<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1471-2164-5-54</ui>
	<ji>1471-2164</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>From biomedicine to natural history research: EST resources for ambystomatid salamanders</p>
			</title>
			<aug>
				<au id="A1" ce="yes">
					<snm>Putta</snm>
					<fnm>Srikrishna</fnm>
					<insr iid="I1"/>
					<email>sputt2@uky.edu</email>
				</au>
				<au id="A2" ce="yes">
					<snm>Smith</snm>
					<mi>J</mi>
					<fnm>Jeramiah</fnm>
					<insr iid="I1"/>
					<email>jjsmit3@uky.edu</email>
				</au>
				<au id="A3" ce="yes">
					<snm>Walker</snm>
					<mi>A</mi>
					<fnm>John</fnm>
					<insr iid="I1"/>
					<email>jawalk2@uky.edu</email>
				</au>
				<au id="A4">
					<snm>Rondet</snm>
					<fnm>Mathieu</fnm>
					<insr iid="I2"/>
					<email>mrondet@uci.edu</email>
				</au>
				<au id="A5">
					<snm>Weisrock</snm>
					<mi>W</mi>
					<fnm>David</fnm>
					<insr iid="I1"/>
					<email>weisrock@uky.edu</email>
				</au>
				<au id="A6">
					<snm>Monaghan</snm>
					<fnm>James</fnm>
					<insr iid="I1"/>
					<email>james.monaghan@uky.edu</email>
				</au>
				<au id="A7">
					<snm>Samuels</snm>
					<mi>K</mi>
					<fnm>Amy</fnm>
					<insr iid="I1"/>
					<email>aksamu2@uky.edu</email>
				</au>
				<au id="A8">
					<snm>Kump</snm>
					<fnm>Kevin</fnm>
					<insr iid="I1"/>
					<email>kevinkump@gmail.com</email>
				</au>
				<au id="A9">
					<snm>King</snm>
					<mi>C</mi>
					<fnm>David</fnm>
					<insr iid="I3"/>
					<email>dck163@psu.edu</email>
				</au>
				<au id="A10">
					<snm>Maness</snm>
					<mi>J</mi>
					<fnm>Nicholas</fnm>
					<insr iid="I4"/>
					<email>njmaness@wisc.edu</email>
				</au>
				<au id="A11">
					<snm>Habermann</snm>
					<fnm>Bianca</fnm>
					<insr iid="I5"/>
					<email>habermann@mpi-cbg.de</email>
				</au>
				<au id="A12">
					<snm>Tanaka</snm>
					<fnm>Elly</fnm>
					<insr iid="I6"/>
					<email>tanaka@mpi-cbg.de</email>
				</au>
				<au id="A13">
					<snm>Bryant</snm>
					<mi>V</mi>
					<fnm>Susan</fnm>
					<insr iid="I2"/>
					<email>svbryant@uci.edu</email>
				</au>
				<au id="A14">
					<snm>Gardiner</snm>
					<mi>M</mi>
					<fnm>David</fnm>
					<insr iid="I2"/>
					<email>dmgardin@uci.edu</email>
				</au>
				<au id="A15">
					<snm>Parichy</snm>
					<mi>M</mi>
					<fnm>David</fnm>
					<insr iid="I7"/>
					<email>dparichy@mail.utexas.edu</email>
				</au>
				<au id="A16" ca="yes">
					<snm>Voss</snm>
					<fnm>S Randal</fnm>
					<insr iid="I1"/>
					<email>srvoss@uky.edu</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Department of Biology, University of Kentucky, Lexington, KY 40506, USA</p>
				</ins>
				<ins id="I2">
					<p>Department of Developmental and Cell Biology and the Developmental Biology Center, University of California, Irvine, CA 92697, USA</p>
				</ins>
				<ins id="I3">
					<p>The Life Sciences Consortium, 519 Wartik Laboratory, Penn State University, University Park, PA 16802, USA</p>
				</ins>
				<ins id="I4">
					<p>Department of Zoology, University of Wisconsin-Madison, 250 N. Mills, Madison, WI 53706, USA</p>
				</ins>
				<ins id="I5">
					<p>Scionics Computer Innovation GmbH, Pfotenhauerstrasse 110, 01307 Dresden, Germany</p>
				</ins>
				<ins id="I6">
					<p>Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany</p>
				</ins>
				<ins id="I7">
					<p>Section of Integrative Biology and Section of Molecular, Cell and Developmental Biology, Institute for Cellular and Molecular Biology, University of Texas, Austin, TX 78712, USA</p>
				</ins>
			</insg>
			<source>BMC Genomics</source>
			<issn>1471-2164</issn>
			<pubdate>2004</pubdate>
			<volume>5</volume>
			<issue>1</issue>
			<fpage>54</fpage>
			<url>http://www.biomedcentral.com/1471-2164/5/54</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">15310388</pubid><pubid idtype="doi">10.1186/1471-2164-5-54</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>19</day>
					<month>7</month>
					<year>2004</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>13</day>
					<month>8</month>
					<year>2004</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>13</day>
					<month>8</month>
					<year>2004</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2004</year>
			<collab>Putta et al; licensee BioMed Central Ltd.</collab>
			<note>This is an open-access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st>
					<p>Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (<it>Ambystoma mexicanum</it>) and Eastern tiger salamander (<it>A. tigrinum tigrinum</it>), species with deep and diverse research histories.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for <it>A. mexicanum </it>were processed to yield 35,413 and 20,599 high quality ESTs for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, respectively. Because the <it>A. t. tigrinum </it>ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human &#8211; <it>Ambystoma </it>synteny group with marker loci, and extended PCR primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>orthologues to a related tiger salamander species.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusions</p>
					</st>
					<p>Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. Expressed sequence tags (EST) are particularly useful genomic resources because they enable multiple lines of research and can be generated for any organism: ESTs allow the identification of molecular probes for developmental studies, provide clones for DNA microchip construction, reveal candidate genes for mutant phenotypes, and facilitate studies of genome structure and evolution. Furthermore, ESTs provide raw material from which strain-specific polymorphisms can be identified for use in population and quantitative genetic analyses. The utility of such resources can be tailored to target novel characteristics of organisms when ESTs are isolated from cell types and tissues that are actively being used by a particular research community, so as to bias the collection of sequences towards genes of special interest. Finally, EST resources produced for model organisms can greatly facilitate comparative and evolutionary studies when their uses are extended to other, closely related taxa.</p>
			<p>Salamanders (urodele amphibians) are traditional model organisms whose popularity was unsurpassed early in the 20<sup>th </sup>century. At their pinnacle, salamanders were the primary model for early vertebrate development. Embryological studies in particular revealed many basic mechanisms of development, including organizer and inducer regions of developing embryos <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Salamanders continue to be important vertebrate model organisms for regeneration because they have by far the greatest capacity to regenerate complex body parts in the adult phase. In contrast to mammals, which are not able to regenerate entire structures or organ systems upon injury or amputation, adult salamanders regenerate their limbs, tail, lens, retina, spinal cord, heart musculature, and jaw <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. In addition, salamanders are the model of choice in a diversity of areas, including vision, embryogenesis, heart development, olfaction, chromosome structure, evolution, ecology, science education, and conservation biology <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. All of these disciplines are in need of genomic resources as fewer than 4100 salamander nucleotide sequences had been deposited in GenBank as of 3/10/04.</p>
			<p>Here we describe results from an EST project for two ambystomatid salamanders: the Mexican axolotl, <it>Ambystoma mexicanum </it>and the eastern tiger salamander, <it>A. tigrinum tigrinum</it>. These two species are members of the Tiger Salamander Complex <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, a group of closely related species and subspecies that are widely distributed in North America. Phylogenetic reconstruction suggests that these species probably arose from a common ancestor about 10&#8211;15 million years ago <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. <it>Ambystoma mexicanum </it>has a long research history of over 100 years and is now principally supplied to the research community by the Axolotl Colony <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, while <it>A. t. tigrinum </it>is obtained from natural populations in the eastern United States. Although closely related with equally large genomes (32 &#215; 10<sup>9 </sup>bp)<abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, these two species and others of the Complex differ dramatically in life history: <it>A. mexicanum </it>is a paedomorphic species that retains many larval features and lives in water throughout it's life cycle while <it>A. t. tigrinum </it>undergoes a metamorphosis that is typical of many amphibians. Like many other traditional model organisms of the last century, interest in these two species declined during the rise of genetic models like the fly, zebrafish, and mouse <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. However, "early" model organisms such as salamanders are beginning to re-attract attention as genome resources can rapidly be developed to exploit the unique features that originally identified their utility for research. We make this point below by showing how the development of ESTs for these two species is enabling research in several areas. Furthermore, we emphasize the value of developing resources in model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research programs.</p>
		</sec>
		<sec>
			<st>
				<p>Results and Discussion</p>
			</st>
			<sec>
				<st>
					<p>Selection of libraries for EST sequencing</p>
				</st>
				<p>Eleven cDNA libraries were constructed using a variety of tissues (Table <tblr tid="T1">1</tblr>). Pilot sequencing of randomly selected clones revealed that the majority of the non-normalized libraries were moderate to highly redundant for relatively few transcripts. For example, hemoglobin-like transcripts represented 15&#8211;25% of the sampled clones from cDNA libraries V1, V2, and V6. Accordingly, we chose to focus our sequencing efforts on the non-normalized MATH library as well as the normalized AG library, which had lower levels of redundancy (5.5 and 0.25% globins, respectively). By concentrating our sequencing efforts on these two libraries we obtained transcripts deriving primarily from regenerating larval tissues in <it>A. mexicanum </it>and several non-regenerating larval tissues in <it>A. t. tigrinum</it>.</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>Tissues selected to make cDNA libraries.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="center">
								<p>
									<b>ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Tissue</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>cDNAs sequenced</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>GARD</p>
							</c>
							<c ca="center">
								<p>limb blastema</p>
							</c>
							<c ca="center">
								<p>1029</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>MATH</p>
							</c>
							<c ca="center">
								<p>limb blastema</p>
							</c>
							<c ca="center">
								<p>16244</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V1</p>
							</c>
							<c ca="center">
								<p>tail blastema</p>
							</c>
							<c ca="center">
								<p>1422</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V2</p>
							</c>
							<c ca="center">
								<p>brain</p>
							</c>
							<c ca="center">
								<p>3196</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V3</p>
							</c>
							<c ca="center">
								<p>liver</p>
							</c>
							<c ca="center">
								<p>792</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V4</p>
							</c>
							<c ca="center">
								<p>spleen</p>
							</c>
							<c ca="center">
								<p>337</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V5</p>
							</c>
							<c ca="center">
								<p>heart</p>
							</c>
							<c ca="center">
								<p>38</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V6</p>
							</c>
							<c ca="center">
								<p>gill</p>
							</c>
							<c ca="center">
								<p>3039</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V7</p>
							</c>
							<c ca="center">
								<p>stage 22 embryo</p>
							</c>
							<c ca="center">
								<p>96</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>AG</p>
							</c>
							<c ca="center">
								<p>liver, gonad, lung, kidney, heart, gill</p>
							</c>
							<c ca="center">
								<p>19871</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Further information is found in Methods and Materials.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>EST sequencing and clustering</p>
				</st>
				<p>A total of 46,064 cDNA clones were sequenced, yielding 39,982 high quality sequences for <it>A. mexicanum </it>and <it>A. t. tigrinum </it>(Table <tblr tid="T2">2</tblr>). Of these, 3,745 corresponded to mtDNA and were removed from the dataset; complete mtDNA genome data for these and other ambystomatid species will be reported elsewhere. The remaining nuclear ESTs for each species were clustered and assembled separately. We included in our <it>A. mexicanum </it>assembly an additional 16,030 high quality ESTs that were generated recently for regenerating tail and neurula stage embryos <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Thus, a total of 32,891 and 19,376 ESTs were clustered for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, respectively. Using PaCE clustering and CAP3 assembly, a similar number of EST clusters and contigs were identified for each species (Table <tblr tid="T2">2</tblr>). Overall contig totals were 11,190 and 9,901 for <it>A. mexicanum </it>and <it>A. t. tigrinum </it>respectively. Thus, although 13,515 more <it>A. mexicanum </it>ESTs were assembled, a roughly equivalent number of contigs were obtained for both species. This indicates that EST development was more efficient for <it>A. t. tigrinum, </it>presumably because ESTs were obtained primarily from the normalized AG library; indeed, there were approximately twice as many ESTs on average per <it>A. mexicanum </it>contig (Table <tblr tid="T2">2</tblr>). Thus, our EST project yielded an approximately equivalent number of contigs for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, and overall we identified &gt; 21,000 different contigs. Assuming that 20% of the contigs correspond to redundant loci, which has been found generally in large EST projects <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, we identified transcripts for approximately 17,000 different ambystomatid loci. If ambystomatid salamanders have approximately the same number of loci as other vertebrates (e.g. <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>), we have isolated roughly half the expected number of genes in the genome.</p>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>EST summary and assembly results.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>cDNA clones sequenced</p>
							</c>
							<c ca="left">
								<p>21830</p>
							</c>
							<c ca="left">
								<p>24234</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>high-quality sequences</p>
							</c>
							<c ca="left">
								<p>19383</p>
							</c>
							<c ca="left">
								<p>20599</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>mt DNA sequence</p>
							</c>
							<c ca="left">
								<p>2522</p>
							</c>
							<c ca="left">
								<p>1223</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>seqs submitted to NCBI</p>
							</c>
							<c ca="left">
								<p>16861</p>
							</c>
							<c ca="left">
								<p>19376</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>sequences assembled</p>
							</c>
							<c ca="left">
								<p>32891<sup>a</sup></p>
							</c>
							<c ca="left">
								<p>19376</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>PaCE clusters</p>
							</c>
							<c ca="left">
								<p>11381</p>
							</c>
							<c ca="left">
								<p>10226</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>ESTs in contigs</p>
							</c>
							<c ca="left">
								<p>25457</p>
							</c>
							<c ca="left">
								<p>12676</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>contigs</p>
							</c>
							<c ca="left">
								<p>3756</p>
							</c>
							<c ca="left">
								<p>3201</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>singlets</p>
							</c>
							<c ca="left">
								<p>7434</p>
							</c>
							<c ca="left">
								<p>6700</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>putative transcripts</p>
							</c>
							<c ca="left">
								<p>11190</p>
							</c>
							<c ca="left">
								<p>9901</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p><sup>a</sup>Includes 16,030 ESTs from [20].</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Identification of vertebrate sequences similar to <it>Ambystoma </it>contigs</p>
				</st>
				<p>We searched all contigs against several vertebrate databases to identify sequences that exhibited significant sequence similarity. As our objective was to reliably annotate as many contigs as possible, we first searched against 19,804 sequences in the NCBI human RefSeq database (Figure <figr fid="F1">1</figr>), which is actively reviewed and curated by biologists. This search revealed 5619 and 4973 "best hit" matches for the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>EST datasets at a BLASTX threshold of <it>E </it>= 10<sup>-7</sup>. The majority of contigs were supported at more stringent E-value thresholds (Table <tblr tid="T3">3</tblr>). Non-matching contigs were subsequently searched against the Non-Redundant (nr) Protein database and <it>Xenopus tropicalus </it>and <it>X. laevis </it>UNIGENE ESTs (Figure <figr fid="F1">1</figr>). These later two searches yielded a few hundred more 'best hit' matches, however a relatively large number of ESTs from both ambystomatid species were not similar to any sequences from the databases above. Presumably, these non-matching sequences were obtained from the non-coding regions of transcripts or they contain protein-coding sequences that are novel to salamander. Although the majority are probably of the former type, we did identify 3,273 sequences from the non-matching set that had open reading frames (ORFs) of at least 200 bp, and 911 of these were greater than 300 bp.</p>
				<fig id="F1">
					<title>
						<p>Figure 1</p>
					</title>
					<caption>
						<p>Results of BLASTX and TBLASTX searches to identify best BLAST hits for <it>Ambystoma </it>contigs searched against NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases</p>
					</caption>
					<text>
						<p><b>Results of BLASTX and TBLASTX searches to identify best BLAST hits for <it>Ambystoma </it>contigs searched against NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases</b>.</p>
					</text>
					<graphic file="1471-2164-5-54-1"/>
				</fig>
				<tbl id="T3">
					<title>
						<p>Table 3</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>contig search of NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p># BLASTX Best Matches</p>
							</c>
							<c ca="left">
								<p>
									<ul>6283</ul>
								</p>
							</c>
							<c ca="left">
								<p>
									<ul>5545</ul>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-100</sup></p>
							</c>
							<c ca="left">
								<p>630</p>
							</c>
							<c ca="left">
								<p>870</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-50 </sup>&gt; E<sup>-100</sup></p>
							</c>
							<c ca="left">
								<p>2015</p>
							</c>
							<c ca="left">
								<p>1990</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-20 </sup>&gt; E<sup>-50</sup></p>
							</c>
							<c ca="left">
								<p>2153</p>
							</c>
							<c ca="left">
								<p>1595</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-10 </sup>&gt; E<sup>-20</sup></p>
							</c>
							<c ca="left">
								<p>967</p>
							</c>
							<c ca="left">
								<p>745</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-7 </sup>&gt; E<sup>-10</sup></p>
							</c>
							<c ca="left">
								<p>518</p>
							</c>
							<c ca="left">
								<p>345</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<p>The distribution of ESTs among contigs can provide perspective on gene expression when clones are randomly sequenced from non-normalized cDNA libraries. In general, frequently sampled transcripts may be expressed at higher levels. We identified the 20 contigs from <it>A. mexicanum </it>and <it>A. t. tigrinum </it>that contained the most assembled ESTs (Table <tblr tid="T4">4</tblr>). The largest <it>A. t. tigrinum </it>contigs contained fewer ESTs than the largest <it>A. mexicanum </it>contigs, probably because fewer overall <it>A. t. tigrinum </it>clones were sequenced, with the majority selected from a normalized library. However, we note that the contig with the most ESTs was identified for <it>A. t. tigrinum: </it>delta globin. In both species, transcripts corresponding to globin genes were sampled more frequently than all other loci. This may reflect the fact that amphibians, unlike mammals, have nucleated red blood cells that are transcriptionally active. In addition to globin transcripts, a few other house-keeping genes were identified in common from both species, however the majority of the contigs were unique to each list. Overall, the strategy of sequencing cDNAs from a diverse collection of tissues (from normalized and non-normalized libraries) yielded different sets of highly redundant contigs. Only 25% and 28% of the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs, respectively, were identified in common (Figure <figr fid="F2">2</figr>). We also note that several hundred contigs were identified in common between Xenopus and <it>Ambystoma</it>; this will help facilitate comparative studies among these amphibian models.</p>
				<tbl id="T4">
					<title>
						<p>Table 4</p>
					</title>
					<caption>
						<p>Top 20 contigs with the most assembled ESTs.</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="center">
								<p>
									<b>Contig ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b># ESTs</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Best Human Match</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4615_Contig1</p>
							</c>
							<c ca="center">
								<p>415</p>
							</c>
							<c ca="left">
								<p>(NM_000519) delta globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_600_Contig1</p>
							</c>
							<c ca="center">
								<p>354</p>
							</c>
							<c ca="left">
								<p>(NM_182985) ring finger protein 36 isoform a</p>
							</c>
							<c ca="center">
								<p>E<sup>-110</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6279_Contig1</p>
							</c>
							<c ca="center">
								<p>337</p>
							</c>
							<c ca="left">
								<p>(NM_000559) A-gamma globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-32</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_10867_Contig1</p>
							</c>
							<c ca="center">
								<p>320</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5357_Contig1</p>
							</c>
							<c ca="center">
								<p>307</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-37</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9285_Contig3</p>
							</c>
							<c ca="center">
								<p>285</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_7987_Contig3</p>
							</c>
							<c ca="center">
								<p>252</p>
							</c>
							<c ca="left">
								<p>(NM_001402) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9285_Contig1</p>
							</c>
							<c ca="center">
								<p>240</p>
							</c>
							<c ca="left">
								<p>(NM_001101) beta actin; beta cytoskeletal actin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9279_Contig3</p>
							</c>
							<c ca="center">
								<p>218</p>
							</c>
							<c ca="left">
								<p>(NM_000223) keratin 12</p>
							</c>
							<c ca="center">
								<p>E<sup>-113</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_11203_Contig1</p>
							</c>
							<c ca="center">
								<p>181</p>
							</c>
							<c ca="left">
								<p>(NM_002032) ferritin, heavy polypeptide 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-70</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig2</p>
							</c>
							<c ca="center">
								<p>152</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C</p>
							</c>
							<c ca="center">
								<p>E<sup>-131</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3193_Contig1</p>
							</c>
							<c ca="center">
								<p>145</p>
							</c>
							<c ca="left">
								<p>(NM_004499) heterogeneous nuclear ribonucleoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-90</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig7</p>
							</c>
							<c ca="center">
								<p>134</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C</p>
							</c>
							<c ca="center">
								<p>E<sup>-131</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5005_Contig3</p>
							</c>
							<c ca="center">
								<p>132</p>
							</c>
							<c ca="left">
								<p>(NM_031263) heterogeneous nuclear ribonucleoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-124</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6225_Contig1</p>
							</c>
							<c ca="center">
								<p>125</p>
							</c>
							<c ca="left">
								<p>(NM_001152) solute carrier family 25, member 5</p>
							</c>
							<c ca="center">
								<p>E<sup>-151</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1066_Contig1</p>
							</c>
							<c ca="center">
								<p>122</p>
							</c>
							<c ca="left">
								<p>[31015660] IMAGE:6953586</p>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig4</p>
							</c>
							<c ca="center">
								<p>114</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C; keratin, epidermal type II</p>
							</c>
							<c ca="center">
								<p>E<sup>-132</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8187_Contig2</p>
							</c>
							<c ca="center">
								<p>113</p>
							</c>
							<c ca="left">
								<p>(NM_005507) cofilin 1 (non-muscle)</p>
							</c>
							<c ca="center">
								<p>E<sup>-65</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_2761_Contig1</p>
							</c>
							<c ca="center">
								<p>109</p>
							</c>
							<c ca="left">
								<p>(NM_001961) eukaryotic translation elongation factor2</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9187_Contig1</p>
							</c>
							<c ca="center">
								<p>105</p>
							</c>
							<c ca="left">
								<p>(NM_007355) heat shock 90 kDa protein 1, beta</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>
									<b>
										<it>A. t. tigrinum</it>
									</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6298_Contig1</p>
							</c>
							<c ca="center">
								<p>654</p>
							</c>
							<c ca="left">
								<p>(NM_000519) delta globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10099_Contig2</p>
							</c>
							<c ca="center">
								<p>193</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6470_Contig1</p>
							</c>
							<c ca="center">
								<p>167</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_9728_Contig2</p>
							</c>
							<c ca="center">
								<p>142</p>
							</c>
							<c ca="left">
								<p>(NM_000477) albumin precursor</p>
							</c>
							<c ca="center">
								<p>E<sup>-140</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6594_Contig1</p>
							</c>
							<c ca="center">
								<p>117</p>
							</c>
							<c ca="left">
								<p>(NM_001402) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5960_Contig1</p>
							</c>
							<c ca="center">
								<p>91</p>
							</c>
							<c ca="left">
								<p>(NM_001101) beta actin; beta cytoskeletal actin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7383_Contig1</p>
							</c>
							<c ca="center">
								<p>77</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6645_Contig1</p>
							</c>
							<c ca="center">
								<p>76</p>
							</c>
							<c ca="left">
								<p>(NM_001063) transferrin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7226_Contig4</p>
							</c>
							<c ca="center">
								<p>74</p>
							</c>
							<c ca="left">
								<p>(NM_006009) tubulin, alpha 3</p>
							</c>
							<c ca="center">
								<p>E<sup>-160</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7191_Contig1</p>
							</c>
							<c ca="center">
								<p>67</p>
							</c>
							<c ca="left">
								<p>(NM_019016) keratin 24</p>
							</c>
							<c ca="center">
								<p>E<sup>-89</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10121_Contig1</p>
							</c>
							<c ca="center">
								<p>64</p>
							</c>
							<c ca="left">
								<p>(NM_005141) fibrinogen, beta chain preproprotein</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6705_Contig1</p>
							</c>
							<c ca="center">
								<p>63</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7854_Contig1</p>
							</c>
							<c ca="center">
								<p>62</p>
							</c>
							<c ca="left">
								<p>(NM_021870) fibrinogen, gamma chain isoform</p>
							</c>
							<c ca="center">
								<p>E<sup>-121</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6139_Contig1</p>
							</c>
							<c ca="center">
								<p>52</p>
							</c>
							<c ca="left">
								<p>(NM_001404) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7226_Contig2</p>
							</c>
							<c ca="center">
								<p>51</p>
							</c>
							<c ca="left">
								<p>(NM_006009) tubulin, alpha 3</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10231_Contig1</p>
							</c>
							<c ca="center">
								<p>44</p>
							</c>
							<c ca="left">
								<p>(NM_003018) surfactant, pulmonary-associated prot.</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6619_Contig1</p>
							</c>
							<c ca="center">
								<p>36</p>
							</c>
							<c ca="left">
								<p>(NM_000041) apolipoprotein E</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7232_Contig2</p>
							</c>
							<c ca="center">
								<p>35</p>
							</c>
							<c ca="left">
								<p>(NM_003651) cold shock domain protein A</p>
							</c>
							<c ca="center">
								<p>E<sup>-46</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5768_Contig1</p>
							</c>
							<c ca="center">
								<p>34</p>
							</c>
							<c ca="left">
								<p>(NM_003380) vimentin</p>
							</c>
							<c ca="center">
								<p>E<sup>-177</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_9784_Contig3</p>
							</c>
							<c ca="center">
								<p>32</p>
							</c>
							<c ca="left">
								<p>|XP_218445.1| similar to RIKEN cDNA 1810065E05</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>Venn diagram of BLAST comparisons among amphibian EST projects</p>
					</caption>
					<text>
						<p><b>Venn diagram of BLAST comparisons among amphibian EST projects. </b>Values provided are numbers of reciprocal best BLAST hits (<it>E&lt;</it>10<sup>-20</sup>) among quality masked <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies and a publicly available <it>X. tropicalis </it>EST assembly <url>http://www.sanger.ac.uk/Projects/X_tropicalis</url></p>
					</text>
					<graphic file="1471-2164-5-54-2"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Functional annotation</p>
				</st>
				<p>For the 10,592 contigs that showed significant similarity to sequences from the human RefSeq database, we obtained Gene Ontology (23) information to describe ESTs in functional terms. Although there are hundreds of possible annotations, we chose a list of descriptors for molecular and biological processes that we believe are of interest for research programs currently utilizing salamanders as model organisms (Table <tblr tid="T5">5</tblr>). In all searches, we counted each match between a contig and a RefSeq sequence as identifying a different ambystomatid gene, even when different contigs matched the same RefSeq reference. In almost all cases, approximately the same number of matches was found per functional descriptor for both species. This was not simply because the same loci were being identified for both species, as only 20% of the total number of searched contigs shared sufficient identity (BLASTN; <it>E&lt;</it>10<sup>-80 </sup>or <it>E&lt;</it>10<sup>-20</sup>) to be potential homologues. In this sense, the sequencing effort between these two species was complementary in yielding a more diverse collection of ESTs that were highly similar to human gene sequences.</p>
				<tbl id="T5">
					<title>
						<p>Table 5</p>
					</title>
					<caption>
						<p>Functional annotation of contigs</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Molecular Function (0016209)</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>antioxidant (0016209)</p>
							</c>
							<c ca="center">
								<p>25</p>
							</c>
							<c ca="center">
								<p>29</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>binding (0005488)</p>
							</c>
							<c ca="center">
								<p>3117</p>
							</c>
							<c ca="center">
								<p>2578</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>chaparone (0003754)</p>
							</c>
							<c ca="center">
								<p>100</p>
							</c>
							<c ca="center">
								<p>85</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>enzyme regulation (003023)</p>
							</c>
							<c ca="center">
								<p>193</p>
							</c>
							<c ca="center">
								<p>223</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>motor (0003774)</p>
							</c>
							<c ca="center">
								<p>73</p>
							</c>
							<c ca="center">
								<p>75</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>signal transduction (0004871)</p>
							</c>
							<c ca="center">
								<p>344</p>
							</c>
							<c ca="center">
								<p>375</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>structural protein (0005198)</p>
							</c>
							<c ca="center">
								<p>501</p>
							</c>
							<c ca="center">
								<p>411</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>transcriptional reg. (0030528)</p>
							</c>
							<c ca="center">
								<p>296</p>
							</c>
							<c ca="center">
								<p>221</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>translational reg. (0045182)</p>
							</c>
							<c ca="center">
								<p>94</p>
							</c>
							<c ca="center">
								<p>59</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>bone remodeling (0046849)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>circulation (0008015)</p>
							</c>
							<c ca="center">
								<p>23</p>
							</c>
							<c ca="center">
								<p>78</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>immune response (000695)</p>
							</c>
							<c ca="center">
								<p>182</p>
							</c>
							<c ca="center">
								<p>263</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>respiratory ex. (0009605)</p>
							</c>
							<c ca="center">
								<p>254</p>
							</c>
							<c ca="center">
								<p>288</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>respiratory in. (0009719)</p>
							</c>
							<c ca="center">
								<p>72</p>
							</c>
							<c ca="center">
								<p>58</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>stress (0006950)</p>
							</c>
							<c ca="center">
								<p>263</p>
							</c>
							<c ca="center">
								<p>320</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Biological Process (0008150)</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Cellular (0009987)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>activation (0001775)</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
							<c ca="center">
								<p>6</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>aging and death (0008219)</p>
							</c>
							<c ca="center">
								<p>158</p>
							</c>
							<c ca="center">
								<p>148</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>communication (0007154)</p>
							</c>
							<c ca="center">
								<p>701</p>
							</c>
							<c ca="center">
								<p>696</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>differentiation (0030154)</p>
							</c>
							<c ca="center">
								<p>31</p>
							</c>
							<c ca="center">
								<p>20</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>extracellular mat. (0043062)</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>growth and main. (0008151)</p>
							</c>
							<c ca="center">
								<p>1731</p>
							</c>
							<c ca="center">
								<p>1445</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>migration (0016477)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>14</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>motility (0006928)</p>
							</c>
							<c ca="center">
								<p>163</p>
							</c>
							<c ca="center">
								<p>154</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Developmental (0007275)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>aging (0007568)</p>
							</c>
							<c ca="center">
								<p>32</p>
							</c>
							<c ca="center">
								<p>21</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>embryonic (0009790)</p>
							</c>
							<c ca="center">
								<p>6</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>growth (0040007)</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>morphogenesis (0009653)</p>
							</c>
							<c ca="center">
								<p>350</p>
							</c>
							<c ca="center">
								<p>272</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>pigment (0048066)</p>
							</c>
							<c ca="center">
								<p>13</p>
							</c>
							<c ca="center">
								<p>26</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>post embryonic (0009791)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>13</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>reproduction (0000003)</p>
							</c>
							<c ca="center">
								<p>42</p>
							</c>
							<c ca="center">
								<p>27</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Physiological (0007582)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>coagulation (0050817)</p>
							</c>
							<c ca="center">
								<p>22</p>
							</c>
							<c ca="center">
								<p>73</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>death and aging (0016265)</p>
							</c>
							<c ca="center">
								<p>159</p>
							</c>
							<c ca="center">
								<p>148</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>homeostasis (0042592)</p>
							</c>
							<c ca="center">
								<p>22</p>
							</c>
							<c ca="center">
								<p>27</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>metabolism (0008152)</p>
							</c>
							<c ca="center">
								<p>3059</p>
							</c>
							<c ca="center">
								<p>2513</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>secretion (0046903)</p>
							</c>
							<c ca="center">
								<p>9</p>
							</c>
							<c ca="center">
								<p>16</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>sex differentiation (0007548)</p>
							</c>
							<c ca="center">
								<p>3</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Numbers in parentheses reference GO numbers [23].</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Informatic searches for regeneration probes</p>
				</st>
				<p>The value of a salamander model to regeneration research will ultimately rest on the ease in which data and results can be cross-referenced to other vertebrate models. For example, differences in the ability of mammals and salamanders to regenerate spinal cord may reflect differences in the way cells of the ependymal layer respond to injury. As is observed in salamanders, ependymal cells in adult mammals also proliferate and differentiate after spinal cord injury (SCI) <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>; immediately after contusion injury in adult rat, ependymal cell numbers increase and proliferation continues for at least 4 days [<abbrgrp><abbr bid="B26">26</abbr></abbrgrp>; but see <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>]. Rat ependymal cells share some of the same gene expression and protein properties of embryonic stem cells <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, however no new neurons have been observed to derive from these cells <it>in vivo </it>after SCI <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Thus, although endogenous neural progenitors of the ependymal layer may have latent regenerative potential in adult mammals, this potential is not realized. Several recently completed microarray analyses of spinal cord injury in rat now make it possible to cross-reference information between amphibians and mammals. For example, we searched the complete list of significantly up and down regulated genes from Carmel et al. <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and Song et al. <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> against all <it>Ambystoma </it>ESTs. Based upon amino acid sequence similarity of translated ESTs (TBLASTX; <it>E</it>&lt;10<sup>-7</sup>), we identified DNA sequences corresponding to 69 of these 164 SCI rat genes (Table <tblr tid="T6">6</tblr>). It is likely that we have sequence corresponding to other presumptive orthologues from this list as many of our ESTs only contain a portion of the coding sequence or the untranslated regions (UTR), and in many cases our searches identified closely related gene family members. Thus, many of the genes that show interesting expression patterns after SCI in rat can now be examined in salamander.</p>
				<tbl id="T6">
					<title>
						<p>Table 6</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>contigs that show sequence similarity to rat spinal cord injury genes.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>
									<b>Ambystoma Contig ID</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>RAT cDNA clone</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_7440_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1150557|c-myc, exon 2</p>
							</c>
							<c ca="center">
								<p>E<sup>-29</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4624_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1468968| brain acyl-CoA synthtase II</p>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4083_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_4_G20_ab1</p>
							</c>
							<c ca="left">
								<p>gi|1552375| SKR6 gene, a CB1 cannabinoid recept.</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT009B_B04</p>
							</c>
							<c ca="left">
								<p>gi|17352488| cyclin ania-6a</p>
							</c>
							<c ca="center">
								<p>E<sup>-46</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_3719_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-114</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8423_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1778068| binding zyginI</p>
							</c>
							<c ca="center">
								<p>E<sup>-102</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7064_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1836160| Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3225_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1906612| Rattus norvegicus CXC chemokine</p>
							</c>
							<c ca="center">
								<p>E<sup>-68</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_13_F03_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL285B_A06</p>
							</c>
							<c ca="left">
								<p>gi|203042| (Na+, K+)-ATPase-beta-2 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6994_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-65</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL014B_F12</p>
							</c>
							<c ca="left">
								<p>gi|203048| plasma membrane Ca2+ ATPase-isoform 2</p>
							</c>
							<c ca="center">
								<p>E<sup>-112</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_5_F07_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-92</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1251_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|203167| GTP-binding protein (G-alpha-i1)</p>
							</c>
							<c ca="center">
								<p>E<sup>-110</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_3_P14_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-152</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_22_B01_ab1</p>
							</c>
							<c ca="left">
								<p>gi|203336| catechol-O-methyltransferase</p>
							</c>
							<c ca="center">
								<p>E<sup>-47</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_17_N04_ab1</p>
							</c>
							<c ca="left">
								<p>gi|203467| voltage-gated K+ channel protein (RK5)</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v1_p8_c16_triplex5ld_</p>
							</c>
							<c ca="left">
								<p>gi|203583| cytosolic retinol-binding protein (CRBP)</p>
							</c>
							<c ca="center">
								<p>E<sup>-77</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6321_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-18</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5399_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|204647| heme oxygenase gene</p>
							</c>
							<c ca="center">
								<p>E<sup>-67</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2577_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-67</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4647_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|204664| heat shock protein 27 (Hsp27)</p>
							</c>
							<c ca="center">
								<p>E<sup>-83</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_12_M05_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-51</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL285C_F02</p>
							</c>
							<c ca="left">
								<p>gi|205404| metabotropic glutamate receptor 3</p>
							</c>
							<c ca="center">
								<p>E<sup>-41</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_2_B24_ab1</p>
							</c>
							<c ca="left">
								<p>gi|205508| myelin/oligodendrocyte glycoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5740_V2_p10_M20_TriplEx5ld_</p>
							</c>
							<c ca="left">
								<p>gi|205531| metallothionein-2 and metallothionein 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_V2_p5_A2_TriplEx5ld_</p>
							</c>
							<c ca="left">
								<p>gi|205537| microtubule-associated protein 1A</p>
							</c>
							<c ca="center">
								<p>E<sup>-59</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1645_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|205633| Na, K-ATPase alpha-2 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-149</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig328</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig45</p>
							</c>
							<c ca="left">
								<p>gi|205683| smallest neurofilament protein (NF-L)</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT016A_A09</p>
							</c>
							<c ca="left">
								<p>gi|205693| nerve growth factor-induced (NGFI-A)</p>
							</c>
							<c ca="center">
								<p>E<sup>-95</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_I09_Ag2_p9_K24_M13R</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT007A_E07</p>
							</c>
							<c ca="left">
								<p>gi|205754| neuronal protein (NP25)</p>
							</c>
							<c ca="center">
								<p>E<sup>-64</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7148_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-57</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9504_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|206161| peripheral-type benzodiazepine receptor</p>
							</c>
							<c ca="center">
								<p>E<sup>-73</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL016B_B02</p>
							</c>
							<c ca="left">
								<p>gi|206166| protein kinase C type III</p>
							</c>
							<c ca="center">
								<p>E<sup>-36</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_981_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-27</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_19_k3_t3_</p>
							</c>
							<c ca="left">
								<p>gi|206170| brain type II Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-117</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v11_p42_j20_t3_049_ab1 gi|207138| norvegicus syntaxin B</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>1e<sup>-079</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_h19_t3_</p>
							</c>
							<c ca="left">
								<p>gi|207473| neural receptor protein-tyrosine kinase</p>
							</c>
							<c ca="center">
								<p>E<sup>-40</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig336</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_E10_Ag2_p18_O19_M13</p>
							</c>
							<c ca="left">
								<p>gi|2116627| SNAP-25A</p>
							</c>
							<c ca="center">
								<p>E<sup>-123</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_211_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|220713| calcineurin A alpha</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_7_K14_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-87</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT014A_G03</p>
							</c>
							<c ca="left">
								<p>gi|220839| platelet-derived growth factor A chain</p>
							</c>
							<c ca="center">
								<p>E<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_9_M15_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-56</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_19_M06_ab1</p>
							</c>
							<c ca="left">
								<p>gi|2501807| brain digoxin carrier protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-55</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig100</p>
							</c>
							<c ca="left">
								<p>gi|2746069| MAP-kinase phosphatase (cpg21)</p>
							</c>
							<c ca="center">
								<p>E<sup>-108</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_A16_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-70</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8345_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|2832312| survival motor neuron (smn)</p>
							</c>
							<c ca="center">
								<p>E<sup>-40</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8032_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-49</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3580_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|294567| heat shock protein 70 (HSP70)</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8592_Contig2</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-161</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_17_N08_ab1</p>
							</c>
							<c ca="left">
								<p>gi|2961528| carboxyl-terminal PDZ</p>
							</c>
							<c ca="center">
								<p>E<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL286C_D09</p>
							</c>
							<c ca="left">
								<p>gi|298325| sodium-dependent neurotransmitter tran.</p>
							</c>
							<c ca="center">
								<p>E<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig95</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig461</p>
							</c>
							<c ca="left">
								<p>gi|2996031| brain finger protein (BFP)</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_O19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-23</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_E16_Ag2_p8_O20_M13R</p>
							</c>
							<c ca="left">
								<p>gi|3135196| Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-33</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig188</p>
							</c>
							<c ca="left">
								<p>gi|3252500| CC chemokine receptor protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6961_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|3319323| suppressor of cytokine signaling-3</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_p15_t3_</p>
							</c>
							<c ca="left">
								<p>gi|349552| P-selectin</p>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_218_Contig2</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-99</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig506</p>
							</c>
							<c ca="left">
								<p>gi|3707306| Normalized rat embryo, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-14</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_I16_Ag2_p5_N7_M13R</p>
							</c>
							<c ca="left">
								<p>gi|3711670| Normalized rat muscle, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_V1_p1_a10_Triplex5Ld</p>
							</c>
							<c ca="left">
								<p>gi|3727094| Normalized rat ovary, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_v2_p1_D20_triplex5ld</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT005B_F02</p>
							</c>
							<c ca="left">
								<p>gi|3811504| Normalized rat brain, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_22_I04_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Ag2_p34_N23_M13R</p>
							</c>
							<c ca="left">
								<p>gi|405556| adenylyl cyclase-activated serotonin</p>
							</c>
							<c ca="center">
								<p>E<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_1_H02_ab1</p>
							</c>
							<c ca="left">
								<p>gi|4103371| putative potassium channel TWIK</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4589_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|4135567| Normalized rat embryo, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-32</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig220</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4093_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|4228395| cDNA clone UI-R-A0-bc-h-02-0-UI</p>
							</c>
							<c ca="center">
								<p>E<sup>-104</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_21_2_m7_t3_</p>
							</c>
							<c ca="left">
								<p>gi|425471| nuclear factor kappa B p105 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8535_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v6_p1_j6_triplex5_1ld_</p>
							</c>
							<c ca="left">
								<p>gi|430718| Sprague Dawley inducible nitric oxide</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_15_D22_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-41</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3498_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|436934| Sprague Dawley protein kinase C rec.</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6648_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL279A_B12</p>
							</c>
							<c ca="left">
								<p>gi|464196| phosphodiesterase I</p>
							</c>
							<c ca="center">
								<p>E<sup>-49</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_25_P03_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-75</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8708_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|466438| 40kDa ribosomal protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-168</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5877_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-168</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_a9_t3_</p>
							</c>
							<c ca="left">
								<p>gi|493208| stress activated protein kinase alpha II</p>
							</c>
							<c ca="center">
								<p>E<sup>-51</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_A13_ab1</p>
							</c>
							<c ca="left">
								<p>gi|517393| tau microtubule-associated protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-44</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_12_J14_ab1</p>
							</c>
							<c ca="left">
								<p>gi|55933| c-fos</p>
							</c>
							<c ca="center">
								<p>E<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_21_2_l13_t3_</p>
							</c>
							<c ca="left">
								<p>gi|56822| major synaptic vesicel protein p38</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2065_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-50</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_10965_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|56828| nuclear oncoprotein p53</p>
							</c>
							<c ca="center">
								<p>E<sup>-75</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5315_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-66</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4245_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|56909| pJunB gene</p>
							</c>
							<c ca="center">
								<p>E<sup>-50</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_G05_Ag2_p9_G8_M13R</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT013D_C12</p>
							</c>
							<c ca="left">
								<p>gi|56919| region fragment for protein kinase C</p>
							</c>
							<c ca="center">
								<p>E<sup>-33</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_21_H19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9585_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|57007| ras-related mRNA rab3</p>
							</c>
							<c ca="center">
								<p>E<sup>-61</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4885_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_1_M03_ab1</p>
							</c>
							<c ca="left">
								<p>gi|57238| silencer factor B</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT008B_D05</p>
							</c>
							<c ca="left">
								<p>gi|57341| transforming growth factor-beta 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_24_I16_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9533_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|57479| vimentin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5768_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL283B_A11</p>
							</c>
							<c ca="left">
								<p>gi|596053| immediate early gene transcription</p>
							</c>
							<c ca="center">
								<p>E<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_13_J19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v6_p4_j2_triplex5_1ld_</p>
							</c>
							<c ca="left">
								<p>gi|790632| macrophage inflammatory protein-1alpha</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2146_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|951175| limbic system-associated membrane prot.</p>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v11_p54_o4_t3_</p>
							</c>
							<c ca="left">
								<p>gi|971274| neurodegeneration associated protein 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_2_J12_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<p>Similar gene expression programs may underlie regeneration of vertebrate appendages such as fish fins and tetrapod limbs. Regeneration could depend on reiterative expression of genes that function in patterning, morphogenesis, and metabolism during normal development and homeostasis. Or, regeneration could depend in part on novel genes that function exclusively in this process. We investigated these alternatives by searching <it>A. mexicanum </it>limb regeneration ESTs against UNIGENE zebrafish fin regeneration ESTs (Figure <figr fid="F3">3</figr>). This search identified 1357 significant BLAST hits (TBLASTX; <it>E</it>&lt;10<sup>-7</sup>) that corresponded to 1058 unique zebrafish ESTs. We then asked whether any of these potential regeneration homologues were represented uniquely in limb and fin regeneration databases (and not in databases derived from other zebrafish tissues). A search of the 1058 zebrafish ESTs against &gt; 400,000 zebrafish ESTs that were sampled from non-regenerating tissues revealed 43 that were unique to the zebrafish regeneration database (Table <tblr tid="T7">7</tblr>). Conceivably, these 43 ESTs may represent transcripts important to appendage regeneration. For example, our search identified several genes (e.g. <it>hspc128</it>, pre-<it>B-cell colony enhancing factor 1</it>, <it>galectin 4</it>, <it>galectin 8</it>) that may be expressed in progenitor cells that proliferate and differentiate during appendage regeneration. Overall, our results suggest that regeneration is achieved largely through the reiterative expression of genes having additional functions in other developmental contexts, however a small number of genes may be expressed uniquely during appendage regeneration.</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Results of BLASTN and TBLASTX searches to identify best BLAST hits for <it>A. mexicanum </it>regeneration ESTs searched against zebrafish EST databases</p>
					</caption>
					<text>
						<p><b>Results of BLASTN and TBLASTX searches to identify best BLAST hits for <it>A. mexicanum </it>regeneration ESTs searched against zebrafish EST databases. </b>A total of 14,961 <it>A. mexicanum </it>limb regeneration ESTs were assembled into 4485 contigs for this search.</p>
					</text>
					<graphic file="1471-2164-5-54-3"/>
				</fig>
				<tbl id="T7">
					<title>
						<p>Table 7</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>limb regeneration contigs that show sequence similarity to zebrafish fin regeneration ESTs</p>
					</caption>
					<tblbdy cols="5">
						<r>
							<c ca="left">
								<p>
									<b>Mex. Contigs</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Human ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Zfish ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="5">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig94</p>
							</c>
							<c ca="center">
								<p>gi|10835079|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-63</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319632</p>
							</c>
							<c ca="center">
								<p>1e<sup>-58</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_30_a11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|32306539|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-58</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312602</p>
							</c>
							<c ca="center">
								<p>1e<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig615</p>
							</c>
							<c ca="center">
								<p>gi|4502693|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-70</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313407</p>
							</c>
							<c ca="center">
								<p>1e<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_23_l13_t3_</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-31</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_9_e22_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4758788|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-98</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309914</p>
							</c>
							<c ca="center">
								<p>1e<sup>-29</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_8_l17_t3_</p>
							</c>
							<c ca="center">
								<p>gi|21361310|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-16</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313396</p>
							</c>
							<c ca="center">
								<p>1e<sup>-27</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig531</p>
							</c>
							<c ca="center">
								<p>gi|13775198|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-27</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309680</p>
							</c>
							<c ca="center">
								<p>1e<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig152</p>
							</c>
							<c ca="center">
								<p>gi|5453712|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-32</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239884</p>
							</c>
							<c ca="center">
								<p>1e<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_32h_j20_t3_</p>
							</c>
							<c ca="center">
								<p>gi|39777601|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-79</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136499</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1011</p>
							</c>
							<c ca="center">
								<p>gi|39752675|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136499</p>
							</c>
							<c ca="center">
								<p>1e<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p50_b24_t3_</p>
							</c>
							<c ca="center">
								<p>gi|41208832|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-36</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319219</p>
							</c>
							<c ca="center">
								<p>1e<sup>-23</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig589</p>
							</c>
							<c ca="center">
								<p>gi|4506505|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-56</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312662</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig785</p>
							</c>
							<c ca="center">
								<p>gi|33695095|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-61</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12264765</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig157</p>
							</c>
							<c ca="center">
								<p>gi|21361122|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-138</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313094</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p42_j20_t3_049_ab1</p>
							</c>
							<c ca="center">
								<p>gi|47591841|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-100</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12137806</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig610</p>
							</c>
							<c ca="center">
								<p>gi|10801345|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-114</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310326</p>
							</c>
							<c ca="center">
								<p>1e<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_27_o1_t3_</p>
							</c>
							<c ca="center">
								<p>gi|7706429|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-72</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310422</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig439</p>
							</c>
							<c ca="center">
								<p>gi|4504799|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_31_d5_t3_</p>
							</c>
							<c ca="center">
								<p>gi|8923956|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-50</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12264745</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p41_h12_t3_026_ab1</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig129</p>
							</c>
							<c ca="center">
								<p>gi|34932414|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-103</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313534</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_14_j21_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4505325|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-42</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136571</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1321</p>
							</c>
							<c ca="center">
								<p>gi|4501857|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-80</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_19_k3_t3_</p>
							</c>
							<c ca="center">
								<p>gi|26051212|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-106</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12137637</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig488</p>
							</c>
							<c ca="center">
								<p>gi|4557525|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-105</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12311975</p>
							</c>
							<c ca="center">
								<p>1e<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_k19_t3_</p>
							</c>
							<c ca="center">
								<p>gi|16950607|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-43</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12196214</p>
							</c>
							<c ca="center">
								<p>1e<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig195</p>
							</c>
							<c ca="center">
								<p>gi|4557231|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-99</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-14</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_14_h19_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4503787|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-86</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p51_d20_t3_</p>
							</c>
							<c ca="center">
								<p>gi|30520322|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12321150</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g3-n14</p>
							</c>
							<c ca="center">
								<p>gi|13654278|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-23</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12318856</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_29_f2_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4506517|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312662</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g4-h23</p>
							</c>
							<c ca="center">
								<p>gi|24111250|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-33</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312651</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Math_p2_A2_T3_</p>
							</c>
							<c ca="center">
								<p>No human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12078998</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_f4_t3_</p>
							</c>
							<c ca="center">
								<p>gi|41148476|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-67</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319663</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig952</p>
							</c>
							<c ca="center">
								<p>gi|21264558|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-61</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12318843</p>
							</c>
							<c ca="center">
								<p>1e<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g4-g21</p>
							</c>
							<c ca="center">
								<p>gi|11995474|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12192716</p>
							</c>
							<c ca="center">
								<p>1e<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig854</p>
							</c>
							<c ca="center">
								<p>gi|8922789|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-117</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313534</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1105</p>
							</c>
							<c ca="center">
								<p>gi|6912638||</p>
							</c>
							<c ca="center">
								<p>1e<sup>-83</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12079967</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_26_f7_t3_</p>
							</c>
							<c ca="center">
								<p>gi|30181238|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-83</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319880</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig949</p>
							</c>
							<c ca="center">
								<p>gi|21284385|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-68</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12290856</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g3-n3</p>
							</c>
							<c ca="center">
								<p>gi|18490991|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-64</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320832</p>
							</c>
							<c ca="center">
								<p>1e<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p41_m16_t3_007_ab1</p>
							</c>
							<c ca="center">
								<p>gi|4885661|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-33</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig653</p>
							</c>
							<c ca="center">
								<p>gi|4505047|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-124</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239868</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1349</p>
							</c>
							<c ca="center">
								<p>gi|9665259|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-46</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320840</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6h12</p>
							</c>
							<c ca="center">
								<p>gi|31317231|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-43</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12321311</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p43h_i14_t3_070_ab1</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_d11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|7661790|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-35</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12196146</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_k22_t3_</p>
							</c>
							<c ca="center">
								<p>gi|5031977|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-124</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12242267</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p48_g2_t3_087_ab1</p>
							</c>
							<c ca="center">
								<p>gi|11496277|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-60</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312396</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_30_e11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|32483357|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-56</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309103</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_28_f23_t3_</p>
							</c>
							<c ca="center">
								<p>gi|42544191|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239884</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_12_p16_t3_</p>
							</c>
							<c ca="center">
								<p>gi|21361553|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_32h_a8_t3_</p>
							</c>
							<c ca="center">
								<p>gi|11386179|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312152</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Human RefSeq sequence ID's are provided to allow cross-referencing.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>DNA sequence polymorphisms within and between <it>A. mexicanum </it>and <it>A. t. tigrinum</it></p>
				</st>
				<p>The identification of single nucleotide polymorphisms (SNPs) within and between orthologous sequences of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>is needed to develop DNA markers for genome mapping <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>, quantitative genetic analysis <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>, and population genetics <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. We estimated within species polymorphism for both species by calculating the frequency of SNPs among ESTs within the 20 largest contigs (Table <tblr tid="T4">4</tblr>). These analyses considered a total of 30,638 base positions for <it>A. mexicanum </it>and 18,765 base positions for <it>A. t. tigrinum</it>. Two classes of polymorphism were considered in this analysis: those occurring at moderate (identified in 10&#8211;30% of the EST sequences) and high frequencies (identified in at least 30% of the EST sequences). Within the <it>A. mexicanum </it>contigs, 0.49% and 0.06% of positions were polymorphic at moderate and high frequency, while higher levels of polymorphism were observed for <it>A. t. tigrinum </it>(1.41% and 0.20%). Higher levels of polymorphism are expected for <it>A. t. tigrinum </it>because they exist in larger, out-bred populations in nature.</p>
				<p>To identify SNPs between species, we had to first identify presumptive, interspecific orthologues. We did this by performing BLASTN searches between the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies, and the resulting alignments were filtered to retain only those alignments between sequences that were one another's reciprocal best BLAST hit. As expected, the number of reciprocal 'best hits' varied depending upon the <it>E </it>value threshold, although increasing the <it>E </it>threshold by several orders of magnitude had a disproportionately small effect on the overall total length of BLAST alignments. A threshold of <it>E&lt;</it>10<sup>-80</sup>yielded 2414 alignments encompassing a total of 1.25 Mbp from each species, whereas a threshold of <it>E&lt;</it>10<sup>-20 </sup>yielded 2820 alignments encompassing a total of 1.32 Mbp. The percent sequence identity of alignments was very high among presumptive orthologues, ranging from 84&#8211;100% at the more stringent <it>E </it>threshold of <it>E&lt;</it>10<sup>-80</sup>. On average, <it>A. mexicanum </it>and <it>A. t. tigrinum </it>transcripts are estimated to be 97% identical at the nucleotide level, including both protein coding and UTR sequence. This estimate for nuclear sequence identity is surprisingly similar to estimates obtained from complete mtDNA reference sequences for these species (96%, unpublished data), and to estimates for partial mtDNA sequence data obtained from multiple natural populations <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. These results are consistent with the idea that mitochondrial mutation rates are lower in cold versus warm-blooded vertebrates <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. From a resource perspective, the high level of sequence identity observed between these species suggests that informatics will enable rapidly the development of probes between these and other species of the <it>A. tigrinum </it>complex.</p>
			</sec>
			<sec>
				<st>
					<p>Extending EST resources to other ambystomatid species</p>
				</st>
				<p>Relatively little DNA sequence has been obtained from species that are closely related to commonly used model organisms, and yet, such extensions would greatly facilitate genetic studies of natural phenotypes, population structures, species boundaries, and conservatism and divergence of developmental mechanisms. Like many amphibian species that are threatened by extinction, many of these ambystomatid salamanders are currently in need of population genetic studies to inform conservation and management strategies [e.g. <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>]. We characterized SNPs from orthologous <it>A. mexicanum </it>and <it>A. t. tigrinum </it>ESTs and extended this information to develop informative molecular markers for a related species, <it>A. ordinarium</it>. <it>Ambystoma ordinarium </it>is a stream dwelling paedomorph endemic to high elevation habitats in central Mexico <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. This species is particularly interesting from an ecological and evolutionary standpoint because it harbors a high level of intraspecific mitochondrial variation, and as an independently derived stream paedomorph, is unique among the typically pond-breeding tiger salamanders. As a reference of molecular divergence, <it>Ambystoma ordinarium </it>shares approximately 98 and 97% mtDNA sequence identity with <it>A. mexicanum </it>and <it>A. t. tigrinum </it>respectively <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
				<p>To identify informative markers for <it>A. ordinarium</it>, <it>A. mexicanum and A. t. tigrinum </it>EST contigs were aligned to identify orthologous genes with species-specific sequence variations (SNPs or Insertion/Deletions = INDELs). Primer pairs corresponding to 123 ESTs (Table <tblr tid="T8">8</tblr>) were screened by PCR using a pool of DNA template made from individuals of 10 <it>A. ordinarium </it>populations. Seventy-nine percent (N = 97) of the primer pairs yielded amplification products that were approximately the same size as corresponding <it>A. mexicanum </it>and <it>A. t. tigrinum </it>fragments, using only a single set of PCR conditions. To estimate the frequency of intraspecific DNA sequence polymorphism among this set of DNA marker loci, 43 loci were sequenced using a single individual sampled randomly from each of the 10 populations, which span the geographic range of <it>A. ordinarium</it>. At least one polymorphic site was observed for 20 of the sequenced loci, with the frequency of polymorphisms dependent upon the size of the DNA fragment amplified. Our results suggest that the vast majority of primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>EST orthologues can be used to amplify the corresponding sequence in a related <it>A. tigrinum </it>complex species, and for small DNA fragments in the range of 150&#8211;500 bp, approximately half are expected to have informative polymorphisms.</p>
				<tbl id="T8">
					<title>
						<p>Table 8</p>
					</title>
					<caption>
						<p>EST loci used in a population-level PCR amplification screen in <it>A. ordinarium</it></p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>
									<b>Locus ID</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Forward Primer 5' to 3'</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Reverse Primer 5' to 3'</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>1F8</p>
							</c>
							<c ca="left">
								<p>AAGAAGGTCGGGATTGTGGGTAA</p>
							</c>
							<c ca="left">
								<p>CAGCCTTCCTCTTCATCTTTGTCTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>1H3</p>
							</c>
							<c ca="left">
								<p>GGCAAATGCTGGTCCCAACACAAA</p>
							</c>
							<c ca="left">
								<p>GGACAACACTGCCAAATACCACAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>2C8</p>
							</c>
							<c ca="left">
								<p>GCAAGCACCAGCCACATAAAG</p>
							</c>
							<c ca="left">
								<p>GGCCACCATAACCACTCTGCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>3B10</p>
							</c>
							<c ca="left">
								<p>TCAAAACGAATAAGGGAAGAGCGACTG</p>
							</c>
							<c ca="left">
								<p>TTGCCCCCATAATAAGCCATCCATC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5E7</p>
							</c>
							<c ca="left">
								<p>ACGCTTCGCTGGGGTTGACAT</p>
							</c>
							<c ca="left">
								<p>CGGTAGGATTTCTGGTAGCGAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5F4</p>
							</c>
							<c ca="left">
								<p>CCGAGATGAGATTTATAGAAGGAC</p>
							</c>
							<c ca="left">
								<p>TAGGGGAAGTTAAACATAGATAGAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6A3</p>
							</c>
							<c ca="left">
								<p>GTTTATGAAGGCGAGAGGGCTATGACCA</p>
							</c>
							<c ca="left">
								<p>ATCTTGTTCTCCTCGCCAGTGCTCTTGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B1</p>
							</c>
							<c ca="left">
								<p>TGATGCTGGCGAGTACAAACCCCCTTCT</p>
							</c>
							<c ca="left">
								<p>TTTACCATTCCTTCCCTTCGGCAGCACA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B3</p>
							</c>
							<c ca="left">
								<p>ACCACGTGCTGTCTTCCCATCCAT</p>
							</c>
							<c ca="left">
								<p>ACGAAGCTCATTGTAGAAGGTGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B4</p>
							</c>
							<c ca="left">
								<p>CCCACGATGAATTGGAATTGGACAT</p>
							</c>
							<c ca="left">
								<p>CTGCCTGCCAGACCTACAGACTATCGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6C4</p>
							</c>
							<c ca="left">
								<p>ATGGCGCCAAAGTGATGAGTA</p>
							</c>
							<c ca="left">
								<p>GGGCCAGGCACACGACCACAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6D2</p>
							</c>
							<c ca="left">
								<p>ATCAAGGCTGGCATGGTGGTCA</p>
							</c>
							<c ca="left">
								<p>GGGGGTCGTTCTTGCTGTCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6H8</p>
							</c>
							<c ca="left">
								<p>GAAGAAGACAGAAACGCAGGAGAAAAAC</p>
							</c>
							<c ca="left">
								<p>CGGGCGGGGGCGGGTCACAGTAAAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL005B_A01.5.1</p>
							</c>
							<c ca="left">
								<p>GACAGGTCATGAACTTTTGAAAATAA</p>
							</c>
							<c ca="left">
								<p>AAAGTATATGTACCAAATGGGAGAGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL006A_G07.5.1</p>
							</c>
							<c ca="left">
								<p>GATGTCCTCTCCACTATACAAGTGTG</p>
							</c>
							<c ca="left">
								<p>GTTTGACTTGTCACCACTTTATCAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL012D_F02.5.1</p>
							</c>
							<c ca="left">
								<p>ACAGCCAGAAATAGAAACTTTGAACT</p>
							</c>
							<c ca="left">
								<p>TGAAAGTATGTATTGTTTTCACAGGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL013C_E01.5.1</p>
							</c>
							<c ca="left">
								<p>AGGATGAAATAATATGCTGTGCTTC</p>
							</c>
							<c ca="left">
								<p>ACCGTGATAAACTCCATCCCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL014D_B11.5.1</p>
							</c>
							<c ca="left">
								<p>AGCAAAACTCCTCTATGAATCTCG</p>
							</c>
							<c ca="left">
								<p>ATTGCACACTAAATAGGTGAATACGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL279A_G10.5.1</p>
							</c>
							<c ca="left">
								<p>ATGGCAGGATGAAGAAAGACAT</p>
							</c>
							<c ca="left">
								<p>ATGCACTTTGGACCCACTGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1023.5.1</p>
							</c>
							<c ca="left">
								<p>TGTGGTTATTGGACTACTTCACTCTC</p>
							</c>
							<c ca="left">
								<p>AAACGTCCATTTGACACTGTATTTTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1166.5.1</p>
							</c>
							<c ca="left">
								<p>GAATGAAGAGAAAATGTTTTGAAGGT</p>
							</c>
							<c ca="left">
								<p>GCACAGTATTGGCTATGAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1311.5.1</p>
							</c>
							<c ca="left">
								<p>AGAAAACTGTGTCAAGCTTATTTTCC</p>
							</c>
							<c ca="left">
								<p>CAACTTAGTGTTCACATTTCTGAGGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1335.5.1</p>
							</c>
							<c ca="left">
								<p>CCACTTATGGTAGTTCCCACTTTTAT</p>
							</c>
							<c ca="left">
								<p>GCTAAAGAATACCAAGAACCTTTGAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1381.5.1</p>
							</c>
							<c ca="left">
								<p>GTCACAGGTATAACATTGAAAGGATG</p>
							</c>
							<c ca="left">
								<p>TAAATGAATCAAACATTGAAGAGAGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1459.5.1</p>
							</c>
							<c ca="left">
								<p>ATAACAAGGACATGTTCTGCTGG</p>
							</c>
							<c ca="left">
								<p>CTAGCAGAACCCTGTATAGCCTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1506.5.1</p>
							</c>
							<c ca="left">
								<p>AGGATATCCGCTCAGAAATATGAAG</p>
							</c>
							<c ca="left">
								<p>CTGACCACTTGCAAAACTTACTACCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1578.5.1</p>
							</c>
							<c ca="left">
								<p>CCTAGAACATTACCAAAACAGACTCA</p>
							</c>
							<c ca="left">
								<p>AATGAAGAAGTATTGCATGTGAGAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1647.5.1</p>
							</c>
							<c ca="left">
								<p>GTACAACGTCAGGCAAAGCTATTCT</p>
							</c>
							<c ca="left">
								<p>ATCTCCAACACCGTGGCTAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1717.5.1</p>
							</c>
							<c ca="left">
								<p>GAACTTGTTGGCAGGTTTCTCTT</p>
							</c>
							<c ca="left">
								<p>CTAGTGATAGGTTGGACATACCAGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1796.5.1</p>
							</c>
							<c ca="left">
								<p>TGTGGGTATGTATATGGCTAACTTGT</p>
							</c>
							<c ca="left">
								<p>AGATTTTATGTGCTACTGCATTTACG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1908.5.1</p>
							</c>
							<c ca="left">
								<p>CTCATGACTTAATTGCTGTTCTTCG</p>
							</c>
							<c ca="left">
								<p>ATAACCATTCTGAGGTTTTGAGTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1941.5.1</p>
							</c>
							<c ca="left">
								<p>ATCTCCTGCTTCATCTCTTGATTTAT</p>
							</c>
							<c ca="left">
								<p>TAACAGATTTAATAAACGTCCCCTTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1943.5.1</p>
							</c>
							<c ca="left">
								<p>AGTACGATGAATCTGGTCCTTCAAT</p>
							</c>
							<c ca="left">
								<p>CCACAATACTGACATACTCTGGTCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig325.5.1</p>
							</c>
							<c ca="left">
								<p>GTGAAGTCAGTGAGTAAAGTCCATGT</p>
							</c>
							<c ca="left">
								<p>CTAGGATACCAGTGGGAGAGTGTAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig330.5.1</p>
							</c>
							<c ca="left">
								<p>GTCATCACCTCCACTACTTCACAAG</p>
							</c>
							<c ca="left">
								<p>TTTTGGCACTGTAAGATTCTATGAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig536.5.1</p>
							</c>
							<c ca="left">
								<p>CCTTAGGTAGAACAGACTGAAGCAG</p>
							</c>
							<c ca="left">
								<p>GAAACATGAAACTGGACTTGTTTTAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig917.5.1</p>
							</c>
							<c ca="left">
								<p>GGATGCAGATTCTTCCTATTTTACTC</p>
							</c>
							<c ca="left">
								<p>CTGGTCACTTTACTTGTTTTCAGTGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig926.5.1</p>
							</c>
							<c ca="left">
								<p>TTCATCACATTCTACTTCACAAATCA</p>
							</c>
							<c ca="left">
								<p>CTAGGCAAGCAAGCTTTCTAATAGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig93.5.1</p>
							</c>
							<c ca="left">
								<p>GAATAAAAGCAACAATTGCAGAGTTA</p>
							</c>
							<c ca="left">
								<p>CTCGACTCCTTCTACGATCTCTACTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig990.5.1</p>
							</c>
							<c ca="left">
								<p>GTTTAGGTTAGTATGAAGGATCCCAA</p>
							</c>
							<c ca="left">
								<p>TGCCAGTACTCACCAATTAGTAAAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C12</p>
							</c>
							<c ca="left">
								<p>CCCAAATCCAGGAGTTCAAA</p>
							</c>
							<c ca="left">
								<p>TGGGACCTGGGGCTTCATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C13</p>
							</c>
							<c ca="left">
								<p>TTGCCCGAGAAAAGGAAGGACATA</p>
							</c>
							<c ca="left">
								<p>CAAGGGTGGGTGAGGGACATC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C5</p>
							</c>
							<c ca="left">
								<p>F-CACTGTTGACTTGGGTTATGTTATT</p>
							</c>
							<c ca="left">
								<p>CTGCTCCTAGGGTTTGTGAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C7</p>
							</c>
							<c ca="left">
								<p>CCCGTGTGGCTGGCTTGTGC</p>
							</c>
							<c ca="left">
								<p>TCGGCTACTTTGGTGTTTTTCTCCCTCAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C9</p>
							</c>
							<c ca="left">
								<p>TGGTCCGGCAACAGCATCAGA</p>
							</c>
							<c ca="left">
								<p>GCTTTTCGGTATTCAACGGCAGAGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C9</p>
							</c>
							<c ca="left">
								<p>TGGTCCGGCAACAGCATCAGA</p>
							</c>
							<c ca="left">
								<p>GCTTTTCGGTATTCAACGGCAGAGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D5</p>
							</c>
							<c ca="left">
								<p>AGACCCTTGCTGTGTAACTGCT</p>
							</c>
							<c ca="left">
								<p>GACTGGGACTGACTTCTATGACG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D6</p>
							</c>
							<c ca="left">
								<p>CAGCGTGCCCACCCGATAGAA</p>
							</c>
							<c ca="left">
								<p>TCCCAAAAAGTAAAATGTGCAAAGAAAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D7</p>
							</c>
							<c ca="left">
								<p>CAGCGGTGGAAATGACAAACAGG</p>
							</c>
							<c ca="left">
								<p>CCAAGACGACGAGGAACGGTATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-E12</p>
							</c>
							<c ca="left">
								<p>CAACCATGAGAGGAGGCCAGAGAAC</p>
							</c>
							<c ca="left">
								<p>AAAACAGCACTACCTACAAAACCCTATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-F1</p>
							</c>
							<c ca="left">
								<p>TTAGTTTGGGTGCAGACAGGA</p>
							</c>
							<c ca="left">
								<p>GGTGCTCAACAACAAATCAACT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-F20</p>
							</c>
							<c ca="left">
								<p>TCCCCAACAACTCCAGCAGAT</p>
							</c>
							<c ca="left">
								<p>GGAAACCACCTAGACGAAAAATG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I18</p>
							</c>
							<c ca="left">
								<p>CATGTTTGTGGGTGTGGTGAA</p>
							</c>
							<c ca="left">
								<p>AAAAGCGGCATCTGGTAAGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I19</p>
							</c>
							<c ca="left">
								<p>ACCCAGACCTGTCCACCTCA</p>
							</c>
							<c ca="left">
								<p>GAACAGCTCTCCAATCCACAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I21</p>
							</c>
							<c ca="left">
								<p>CCAAGCGAAGGAGGCGTGTG</p>
							</c>
							<c ca="left">
								<p>CATGTGGCTCTTTGTTTCTGGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I5</p>
							</c>
							<c ca="left">
								<p>TAATCGTGTTTGGTGGCATCCTTGAGTC</p>
							</c>
							<c ca="left">
								<p>AGCAGCAGTTCCATTTTCCCACACCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I8</p>
							</c>
							<c ca="left">
								<p>ACCTGCAGTGGGCTAAGACC</p>
							</c>
							<c ca="left">
								<p>ATGGAAATAATAAAATAAAATGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J10</p>
							</c>
							<c ca="left">
								<p>CGTTCGCTTTGCCTGCCACA</p>
							</c>
							<c ca="left">
								<p>GGCTCTTCCCCGGTCGTCCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J17</p>
							</c>
							<c ca="left">
								<p>AGCGCCTTCTACACGGACAC</p>
							</c>
							<c ca="left">
								<p>TATGCCCCAATTACTCTTCTGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J2</p>
							</c>
							<c ca="left">
								<p>TACAGTAACTATGCCAAGATGAAATG</p>
							</c>
							<c ca="left">
								<p>CAATATGGATAATGGCTGTAGACC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J20</p>
							</c>
							<c ca="left">
								<p>ATCCTCCAAGCTCACTACAACA</p>
							</c>
							<c ca="left">
								<p>CCAGCCCCTTCCCAAACAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J9</p>
							</c>
							<c ca="left">
								<p>CTGTCATTGCCTGCATCGGGGAGAAG</p>
							</c>
							<c ca="left">
								<p>TGTTGAGGGGAAGCAGTTTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-K2</p>
							</c>
							<c ca="left">
								<p>GCTTTCGCCTTTGACACCTC</p>
							</c>
							<c ca="left">
								<p>GGCCGGACCATTGCTGAAGAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L11</p>
							</c>
							<c ca="left">
								<p>AAAGTGACCATCCAGTGCCCAAACCT</p>
							</c>
							<c ca="left">
								<p>CCGGCCGAAACTGACGAGATACATTAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L13</p>
							</c>
							<c ca="left">
								<p>TCAGCTGCACTAGGTTTGTC</p>
							</c>
							<c ca="left">
								<p>CATTTTGATTTGCTCCATAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L19</p>
							</c>
							<c ca="left">
								<p>GACAACCTTGAATCCTTTATG</p>
							</c>
							<c ca="left">
								<p>AGATGTTGGTTGGTGACTTAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L20</p>
							</c>
							<c ca="left">
								<p>TGGGCATAGATGGCAAGGAAAAA</p>
							</c>
							<c ca="left">
								<p>CCCCCAGCATCTCGCATACAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L7</p>
							</c>
							<c ca="left">
								<p>GTGCTACAGGAAGGAATGGATG</p>
							</c>
							<c ca="left">
								<p>TAGCACAGGAACAGCCGACAATAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-M14</p>
							</c>
							<c ca="left">
								<p>CCGCTTGGACATGAGGAGAT</p>
							</c>
							<c ca="left">
								<p>TGGCAAAGAAACAGAACACAACTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-M19</p>
							</c>
							<c ca="left">
								<p>GAGAAGTAGTGTCCCGGCAGAAAC</p>
							</c>
							<c ca="left">
								<p>ATGGGTGAAAACTTAGGTGAAATG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-N9</p>
							</c>
							<c ca="left">
								<p>GCGGGGCAATACATGACGTTCCACAG</p>
							</c>
							<c ca="left">
								<p>GACCCCCATCTCCGTTTCCCATTCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O1</p>
							</c>
							<c ca="left">
								<p>GGGGTAGAGCACAGTCCAGTT</p>
							</c>
							<c ca="left">
								<p>TTGCAAGGCCGAAAAGGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O12</p>
							</c>
							<c ca="left">
								<p>GGAATTCCGGGGCACTACT</p>
							</c>
							<c ca="left">
								<p>TCGCGAGGACGGGGAAGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O24</p>
							</c>
							<c ca="left">
								<p>CGGCCTTCCTGCAGTACAACCATC</p>
							</c>
							<c ca="left">
								<p>TCGGCAACGTGAAGACCATA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-A11</p>
							</c>
							<c ca="left">
								<p>GCCCCTGGAAGCTGTTGTGA</p>
							</c>
							<c ca="left">
								<p>GGGGTCCATCCGAGTCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-A7</p>
							</c>
							<c ca="left">
								<p>TTACCCCACAGACAAAATCAACACC</p>
							</c>
							<c ca="left">
								<p>GGCGGCCCCTCATAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-B1</p>
							</c>
							<c ca="left">
								<p>GGGCCTAGTCCTGCTGGTC</p>
							</c>
							<c ca="left">
								<p>CAAAGAGTGCGGAGAAATGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-B8</p>
							</c>
							<c ca="left">
								<p>CAACATGCGACCACTATAGCCACTTCCT</p>
							</c>
							<c ca="left">
								<p>CGCCACCGCCACCACCACA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-C2</p>
							</c>
							<c ca="left">
								<p>TTTGCAGGAAGAGTCATAACACAG</p>
							</c>
							<c ca="left">
								<p>GTCAACAACACCCTTTTCCCTTCCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-D1</p>
							</c>
							<c ca="left">
								<p>GCAGGTCGGCAAGAAGCTAAAGAAGGAA</p>
							</c>
							<c ca="left">
								<p>AGGGTTGGTTTGAAAGGATGTGCTGGTAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-E17</p>
							</c>
							<c ca="left">
								<p>GGAGCACCAAATTCAAGTCAG</p>
							</c>
							<c ca="left">
								<p>CGTCCCCGGTCAATCTCCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-E19</p>
							</c>
							<c ca="left">
								<p>CCAGTTTGAGCCCCAGGAG</p>
							</c>
							<c ca="left">
								<p>TCGCGGCAGTCAAGAGGTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-F17</p>
							</c>
							<c ca="left">
								<p>TATCCTCTTATTGCTGCATTCTCCTCAC</p>
							</c>
							<c ca="left">
								<