ significantly <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B46">46</abbr></abbrgrp>. Expression profiles for clustered genes are also very similar, raising the possibility that transcription of these miRNAs is controlled by a common regulatory element <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. Examining the positions of the identified miRNAs in the <it>B. mori </it>genome, we identified two miRNA clusters (Figure <figr fid="F4">4</figr>): <it>bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b</it>; and <it>bmo-miR-275/bmo-miR-305/bmo-miR-305*</it>. The lengths of the two cluster sequences were 498 and 208 bp, respectively. Genes in the cluster containing <it>bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b </it>are members of the <it>mir-2 </it>miRNA family. This cluster contains <it>bmo-miR-2a</it>, which can be derived from two different precursor miRNAs transcribed from two paralogous miRNA genes, <it>bmo-miR-2a-1 </it>and <it>bmo-miR-2a-2</it>. The opposite strand to <it>bmo-miR-2a-1 </it>also encodes a miRNA. Searching miRBase, we found that the <it>bmo-miR-2a </it>sequence was identical to the <it>dme-miR-2a</it>, <it>dps-miR-2a</it>, <it>ame-miR-2</it>, and <it>aga-miR-2 </it>sequences, but we failed to identify any other miRNA that had the same sequence as <it>bmo-miR-2b </it>(Figure <figr fid="F5">5</figr>); therefore, <it>bmo-miR-2b </it>is a newly identified member of the <it>mir-2 </it>miRNA family. Searching the <it>D. melanogaster </it>and <it>A. gambiae </it>miRNAs, we found that corresponding <it>mir-2 </it>and <it>mir-13 </it>family members also assembled into clusters in these two species. <it>mir-2 </it>and <it>mir-13 </it>repress translation of the target genes, <it>grim, skl </it>and <it>rpr</it>, suggesting that they may be involved in regulating apoptosis <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. The cluster <it>bmo-miR-275/bmo-miR-305/bmo-miR-305* </it>is also found in <it>D. melanogaster, D. pseudoobscura </it>and <it>A. gambiae</it>. <it>bmo-miR-275 </it>and <it>bmo-miR-305 </it>belong to different miRNA families, <it>mir-275 </it>and <it>mir-305</it>. The functions of these two miRNA families remain unknown.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Secondary structures of miRNA clusters</p>
               </caption>
               <text>
                  <p><b>Secondary structures of miRNA clusters.</b> a. <it>bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b</it>; b. <it>bmo-miR-275/bmo-miR-305/bmo-miR-305*</it>.</p>
               </text>
               <graphic file="1471-2164-9-248-4"/>
            </fig>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Homologous analysis of <it>mir-2 </it>family</p>
               </caption>
               <text>
                  <p><b>Homologous analysis of <it>mir-2 </it>family.</b><it>bmo-miR-2b </it>is considered to be a new member of the <it>mir-2 </it>family. (A), Multi-alignment of <it>mir-2 </it>family miRNAs. (B), Hairpin structure of the precursor of <it>bmo-miR-2b</it>.</p>
               </text>
               <graphic file="1471-2164-9-248-5"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Analysis of <it>B. mori </it>miRNAs</p>
            </st>
            <p>The identified 46 <it>B. mori </it>miRNAs belonged to 29 miRNA families based on sequence similarity (Table <tblr tid="T2">2</tblr>). Among the 46 identified miRNAs, we found 12 pairs of miRNAs and miRNA*s. Scanning miRBase, we determined that seven of these 12 miRNA*s had not been reported. These newly identified miRNAs are <it>bmo-miR-2a*, bmo-miR-8*, bmo-miR-13a*, bmo-miR-46*, bmo-miR-263*, bmo-miR-279*</it>, and <it>bmo-miR-305*</it>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Comparisons of sequence similarity between <it>B. mori </it>miRNAs and corresponding miRNA family members</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Index</p>
                     </c>
                     <c ca="left">
                        <p>Family</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Mature</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Pre-miRNA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Count</p>
                     </c>
                     <c ca="left">
                        <p>Similarity</p>
                     </c>
                     <c ca="left">
                        <p>Count</p>
                     </c>
                     <c ca="left">
                        <p>Similarity</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>bantam</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>>91% a</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>***</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>let-7</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>72</p>
                     </c>
                     <c ca="left">
                        <p>>80% a</p>
                     </c>
                     <c ca="left">
                        <p>101</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>>86% a</p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>>92% a</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-7</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>>85%</p>
                     </c>
                     <c ca="left">
                        <p>41</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-8</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-9</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>>83% a</p>
                     </c>
                     <c ca="left">
                        <p>48</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-10</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>>86% a</p>
                     </c>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-14</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-31</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>>81%</p>
                     </c>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-34</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>>80% a</p>
                     </c>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-46</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>>90%</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-71</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>***</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-79</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>>90%</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-87</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>>92%</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-133</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p>>88% a</p>
                     </c>
                     <c ca="left">
                        <p>37</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-184</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>>90% a</p>
                     </c>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-210</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>>90% a</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-263</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>>80%</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-275</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>***</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-276</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>>91% a</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-277</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>***</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-279</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>***</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-281</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>>83%</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-282</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>>85%</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-283</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-305</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-307</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>100%</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>mir-317</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>>92% a</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>**</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>family: the name of miRNA family; count: the number of miRNAs in other species in the same miRNA family; similarity: the similarity between the sequences of <it>B. mori </it>miRNAs and the sequences of other members of the same family; the letter "a" denotes that this miRNA is identical to other mature miRNAs in the family; * denotes that this miRNA is only highly conserved in the miRNA-encoding region; ** denotes that this miRNA is highly conserved in the miRNA-encoding region and its opposite-strand region (miRNA*-encoding region); *** ** denotes that this miRNA is highly conserved in the precursor sequences.</p>
               </tblfn>
            </tbl>
            <p>Observing the orthologous miRNA genes for each family in miRBase, we found that 15 of the 29 families are exclusive to <it>Arthropoda</it>; the other 12 families are found in many species, including five species of <it>Arthropoda</it>. miRNAs having the most orthologs are <it>mir-133 </it>and <it>mir-9</it>, which are found in 25 and 23 animal species, including <it>D. melanogaster </it>and <it>C. elegans</it>.</p>
            <p>We determined the number of orthologous and paralogous genes for each detected miRNA. The <it>let-7 </it>miRNA family contains the most members; 77 <it>let-7 </it>family members were identified in miRBase [see Figure S3 of Additional file <supplr sid="S1">1</supplr>].</p>
         </sec>
         <sec>
            <st>
               <p>Analysis of <it>B. mori </it>precursor miRNA sequences</p>
            </st>
            <p>Variations in pre-miRNA sequences are related to their evolutionary history <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, so we compared the sequences of <it>B. mori </it>pre-miRNAs and members of the same family of pre-miRNAs in the miRBase database (Table <tblr tid="T2">2</tblr>). The number of the pre-miRNAs is greater than the number of mature miRNAs because mature miRNAs can be derived from two or more pre-miRNAs. This is consistent with the literature: mature miRNAs are conserved, but pre-miRNAs are diverse <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>.</p>
            <p>Members of the <it>bantam</it>, <it>mir-71, mir-275, mir-277, mir-279 </it>miRNA families have a high degree of similarity in their precursor sequences. <it>bmo-miR-279 </it>and other <it>mir-279 </it>precursor sequences have sequence similarities of >55%; <it>bmo-miR-277 </it>precursors share >56% sequence similarity; <it>bmo-miR-27 </it>precursors share >57% sequence similarity; <it>bmo-miR-71 </it>precursors share >59% sequence similarity; and <it>bmo-bantam </it>precursors share >60% sequence similarity.</p>
            <p>Based on the results of our sequence comparisons, we determined the phylogenetic tree for each miRNA family using the DNAStar MegAlign program to analyze evolutionary relationships between miRNA members from each family. Many of the <it>B. mori </it>miRNA families were found only in <it>Arthropoda</it>; their mature and pre-miRNAs are highly conserved. For these miRNAs, we found that these <it>B. mori </it>miRNAs have close evolutionary relationships with <it>A. mellifera</it>, and <it>A. gambiae </it>miRNAs. We found that these <it>B. mori </it>miRNAs are located on the same branches of the phylogenetic tree as related miRNAs from <it>D. melanogaster</it>, <it>D. pseudoobscura</it>, <it>A. mellifera</it>, and <it>A. gambiae</it>. The phylogenetic tree for the <it>mir-1 </it>and <it>mir-184 </it>miRNA family is shown in Figure <figr fid="F6">6</figr>; other detailed results are listed in Additional file <supplr sid="S4">4</supplr>.</p>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p>Phylogeny trees for each of miRNA families. The data provided show the phylogeny trees for each of miRNA families in <it>B. mori</it>.</p>
               </text>
               <file name="1471-2164-9-248-S4.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Phylogenetic tree of the <it>mir-1 </it>family and the <it>mir-184 </it>family</p>
               </caption>
               <text>
                  <p>
                     <b>Phylogenetic tree of the <it>mir-1 </it>family and the <it>mir-184 </it>family.</b>
                  </p>
               </text>
               <graphic file="1471-2164-9-248-6"/>
            </fig>
            <p>We compared the hairpin structures of <it>B. mori </it>miRNA precursor sequences to those of related <it>D. melanogaster, D. pseudoobscura</it>, <it>A. mellifera</it>, and <it>A. gambiae </it>miRNA precursor sequences. Conserved regions of the precursors are found in two arms of the stem-loop structure. The results of comparisons between the hairpin structures of <it>bmo-miR-1, aga-miR-1, ame-miR-1, dme-miR-1 </it>and <it>dps-miR-1 </it>precursors are shown in Figure <figr fid="F7">7</figr>. Additional file <supplr sid="S5">5</supplr> shows the secondary structures of <it>B. mori </it>miRNAs. These results strongly indicate that the identified 46 <it>B. mori </it>sequences are miRNAs.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Comparison of the secondary structures of <it>bmo-miR-1</it>, <it>aga-miR-1</it>, <it>ame-miR-1</it>, <it>dme-miR-1 </it>and <it>dps-miR-1</it></p>
               </caption>
               <text>
                  <p>
                     <b>Comparison of the secondary structures of <it>bmo-miR-1</it>, <it>aga-miR-1</it>, <it>ame-miR-1</it>, <it>dme-miR-1 </it>and <it>dps-miR-1</it>.</b>
                  </p>
               </text>
               <graphic file="1471-2164-9-248-7"/>
            </fig>
            <suppl id="S5">
               <title>
                  <p>Additional file 5</p>
               </title>
               <text>
                  <p>Detailed information of all the 46 identified miRNAs in <it>B. mori</it>. The data provided show the detailed information of all the 46 identified miRNAs in <it>B. mori</it>, including sequences of the pre-miRNA and mature miRNA, the complementary region of miRNAs, the secondary structure of pre-miRNA, and the minimum energy.</p>
               </text>
               <file name="1471-2164-9-248-S5.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Computational prediction of <it>B. mori </it>miRNA targets</p>
            </st>
            <p>MiRNA can regulate the protein expression of genes based on the level of complementarity between miRNA seed sequences and binding sites on target mRNA <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr><abbr bid="B51">51</abbr></abbrgrp>. For animals, the seed sequences of miRNA can bind to complementary sites on 3'UTR of its targeted gene. Complementary sites in targeted genes and seed sequences of miRNAs may be conserved in various species; this may result in the functional conservation of miRNAs, and the orthologous miRNAs may regulate orthologs of the targeted genes. The prediction for miRNA targeted genes according to functional conservation may offer additional insights into the function of miRNAs. Grun <it>et al. </it>(2005) computed the conserved regulatory microRNA-mRNA relationships <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. They found that 50 unique gene pairs were predicted to be targeted by homologous microRNAs, including 60 microRNA-mRNA regulatory relationships <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Weaver <it>et al. </it>(2007) demonstrated that some microRNAs function in the same or similar way in <it>Drosophila </it>and bee (e.g., <it>mir-9a </it>may control sensory organ precursors (SOPs) between <it>Drosophila </it>and bee) <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Functional prediction based on cross-species conservation may provide a reference for studying on the functions of <it>B. mori </it>miRNAs. Based on this method, we identified 12 miRNAs that regulate 15 potential targeted genes [see Additional file <supplr sid="S2">2</supplr>]. Most <it>Drosophila </it>orthologs of these potential targeted genes were the vital genes for development, including transcriptional regulator, apoptosis-related genes and genes involved in signal transduction pathways. <it>mir-2 </it>controls HLHmdelta, and <it>mir-7 </it>controls HLHm3, HLHm5, HLHmgamma, M4 and TOM, in <it>D. melanogaster</it>; these six genes are involved in the Notch signaling pathway. <it>B. mori </it>homologs [GenBank: Bmo.1984 and Bmo.4220] of these six genes can bind perfectly to <it>mir-2 (bmo-miR-2a</it>, <it>bmo-miR-2b</it>, <it>bmo-miR-13a* </it>and <it>bmo-miR-13b</it>) and <it>bmo-miR-7</it>, respectively. <it>mir-2 </it>and <it>mir-7 </it>may be related to the Notch signaling pathway in <it>B. mori</it>; this hypothesis is consistent with previous predictions <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B53">53</abbr></abbrgrp>. Cross-species comparisons allow for the identification of evolutionarily conserved and probable functional target sites. The 12 miRNAs could play parts in the development of <it>B. mori </it>by regulating their targeted genes, including the 15 potential targeted genes identified in this study.</p>
            <p>We predicted many miRNA targeted genes by calculating target sites. Interestingly, we have studied <it>B. mori profilin </it>gene [GenBank: <ext-link ext-link-type="gen" ext-link-id="EF112402">EF112402</ext-link>]; there was not a linear relationship between the transcription level of this gene and protein expression (data not shown). The long 3'UTR of this gene was found to have nine potential binding sites [see Additional file <supplr sid="S3">3</supplr>]. Profilin plays an important part in biologically active cellular compartments <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>. It regulates the polymerization, depolymerization, and dynamics of actin, which are important for determining cell shape and movement through the cytoplasm <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>.</p>
            <p>We can predict miRNA targets specifically according to the level of complementarity between the seed region of miRNA and 3'UTR of mRNA <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. We set stringent settings for base pairing of binding sites (see Materials and Methods) based on this knowledge. Applying these settings, many targets predicted by functional conservation, such as <it>B. mori </it>homologs of HLHmdelta and M4, would not have been predicted because of stringent filtering of the settings for miRNA-mRNA duplexes. However, using the settings, the predicted binding sites of targets can bind perfectly to miRNA, and the target sites belong mainly to the three categories of known miRNA target sites classified by Sethupathy <it>et al. </it>(2006)<abbrgrp><abbr bid="B49">49</abbr></abbrgrp> [see Additional file <supplr sid="S3">3</supplr>]. Nevertheless, we identified too many potential binding sites to test experimentally. According to a previous suggestion <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>, genes with multiple predicted target sites (61 genes here accounting for 11% of all predicted targets) should be considered strong candidates for future functional studies.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We identified 46 <it>B. mori </it>miRNAs, 13 of which were miRNA*s, by combining computational predictions with microarray assays. We identified a novel small RNA and 21 plausible <it>B. mori </it>miRNAs that could not be found in the available <it>B. mori </it>genome, but which were detected by microarray. The small novel RNA, <it>bmo-miR-100-like</it>, was identified using the known miRNA <it>aga-miR-100 </it>as a probe; it was detected by microarray assay and Northern blotting, but its precursor sequences failed to fold into a hairpin structure. Northern blotting revealed that some <it>B. mori </it>miRNA genes were expressed only during specific stages, indicating that <it>B. mori </it>miRNA genes have developmentally regulated expression patterns. For example, <it>bmo-miR-277 </it>was expressed only during the moth stage. We identified two miRNA gene clusters in the <it>B. mori </it>genome, and <it>bmo-miR-2b </it>was identified as a new member of the <it>mir-2 </it>family. We found that methylation of the DNA probe used to detect the miRNA by Northern blotting may increase its sensitivity. According to functional conservation in various species, we predicted that 11 miRNAs may regulate 13 <it>B. mori </it>orthologs of the 25 known <it>Drosophila </it>miRNA-targeted genes. A total of 547 targeted genes were predicted from 1671 <it>B. mori </it>genes according to the target sites predicted by settings hybrid11 and hybridf22. From the predicted genes, 61 genes each contained multiple predicted target sites and could be candidates for the functional study of miRNA. Three GO terms, "binding", "catalytic activity" and "physiological process", were over-represented for the predicted genes.</p>
         <p>Identification of putative miRNAs in other organisms is a worthwhile approach for increasing the understanding of the roles of miRNA. Identification of miRNAs in <it>B. mori </it>may help to elucidate the mechanisms underlying simple and complex regulation of the 42-day lifecycle of <it>B. mori</it>, which consists of six periods of ecdysis and four periods of metamorphosis.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>miRNA reference sets and the <it>B. mori </it>genome</p>
            </st>
            <p>Prediction and identification of miRNAs in <it>B. mori </it>is shown in Figure <figr fid="F8">8</figr>. We downloaded 78 miRNAs from <it>D. melanogaster</it>, 73 from <it>D. pseudoobscura</it>, 25 from <it>A. mellifera</it>, 38 from <it>A. gambiae</it>, and their precursor sequences from MicroRNA Registry release 7.1 <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B55">55</abbr></abbrgrp>. These sequences were used as a reference set to predict miRNA in <it>B. mori</it>. Genomic sequences for <it>B. mori </it>were downloaded from the Beijing Genomics Institute <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B56">56</abbr></abbrgrp>. The total size of <it>B. mori </it>genome is 428.7 Mb, containing 23,156 scaffolds and 66,482 contigs.</p>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>Predictions and microarray assays for miRNA in <it>B. mori</it></p>
               </caption>
               <text>
                  <p>
                     <b>Predictions and microarray assays for miRNA in <it>B. mori</it>.</b>
                  </p>
               </text>
               <graphic file="1471-2164-9-248-8"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Prediction of <it>B. mori </it>miRNAs by homology search</p>
            </st>
            <p>We used the sequences of known miRNAs (<it>vide supra</it>) and pre-miRNAs in the reference set as query sequences for BLAST searches against the <it>B. mori </it>genome; we used a word size of seven and an E-value cutoff of ten.</p>
            <p>Four criteria were used to predict <it>B. mori </it>miRNAs and pre-miRNAs according to BLAST search results: (1) there was >80% similarity between each potential <it>B. mori </it>miRNA and the corresponding miRNA in the reference set; (2) the difference in the lengths between each potential <it>B. mori </it>pre-miRNA and the corresponding pre-miRNA in reference set was &lt;5-nt, and the corresponding positions of the mature miRNAs in their pre-miRNAs were nearly identical; (3) the lowest free energy for folding of the secondary structures for each potential <it>B. mori </it>pre-miRNA, as predicted by the <it>mfold </it>program <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, was less than -20 kcal/mol; and (4) the secondary structures of the predicted pre-miRNA satisfied the requirements set out in reference <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, i.e., a potential fold-back precursor structure must contain the ~22-nt miRNA sequence within one arm of the hairpin, and the hairpin must include at least 16 bp within the first 22 nt of the miRNA. The structure should not contain large internal loops or bulges, particularly not large asymmetric bulges (&lt;5-nt).</p>
         </sec>
         <sec>
            <st>
               <p>Paraflo&#8482; miRNA microarray assay</p>
            </st>
            <p>Based on the predicted results and the sequences of known miRNAs in <it>Arthropoda</it>, <it>Nematoda</it>, and human, we designed probes to detect <it>B. mori </it>miRNAs in <it>B. mori </it>pupa and moth stages by microarray profiling.</p>
            <p>Microarray assays were done using a service provider (LC Sciences, Houston, USA). The assay was done on 5-&#956;g total RNA samples from <it>B. mori </it>pupa (labeled cy3) and moth (labeled cy5), which were size fractionated using a mirVana Isolation kit (Ambion, Austin, USA); the small RNAs (&lt;200 nt) were 3'-extended with a poly(A) tail using poly(A) polymerase. An oligonucleotide tag was then ligated to the poly(A) tail for later staining with fluorescent dye; two different tags were used for the two RNA samples in dual-sample experiments. Hybridization was done overnight on a &#956;ParaFlo microfluidic chip using a micro-circulation pump (Atactic Technologies, Houston, USA) <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. On the microfluidic chip, each detection probe consisted of a chemically modified nucleotide coding segment complementary to the target miRNA (miRBase, <url>http://microrna.sanger.ac.uk/sequences/</url>) or other RNA (control or our defined sequences) and a spacer segment of polyethylene glycol to extend the coding segment away from the substrate. Detection probes were made by <it>in situ </it>synthesis using photogenerated reagent (PGR) chemistry. The hybridization melting temperatures were balanced by chemical modifications of the detection probes. Hybridizations used 100 L 6 &#215; SSPE buffer (0.90 M NaCl, 60 mM Na<sub>2</sub>HPO<sub>4</sub>, 6 mM EDTA, pH 6.8) containing 25% formamide at 34&#176;C. After hybridization, signals were detected using fluorescence labeling with tag-specfic Cy5 (for <it>B. mori </it>pupa and moth) dyes (Invitrogen, Carlsbad, USA). Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Device, Sunnyvale, USA) and quantified. Data were analyzed by first subtracting the background, and then normalized using a cyclic LOWESS filter (locally-weighted regression) <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. For two color experiments, the ratio of the two sets of detected signals (log2 transformed, balanced) and p-values of the <it>t</it>-test were calculated; differentially detected signals were those with p-values of &lt; 0.01. Data classification involved a hierarchical clustering method using average linkage and Euclidean distance metric, and was visualized with TIGR's MeV (Multiple Experimental Viewer; Institute for Genomic Research).</p>
         </sec>
         <sec>
            <st>
               <p>Northern blotting</p>
            </st>
            <p>Total small RNA was isolated from the larva, pupa, and moth stages of the silkworm using mirVana&#8482; miRNA Isolation Kit (Ambion) according to manufacturer instructions. Liquid nitrogen was used to freeze samples before RNA extraction. Small RNA was quantified by spectrophotometer (NanoDrop, Wilmington, USA). Twenty micrograms of small RNA was loaded per lane, and resolved on a denaturing 15% polyacrylamide gel containing 8 M urea at 20 mA; small RNA was transferred by electrophoresis from the gel to a positively charged nylon membrane (Millipore, Shanghai, China) by a semi-dry transfer apparatus (ATTA) at 200 mA for 2 h. After electroblotting, membranes were ultraviolet crosslinked (120 mJ, 30 s) and baked for 1 h at 80&#176;C. DNA probes complementary to small RNA sequences were 5' end-labeled with &#947;-<sup>32</sup>P-ATP using a 5' DNA Labeling Kit (Shenergy Biocolor, Shanghai, China). The membrane was prehybridized in prehybridization solution (6 &#215; SSC, 10 &#215; Denhardt's solution, 0.2% SDS) at 64&#176;C for 1 h. Membranes were hybridized in hybridization solution (6 &#215; SSC, 5 &#215; Denhardt's solution, 0.2% SDS) containing 1&#8211;5 &#215; 10<sup>6 </sup>cpm 5' end-labeled antisense probes for 18&#8211;24 h with gentle agitation at 28&#176;C. Blots were washed three times for 5 min each at 28&#176;C with 6 &#215; SSC and 0.2% SDS, and once at 42&#176;C for 10 min. After the final wash, blots were wrapped in plastic wrap and exposed to a phosphorimager screen (Amersham, Piscataway, USA) according to manufacturer instructions.</p>
         </sec>
         <sec>
            <st>
               <p>Computational prediction of miRNA targets</p>
            </st>
            <p>Functions of the identified <it>B. mori </it>miRNAs were analyzed according to the functional conservation and the potential binding sites between miRNAs and the 3'UTR of responding mRNAs.</p>
            <p>Based on the Tarbase database <abbrgrp><abbr bid="B59">59</abbr></abbrgrp>, we searched for the known targeted genes of <it>Drosophila </it>orthologs of identified miRNAs. Their <it>B. mori </it>homologs and their 3'UTR were subsequently obtained by the BLAST program. The <it>B. mori </it>miRNA targeted genes were predicted according to the binding between miRNAs and their complementary sites on the 3'UTR of the <it>B. mori </it>homologs by the RNAhybrid program <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>.</p>
            <p>In general, base pairing between miRNA and the complementary site on mRNA may provide a function prediction for miRNA. We calculated the potential binding sites between identified miRNAs and the 3'UTR of mRNAs of <it>B. mori </it>genes using the RNAhybrid program <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>; we used two settings to obtain specific binding sites. The first setting (P-value cutoff of 0.05, minimum free energy cutoff of -20.0 kcal/mol, maximum internal and bulge loop size of 1) was termed "hybrid11"; if maximum internal and bulge loop size was 2 but the seed region of miRNA could perfectly bind to 3'UTR of a gene (helix constraint of 2.7), we also considered this gene to be a potential miRNA-targeted gene (this setting was termed "hybridf22"). The functional annotation for predicted targeted genes were analyzed using Gene Ontology analysis <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. <it>B. mori </it>genes were obtained from <it>B. mori </it>Genes Database constructed by us, and which includes 1909 genes. From these genes, 1671 3'UTRs were obtained and used for predicting potential targeted genes.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>PAH carried out the prediction and analysis of the miRNA and drafted the manuscript. ZMN performed the experiments, and carried out the analysis of miRNA and drafted the manuscript. JQC, JC, ZBL, QS and LYK performed the experiments. SPZ and XLG helped to analyze the data and draft the manuscript. XFW directed all the work of the manuscript. YFJ and YZZ conceived, and carried out the design and draft of the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by financial grants from the National Basic Research Program of China (973 Program, No.2005CB121006), the National High Technology Research and Development Program (No. 2007AA021703), the National Natural Science Foundation of China (No.30740015, No.30670447) and the Zhejiang Natural Science Foundation (No. Y205449, Y304122). We thank International Science Editing for English editing.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing</p>
            </title>
            <aug>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2003</pubdate>
            <volume>113</volume>
            <issue>6</issue>
            <fpage>673</fpage>
            <lpage>676</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(03)00428-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12809598</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>The functions of animal microRNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2004</pubdate>
            <volume>431</volume>
            <issue>7006</issue>
            <fpage>350</fpage>
            <lpage>355</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature02871</pubid>
                  <pubid idtype="pmpid" link="fulltext">15372042</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The microRNAs of Caenorhabditis elegans</p>
            </title>
            <aug>
               <au>
                  <snm>Lim</snm>
                  <fnm>LP</fnm>
               </au>
               <au>
                  <snm>Lau</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Weinstein</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Abdelhakim</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yekta</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rhoades</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Burge</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Bartel</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>2003</pubdate>
            <volume>17</volume>
            <issue>8</issue>
            <fpage>991</fpage>
            <lpage>1008</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">196042</pubid>
                  <pubid idtype="pmpid" link="fulltext">12672692</pubid>
                  <pubid idtype="doi">10.1101/gad.1074403</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Role of microRNAs in plant and animal development</p>
            </title>
            <aug>
               <au>
                  <snm>Carrington</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>301</volume>
            <issue>5631</issue>
            <fpage>336</fpage>
            <lpage>338</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1085242</pubid>
                  <pubid idtype="pmpid" link="fulltext">12869753</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Feinbaum</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1993</pubdate>
            <volume>75</volume>
            <issue>5</issue>
            <fpage>843</fpage>
            <lpage>854</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(93)90529-Y</pubid>
                  <pubid idtype="pmpid" link="fulltext">8252621</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans</p>
            </title>
            <aug>
               <au>
                  <snm>Reinhart</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Slack</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Basson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pasquinelli</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Bettinger</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Rougvie</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Horvitz</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Ruvkun</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>403</volume>
            <issue>6772</issue>
            <fpage>901</fpage>
            <lpage>906</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35002607</pubid>
                  <pubid idtype="pmpid" link="fulltext">10706289</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Identification of novel genes coding for small expressed RNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Lagos-Quintana</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rauhut</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lendeckel</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Tuschl</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>294</volume>
            <issue>5543</issue>
            <fpage>853</fpage>
            <lpage>858</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1064921</pubid>
                  <pubid idtype="pmpid" link="fulltext">11679670</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans</p>
            </title>
            <aug>
               <au>
                  <snm>Lau</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>LP</fnm>
               </au>
               <au>
                  <snm>Weinstein</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Bartel</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>294</volume>
            <issue>5543</issue>
            <fpage>858</fpage>
            <lpage>862</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1065062</pubid>
                  <pubid idtype="pmpid" link="fulltext">11679671</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>An extensive class of small RNAs in Caenorhabditis elegans</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>294</volume>
            <issue>5543</issue>
            <fpage>862</fpage>
            <lpage>864</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1065329</pubid>
                  <pubid idtype="pmpid" link="fulltext">11679672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Computational and experimental identification of C. elegans microRNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Grad</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Aach</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hayes</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Reinhart</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Church</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Ruvkun</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Cell</source>
            <pubdate>2003</pubdate>
            <volume>11</volume>
            <issue>5</issue>
            <fpage>1253</fpage>
            <lpage>1263</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1097-2765(03)00153-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">12769849</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Computational identification of Drosophila microRNA genes</p>
            </title>
            <aug>
               <au>
                  <snm>Lai</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Tomancak</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Rubin</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2003</pubdate>
            <volume>4</volume>
            <issue>7</issue>
            <fpage>R42</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">193629</pubid>
                  <pubid idtype="pmpid" link="fulltext">12844358</pubid>
                  <pubid idtype="doi">10.1186/gb-2003-4-7-r42</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>XJ</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Gaasterland</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <issue>9</issue>
            <fpage>R65</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">522872</pubid>
                  <pubid idtype="pmpid" link="fulltext">15345049</pubid>
                  <pubid idtype="doi">10.1186/gb-2004-5-9-r65</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Computational identification of plant microRNAs and their targets, including a stress-induced miRNA</p>
            </title>
            <aug>
               <au>
                  <snm>Jones-Rhoades</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Bartel</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Mol Cell</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>6</issue>
            <fpage>787</fpage>
            <lpage>799</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.molcel.2004.05.027</pubid>
                  <pubid idtype="pmpid" link="fulltext">15200956</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Evidence that microRNA precursors, unlike other non-coding RNAs, have lower folding free energies than random sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Bonnet</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wuyts</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rouze</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Peer</snm>
                  <mnm>Van de</mnm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <issue>17</issue>
            <fpage>2911</fpage>
            <lpage>2917</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bth374</pubid>
                  <pubid idtype="pmpid" link="fulltext">15217813</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Prediction of regulatory modules comprising microRNAs and target genes</p>
            </title>
            <aug>
               <au>
                  <snm>Yoon</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>De Micheli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <issue>Suppl 2</issue>
            <fpage>ii93</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bti1116</pubid>
                  <pubid idtype="pmpid" link="fulltext">16204133</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>MicroRNA identification based on sequence and structure alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <issue>18</issue>
            <fpage>3610</fpage>
            <lpage>3614</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bti562</pubid>
                  <pubid idtype="pmpid" link="fulltext">15994192</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Human microRNA prediction through a probabilistic co-learning model of sequence and structure</p>
            </title>
            <aug>
               <au>
                  <snm>Nam</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Shin</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>VN</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>BT</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <issue>11</issue>
            <fpage>3570</fpage>
            <lpage>3581</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1159118</pubid>
                  <pubid idtype="pmpid" link="fulltext">15987789</pubid>
                  <pubid idtype="doi">10.1093/nar/gki668</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Identification of plant microRNA homologs</p>
            </title>
            <aug>
               <au>
                  <snm>Dezulian</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Remmert</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Palatnik</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Weigel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Huson</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2006</pubdate>
            <volume>22</volume>
            <issue>3</issue>
            <fpage>359</fpage>
            <lpage>360</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bti802</pubid>
                  <pubid idtype="pmpid" link="fulltext">16317073</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Computational prediction of microRNA genes in silkworm genome</p>
            </title>
            <aug>
               <au>
                  <snm>Tong</snm>
                  <fnm>CZ</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>YF</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>YZ</fnm>
               </au>
            </aug>
            <source>J Zhejiang Univ Sci B</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <issue>10</issue>
            <fpage>806</fpage>
            <lpage>816</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1599803</pubid>
                  <pubid idtype="pmpid" link="fulltext">16972323</pubid>
                  <pubid idtype="doi">10.1631/jzus.2006.B0806</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Reliable prediction of Drosha processing sites improves microRNA gene prediction</p>
            </title>
            <aug>
               <au>
                  <snm>Helvik</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Snove</snm>
                  <fnm>O</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Saetrom</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2007</pubdate>
            <volume>23</volume>
            <issue>2</issue>
            <fpage>142</fpage>
            <lpage>149</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btl570</pubid>
                  <pubid idtype="pmpid" link="fulltext">17105718</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>miRBase: microRNA sequences, targets and gene nomenclature</p>
            </title>
            <aug>
               <au>
                  <snm>Griffiths-Jones</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Grocock</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>van Dongen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bateman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Enright</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2006</pubdate>
            <issue>34 Database</issue>
            <fpage>D140</fpage>
            <lpage>144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1347474</pubid>
                  <pubid idtype="pmpid" link="fulltext">16381832</pubid>
                  <pubid idtype="doi">10.1093/nar/gkj112</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>The microRNA Registry</p>
            </title>
            <aug>
               <au>
                  <snm>Griffiths-Jones</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2004</pubdate>
            <issue>32 Database</issue>
            <fpage>D109</fpage>
            <lpage>111</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308757</pubid>
                  <pubid idtype="pmpid" link="fulltext">14681370</pubid>
                  <pubid idtype="doi">10.1093/nar/gkh023</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>A uniform system for microRNA annotation</p>
            </title>
            <aug>
               <au>
                  <snm>Ambros</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bartel</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bartel</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Burge</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Carrington</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Dreyfuss</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Eddy</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Griffiths-Jones</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>RNA</source>
            <pubdate>2003</pubdate>
            <volume>9</volume>
            <issue>3</issue>
            <fpage>277</fpage>
            <lpage>279</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1370393</pubid>
                  <pubid idtype="pmpid" link="fulltext">12592000</pubid>
                  <pubid idtype="doi">10.1261/rna.2183803</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A family of microRNAs present in plants and animals</p>
            </title>
            <aug>
               <au>
                  <snm>Arteaga-Vazquez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Caballero-Perez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vielle-Calzada</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <issue>12</issue>
            <fpage>3355</fpage>
            <lpage>3369</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1785418</pubid>
                  <pubid idtype="pmpid" link="fulltext">17189346</pubid>
                  <pubid idtype="doi">10.1105/tpc.106.044420</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A draft sequence for the genome of the domesticated silkworm (Bombyx mori)</p>
            </title>
            <aug>
               <au>
                  <snm>Xia</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dai</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zha</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chai</snm>
                  <fnm>C</fnm>
               </au>
               <etal/>
            </aug>
            <source>Science</source>
            <pubdate>2004</pubdate>
            <volume>306</volume>
            <issue>5703</issue>
            <fpage>1937</fpage>
            <lpage>1940</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1102210</pubid>
                  <pubid idtype="pmpid" link="fulltext">15591204</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>SilkDB: a knowledgebase for silkworm biology and genomics</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Xia</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Dai</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ruan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>R</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <issue>33 Database</issue>
            <fpage>D399</fpage>
            <lpage>402</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">540070</pubid>
                  <pubid idtype="pmpid" link="fulltext">15608225</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Asymmetry in the assembly of the RNAi enzyme complex</p>
            </title>
            <aug>
               <au>
                  <snm>Schwarz</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Hutvagner</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Du</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Aronin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Zamore</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2003</pubdate>
            <volume>115</volume>
            <issue>2</issue>
            <fpage>199</fpage>
            <lpage>208</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(03)00759-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">14567917</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Human RISC couples microRNA biogenesis and posttranscriptional gene silencing</p>
            </title>
            <aug>
               <au>
                  <snm>Gregory</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Chendrimada</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Cooch</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Shiekhattar</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2005</pubdate>
            <volume>123</volume>
            <issue>4</issue>
            <fpage>631</fpage>
            <lpage>640</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cell.2005.10.022</pubid>
                  <pubid idtype="pmpid" link="fulltext">16271387</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Gene silencing using RNA interference in embryonic stem cells</p>
            </title>
            <aug>
               <au>
                  <snm>Velkey</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Slawny</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Gratsch</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>O'Shea</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>Methods Mol Biol</source>
            <pubdate>2006</pubdate>
            <volume>329</volume>
            <fpage>233</fpage>
            <lpage>261</lpage>
            <xrefbib>
               <pubid idtype="pmpid">16845995</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>MicroRNAs: genomics, biogenesis, mechanism, and function</p>
            </title>
            <aug>
               <au>
                  <snm>Bartel</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2004</pubdate>
            <volume>116</volume>
            <issue>2</issue>
            <fpage>281</fpage>
            <lpage>297</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(04)00045-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">14744438</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Illuminating the silence: understanding the structure and function of small RNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Rana</snm>
                  <fnm>TM</fnm>
               </au>
            </aug>
            <source>Nat Rev Mol Cell Biol</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <issue>1</issue>
            <fpage>23</fpage>
            <lpage>36</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrm2085</pubid>
                  <pubid idtype="pmpid" link="fulltext">17183358</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>MicroRNAs and their regulatory roles in animals and plants</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Pan</snm>
                  <fnm>X</fnm>
               </au>
            </aug>
            <source>J Cell Physiol</source>
            <pubdate>2007</pubdate>
            <volume>210</volume>
            <issue>2</issue>
            <fpage>279</fpage>
            <lpage>289</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jcp.20869</pubid>
                  <pubid idtype="pmpid" link="fulltext">17096367</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Insect microRNAs: Structure, function and evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Behura</snm>
                  <fnm>SK</fnm>
               </au>
            </aug>
            <source>Insect Biochem Mol Biol</source>
            <pubdate>2007</pubdate>
            <volume>37</volume>
            <issue>1</issue>
            <fpage>3</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ibmb.2006.10.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17175441</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Processing of primary microRNAs by the Microprocessor complex</p>
            </title>
            <aug>
               <au>
                  <snm>Denli</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Tops</snm>
                  <fnm>BB</fnm>
               </au>
               <au>
                  <snm>Plasterk</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Ketting</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Hannon</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2004</pubdate>
            <volume>432</volume>
            <issue>7014</issue>
            <fpage>231</fpage>
            <lpage>235</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03049</pubid>
                  <pubid idtype="pmpid" link="fulltext">15531879</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Substrate requirements for let-7 function in the developing zebrafish embryo</p>
            </title>
            <aug>
               <au>
                  <snm>Kloosterman</snm>
                  <fnm>WP</fnm>
               </au>
               <au>
                  <snm>Wienholds</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ketting</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Plasterk</snm>
                  <fnm>RH</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2004</pubdate>
            <volume>32</volume>
            <issue>21</issue>
            <fpage>6284</fpage>
            <lpage>6291</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">535676</pubid>
                  <pubid idtype="pmpid" link="fulltext">15585662</pubid>
                  <pubid idtype="doi">10.1093/nar/gkh968</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Characterization and expression patterns of let-7 microRNA in the silkworm (Bombyx mori)</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Xia</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Xiang</snm>
                  <fnm>Z</fnm>
               </au>
            </aug>
            <source>BMC Dev Biol</source>
            <pubdate>2007</pubdate>
            <volume>7</volume>
            <fpage>88</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1976426</pubid>
                  <pubid idtype="pmpid" link="fulltext">17651473</pubid>
                  <pubid idtype="doi">10.1186/1471-213X-7-88</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Mfold web server for nucleic acid folding and hybridization prediction</p>
            </title>
            <aug>
               <au>
                  <snm>Zuker</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2003</pubdate>
            <volume>31</volume>
            <issue>13</issue>
            <fpage>3406</fpage>
            <lpage>3415</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">169194</pubid>
                  <pubid idtype="pmpid" link="fulltext">12824337</pubid>
                  <pubid idtype="doi">10.1093/nar/gkg595</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>microRNA target predictions across seven Drosophila species and comparison to mammalian targets</p>
            </title>
            <aug>
               <au>
                  <snm>Grun</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Langenberger</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gunsalus</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Rajewsky</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>PLoS Comput Biol</source>
            <pubdate>2005</pubdate>
            <volume>1</volume>
            <issue>1</issue>
            <fpage>e13</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1183519</pubid>
                  <pubid idtype="pmpid" link="fulltext">16103902</pubid>
                  <pubid idtype="doi">10.1371/journal.pcbi.0010013</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>TarBase: A comprehensive database of experimentally supported animal microRNA targets</p>
            </title>
            <aug>
               <au>
                  <snm>Sethupathy</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Corda</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hatzigeorgiou</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>RNA</source>
            <pubdate>2006</pubdate>
            <volume>12</volume>
            <issue>2</issue>
            <fpage>192</fpage>
            <lpage>197</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1370898</pubid>
                  <pubid idtype="pmpid" link="fulltext">16373484</pubid>
                  <pubid idtype="doi">10.1261/rna.2239606</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Transcriptional repression by Drosophila methyl-CpG-binding proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Roder</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hung</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>TY</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Isobe</snm>
                  <fnm>KI</fnm>
               </au>
               <au>
                  <snm>Juang</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>CJ</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2000</pubdate>
            <volume>20</volume>
            <issue>19</issue>
            <fpage>7401</fpage>
            <lpage>7409</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">86293</pubid>
                  <pubid idtype="pmpid" link="fulltext">10982856</pubid>
                  <pubid idtype="doi">10.1128/MCB.20.19.7401-7409.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>MicroRNA modulation of megakaryoblast fate involves cholinergic signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Guimaraes-Sternberg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Meerson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Shaked</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Soreq</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Leuk Res</source>
            <pubdate>2006</pubdate>
            <volume>30</volume>
            <issue>5</issue>
            <fpage>583</fpage>
            <lpage>595</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.leukres.2005.09.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">16249029</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Advantages of 2'-O-methyl oligoribonucleotide probes for detecting RNA targets</p>
            </title>
            <aug>
               <au>
                  <snm>Majlessi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Becker</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1998</pubdate>
            <volume>26</volume>
            <issue>9</issue>
            <fpage>2224</fpage>
            <lpage>2229</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">147516</pubid>
                  <pubid idtype="pmpid" link="fulltext">9547284</pubid>
                  <pubid idtype="doi">10.1093/nar/26.9.2224</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Molecular evolution of a microRNA cluster</p>
            </title>
            <aug>
               <au>
                  <snm>Tanzer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Stadler</snm>
                  <fnm>PF</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2004</pubdate>
            <volume>339</volume>
            <issue>2</issue>
            <fpage>327</fpage>
            <lpage>335</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jmb.2004.03.065</pubid>
                  <pubid idtype="pmpid" link="fulltext">15136036</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>The small RNA profile during Drosophila melanogaster development</p>
            </title>
            <aug>
               <au>
                  <snm>Aravin</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Lagos-Quintana</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yalcin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zavolan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marks</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Snyder</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Gaasterland</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tuschl</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Dev Cell</source>
            <pubdate>2003</pubdate>
            <volume>5</volume>
            <issue>2</issue>
            <fpage>337</fpage>
            <lpage>350</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1534-5807(03)00228-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12919683</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain</p>
            </title>
            <aug>
               <au>
                  <snm>Seitz</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Royo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bortolin</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Ferguson-Smith</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Cavaille</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>9</issue>
            <fpage>1741</fpage>
            <lpage>1748</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">515320</pubid>
                  <pubid idtype="pmpid" link="fulltext">15310658</pubid>
                  <pubid idtype="doi">10.1101/gr.2743304</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Control of translation and mRNA degradation by miRNAs and siRNAs</p>
            </title>
            <aug>
               <au>
                  <snm>Valencia-Sanchez</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hannon</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>2006</pubdate>
            <volume>20</volume>
            <issue>5</issue>
            <fpage>515</fpage>
            <lpage>524</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gad.1399806</pubid>
                  <pubid idtype="pmpid" link="fulltext">16510870</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>MicroRNA maturation: stepwise processing and subcellular localization</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Jeon</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>VN</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>2002</pubdate>
            <volume>21</volume>
            <issue>17</issue>
            <fpage>4663</fpage>
            <lpage>4670</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">126204</pubid>
                  <pubid idtype="pmpid">12198168</pubid>
                  <pubid idtype="doi">10.1093/emboj/cdf476</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Identification of Drosophila MicroRNA targets</p>
            </title>
            <aug>
               <au>
                  <snm>Stark</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Brennecke</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>PLoS Biol</source>
            <pubdate>2003</pubdate>
            <volume>1</volume>
            <issue>3</issue>
            <fpage>E60</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">270017</pubid>
                  <pubid idtype="pmpid" link="fulltext">14691535</pubid>
                  <pubid idtype="doi">10.1371/journal.pbio.0000060</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>A guide through present computational approaches for the identification of mammalian microRNA targets</p>
            </title>
            <aug>
               <au>
                  <snm>Sethupathy</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Megraw</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hatzigeorgiou</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Nat Methods</source>
            <pubdate>2006</pubdate>
            <volume>3</volume>
            <issue>11</issue>
            <fpage>881</fpage>
            <lpage>886</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nmeth954</pubid>
                  <pubid idtype="pmpid" link="fulltext">17060911</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>MicroRNA profiling of developing and regenerating pancreas reveal post-transcriptional regulation of neurogenin3</p>
            </title>
            <aug>
               <au>
                  <snm>Joglekar</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Parekh</snm>
                  <fnm>VS</fnm>
               </au>
               <au>
                  <snm>Mehta</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bhonde</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Hardikar</snm>
                  <fnm>AA</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2007</pubdate>
            <volume>311</volume>
            <issue>2</issue>
            <fpage>603</fpage>
            <lpage>612</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2007.09.008</pubid>
                  <pubid idtype="pmpid" link="fulltext">17936263</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Asangani</snm>
                  <fnm>IA</fnm>
               </au>
               <au>
                  <snm>Rasheed</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Nikolova</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Leupold</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Colburn</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Post</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Allgayer</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2007</pubdate>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Computational and transcriptional evidence for microRNAs in the honey bee genome</p>
            </title>
            <aug>
               <au>
                  <snm>Weaver</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Anzola</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Reese</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Childs</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Zdobnov</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Samanta</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Elsik</snm>
                  <fnm>CG</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <issue>6</issue>
            <fpage>R97</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2394756</pubid>
                  <pubid idtype="pmpid" link="fulltext">17543122</pubid>
                  <pubid idtype="doi">10.1186/gb-2007-8-6-r97</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation</p>
            </title>
            <aug>
               <au>
                  <snm>Lai</snm>
                  <fnm>EC</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <issue>4</issue>
            <fpage>363</fpage>
            <lpage>364</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng865</pubid>
                  <pubid idtype="pmpid" link="fulltext">11896390</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>A potential signaling role for profilin in pollen of Papaver rhoeas</p>
            </title>
            <aug>
               <au>
                  <snm>Clarke</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Staiger</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Gibbon</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Franklin-Tong</snm>
                  <fnm>VE</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1998</pubdate>
            <volume>10</volume>
            <issue>6</issue>
            <fpage>967</fpage>
            <lpage>979</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">144038</pubid>
                  <pubid idtype="pmpid" link="fulltext">9634585</pubid>
                  <pubid idtype="doi">10.1105/tpc.10.6.967</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>miRBase website</p>
            </title>
            <url>http://microrna.sanger.ac.uk/sequences/index.shtml</url>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Beijing Genomics Institute website</p>
            </title>
            <url>http://silkworm.genomics.org.cn/</url>
         </bibl>
         <bibl id="B57">
            <title>
               <p>In situ synthesis of oligonucleotide microarrays</p>
            </title>
            <aug>
               <au>
                  <snm>Gao</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Gulari</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>X</fnm>
               </au>
            </aug>
            <source>Biopolymers</source>
            <pubdate>2004</pubdate>
            <volume>73</volume>
            <issue>5</issue>
            <fpage>579</fpage>
            <lpage>596</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/bip.20005</pubid>
                  <pubid idtype="pmpid" link="fulltext">15048782</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>A comparison of normalization methods for high density oligonucleotide array data based on variance and bias</p>
            </title>
            <aug>
               <au>
                  <snm>Bolstad</snm>
                  <fnm>BM</fnm>
               </au>
               <au>
                  <snm>Irizarry</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Astrand</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Speed</snm>
                  <fnm>TP</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <issue>2</issue>
            <fpage>185</fpage>
            <lpage>193</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/19.2.185</pubid>
                  <pubid idtype="pmpid" link="fulltext">12538238</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Tarbase website</p>
            </title>
            <url>http://www.diana.pcbi.upenn.edu/tarbase.html</url>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Fast and effective prediction of microRNA/target duplexes</p>
            </title>
            <aug>
               <au>
                  <snm>Rehmsmeier</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Steffen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hochsmann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Giegerich</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>RNA</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>10</issue>
            <fpage>1507</fpage>
            <lpage>1517</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1370637</pubid>
                  <pubid idtype="pmpid" link="fulltext">15383676</pubid>
                  <pubid idtype="doi">10.1261/rna.5248604</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Gene Ontology analysis website</p>
            </title>
            <url>http://goblet.molgen.mpg.de/cgi-bin/goblet/webapp-goblet.cgi?menu=Form</url>
         </bibl>
      </refgrp>
   </bm>
</art>
