The <it>PIT1 </it>gene polymorphisms were associated with chicken growth traits

1471-2156-9-20 1471-2156 Research article The <it>PIT1 </it>gene polymorphisms were associated with chicken growth traits Nie Qinghua nqinghua@scau.edu.cn Fang Meixia amg@scau.edu.cn Xie Liang amg@scau.edu.cn Zhou Min amg@scau.edu.cn Liang Zhangmin amg@scau.edu.cn Luo Ziping amg@scau.edu.cn Wang Guohuang amg@scau.edu.cn Bi Wensen amg@scau.edu.cn Liang Canjian amg@scau.edu.cn Zhang Wei amg@scau.edu.cn Zhang Xiquan xqzhang@scau.edu.cn

Department of Animal Genetics, Breeding and Reproduction, College of Animal Science, South China Agricultural University, Guangzhou 510642, Guangdong, China

BMC Genetics 1471-2156 2008 9 1 20 http://www.biomedcentral.com/1471-2156/9/20 18304318 10.1186/1471-2156-9-20 23 8 2007 27 2 2008 27 2 2008 2008 Nie et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

With crucial roles on the differentiation of anterior pituitary and the regulation of the prolactin (PRL), growth hormone (GH) and thyroid-stimulating hormone-β (TSH-β) genes, the chicken PIT1 gene is regarded as a key candidate gene for production traits. In this study, five reported polymorphisms (MR1-MR5) of the PIT1 gene were genotyped in a full sib F₂resource population to evaluate their effects on growth, carcass and fatty traits in chickens.

Results

Marker-trait association analyses showed that, MR1 was significantly associated with shank diameters (SD) at 84 days (P < 0.05), hatch weight (HW) and shank length (SL) at 84 days (P < 0.01), MR2 was significantly associated with BW at 28, 42 days and average daily gain (ADG) at 0–4 weeks (P < 0.05), and MR3 was significantly associated with ADG at 4–8 weeks (P < 0.05). MR4 was associated with SL at 63, 77, 84 days and BW at 84 days (P < 0.05), as well as SD at 77 days (P < 0.01). Significant association was also found of MR5 with BW at 21, 35 days and SD at 63 days (P < 0.05), BW at 28 days and ADG at 0–4 weeks (P < 0.01). Both T allele of MR4 and C allele of MR5 were advantageous for chicken growth. The PIT1 haplotypes were significantly associated with HW (P = 0.0252), BW at 28 days (P = 0.0390) and SD at 56 days (P = 0.0400). No significant association of single SNP and haplotypes with chicken carcass and fatty traits was found (P > 0.05).

Conclusion

Our study found that polymorphisms of PIT1 gene and their haplotypes were associated with chicken growth traits and not with carcass and fatty traits.

Background

As a kind of POU (Pit-Oct-Unc)-domain binding factor, pituitary-specific transcription factor (PIT1, or GHF1, or POU1F1) has been proved to bind and transactivate promoters of growth hormone (GH), prolactin (PRL) and thyroid-stimulating hormone-β (TSH-β) genes 123. Other bioactivities of PIT1 have also been reported, like regulating anterior pituitary development 45 and pituitary cell proliferation 6, silencing or delaying adrenarche in human 7, being related to dwarf phenotype in mice 8, as well as inducing the differentiation of hepatic progenitor cells into PRL-producing cells 9. Initially activated under the control of Phophet of PIT1 (PROP-1) gene, PIT1 gene is auto-regulated in expression 10 and its mRNA is present in any cell types of pituitary, whereas PIT1 protein mainly expresses in lactotrophs, somatotrophs and thyrotrophs, which secrete PRL, GH and TSH-β 11.

Until now, PIT1 cDNA has been identified in a variety of species, and previous studies showed that the PIT1 gene comprised 6 exons in mammals and 7 exons in birds and fishes, seen as differences in precursor length 121314. The chicken PIT1 cDNA has firstly been isolated and sequenced by Tanaka et al. (1999) 15, and its three isoforms of PIT1*, PIT1β* and PIT1ω* induced by alternative splicing have also been isolated and found to comprise 335, 363, and 327 amino acids, respectively 16. The alternative splicing of PIT1 gene has also been reported in other species 1718. According to the chicken genome sequences released in May of 2006 19, the chicken PIT1 gene is located at chromosome 1 (GGA1) and spans over 14 kb in length.

Due to its crucial regulatory function and a variety of bioactivities, PIT1 has been regarded as a key candidate gene for production performance. There are indications that variations of PIT1 gene are related to growth, carcass and fatty traits in pig 2021222324, growth and carcass traits in cattle 2526. In chickens, although a total of 23 single nucleotide polymorphism (SNP) and a 57 bp indel have been lately identified in 2400 bp discrete region of PIT1 gene, their genetic effects on chicken production traits remain unclear 27. Recently, it has been shown that a non-synonymous SNP at POU domain (A → T, Asn229Ile) is significantly associated with body weight at 8 wk 28.

In this study, five reported polymorphisms of the chicken PIT1 gene were genotyped in a full sib F₂resource population to evaluate their genetic association with chicken growth, carcass and fatty traits were also observed.

Methods

Chicken populations

A full sib F₂resource population as described by Lei et al. (2005) was used in this study 29. The cross of 9 White Recessive Rock (WRR) males and 9 Chinese Xinghua (X) females and the reciprocal cross of 6 WRR females and 6 X males produced 17 F₁families and 454 F₂full-sib individuals. F₂chickens were raised in floor pens and fed with commercial corn-soybean-based diets that met all NRC requirements. All birds from three generations were genotyped to evaluate the effects of PIT1 variations on chicken production performance. All 57 tested traits were 31 growth traits of HW, BW at 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84 and 90 days, SL at 42, 49, 56, 63, 70, 77, 84 and 90 days, SD at 42, 49, 56, 63, 70, 77 and 84 days, ADG at 0–4 and 4–8 weeks, and 14 carcass traits of head width (HWD), breast width (BWD), body length (BL), breast angle (BA), carcass weight (CW), eviscerated weight with giblet (EWG), eviscerated weight (EW), breast muscle weight (BMW), leg muscle weight (LMW), wing weight (WW), head and neck weight (HNW), shank and toe weight (STW), heart-liver- proventriculus-gizzard weight (HLPGW) and small intestine length (SIL), as well as 12 fatty traits of subcutaneous fat thickness (SFT), cingulated fat width (CFW), abdominal fat pad weight (AFW), leg muscle colour (LMC), breast muscle colour (BMC), shear force of leg muscle (SFLM), shear force of breast muscle (SFBM), leg muscle conductivity (LMCD), breast muscle conductivity (BMCD), water loss rate of muscle (WLRM), transversal area of the leg muscle fibre (TALMF) and transversal area of the breast muscle fibre (TABMF) 29.

Markers and primers

Five reported polymorphisms of the chicken PIT1 gene that could be easily genotyped by either PCR-RFLP or simple PCR were selected as markers to evaluate their effects on chicken production traits. These polymorphisms were a 57 bp indel (MR1) 27 and 4 SNP (MR2-MR5). Four primer pairs of PR1-PR4 were designed and synthesized to amplify specific fragments covering MR1-MR5 (Table 1). The detailed information for these polymorphisms is presented in Table 1.

Table 1

Detail information for MR1-MR5 of the chicken PIT1 gene

Markers

Source¹

Variation

Region

Primers (forward/reverse) (5' → 3')

Size (bp)²

Enzyme

MR1

Nie et al. 2005

57 bp indel

Intron 2

PR1 (gtcaaggcaaatattctgtacc/tgcatgttaatttggctctg)

387 or 330

MR2

Rs13905611

C/T

Intron 5

PR2 (ggaccctctctaacagctctc/gggaagaatacagggaaagg)

599

TaqI

MR3

Rs13687125

A/G

Intron 5

PR2 (as described above)

599

MspI

MR4

Rs13687127

C/T

Intron 5

PR3 (ggggattttgccactttaggg/tgggtaaggctctggcactgt)

442

EcoRI

MR5

Rs13687128

C/T

Exon 6 (I syn)

PR4 (tgggaagaacagtttatggc/tggctagcttgtaagggaatc)

483

TasI

¹MR1 was reported by Nie et al. (2005); MR2-MR5 were released by NCBI with accession number of Rs13905611, Rs13687125 Rs13687127, and Rs13687128, respectively. The chromosomal sites for MR1-MR5 were nt 96213503–96213559, nt 96221521, nt 96221553, nt 96222619, and nt 96224228, respectively. ²indicated length of PCR products

Genotyping by PCR-RFLP procedure

PCR was performed in 25 μL mixture containing 50 ng of chicken genomic DNA, 1 × PCR buffer, 12.5 pmol of primers (PR1-PR4), 100 μM of each dNTP, 1.5 mM MgCl₂and 1.0 U Taq DNA polymerase (Sangon Biological Engineering Technology Company, Shanghai, China). PCR was run in a Mastercycler gradient (M. J. Research Co Ltd, USA) with the following procedure: 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 45 s at annealing temperature (58–62°C), 1 min at 72°C, and a final extension of 5 min at 72°C. Genotypes of MR1 were directly observed by 2% agarose gel electrophoresis with PCR product amplified by PR1. PCR products of PR2-PR4 were further digested at 37°C overnight with TaqI, MspI, EcoRI and TasI (Table 1). The digestion mixture contained 8 μL PCR products, 1 × digestion buffer, and 3.0 U of each enzyme. Genotypes of MR2-MR5 were finally determined in TFM-40 Ultraviolet Transilluminator (UVP Company, USA) after 2.0% agarose gel electrophoresis of digestion mixture for half an hour.

Statistical analyses

Haplotype inference

For 454 F₂individuals, genotype data of MR1-MR5 were used to infer haplotypes with PHASE 2.0 software 30.

Marker-trait association analyses

Marker-trait association analyses were performed with SAS GLM procedure (SAS Institute, 1996) and the genetic effects were analyzed using the following mixed model:

Y = μ+G+D+H+S+e

where Y is a trait observation, μ is the overall population mean, G is the fixed effect of genotype, D is the random effect of dam, H is the fixed effect of hatch, S is the fixed effect of sex (male or female), and e is the residual random error. With the above model, association of each of MR1-MR5 and their haplotypes with the 57 production traits was performed to evaluate its genetic effect on chicken growth, body composition and fat deposition.

Results

Genotype and haplotype inference

For each of MR1-MR5, three genotypes were found in the total population. Haplotypes inferred from genotype data showed that a total of 13 haplotypes were found. These haplotype contained two major ones of H1 ("DTGCC", 74.56% or 671 of 900) and H2 ("ITGTT", 12.89% or 116 of 900), six minor ones of H3 ('ITACC', 2.66% or 24 of 900), H4 ('ITGCC', 2.33% or 21 of 900), H5 ('ICGCC', 2.33% or 21 of 900), H6 ('ITGTC', 1.88% or 17 of 900), H7 ('DTGTC', 1.00% or 9 of 900) and H7 ('DCGCC', 1.00% or 9 of 900) with frequencies between 1% and 5%, as well as five rare ones (H9-H13) with frequencies lower than 1%.

Association of single SNP with chicken production traits

Results showed that MR1 was significantly associated with SD at 84 days (P < 0.05) and highly significantly associated with HW and SL at 84 days (P < 0.01), and MR2 was significantly associated with BW at 28, 42 days and ADG at 0–4 weeks (P < 0.05). MR3 was significantly associated with ADG at 4–8 weeks (P < 0.05). Moreover, MR4 was significantly associated with SL at 63, 77, 84 days and BW at 84 days (P < 0.05) and highly significantly associated with SD at 77 days (P < 0.01), and T rather than C was advantageous for chicken growth (Table 2). MR5 was significantly associated with BW at 21, 35 days, and SD at 63 days (P < 0.05) and highly significantly associated with BW at 28 days and ADG at 0–4 weeks (P < 0.01), and C allele was advantageous for chicken growth (Table 3).

Table 2

Association of MR4 with chicken growth traits

Traits¹

P value

Least squares Mean ± S.D²

CC (335)

CT (105)

TT (11)

SL at 63 days (mm)

0.0197

9.43 ± 0.14^ab

8.99 ± 0.22^a

10.00 ± 0.43^b

SL at 77 days (mm)

0.0333

88.56 ± 0.82^a

87.74 ± 1.34^a

94.22 ± 2.59^b

SD at 77 days (mm)

0.0065

9.90 ± 0.13^A

9.61 ± 0.21^A

10.81 ± 0.40^B

BW at 84 days (g)

0.0207

1463 ± 19.36^a

1436 ± 32.92^a

1667 ± 82.23^b

SL at 84 days (mm)

0.0346

88.28 ± 0.44^a

87.41 ± 0.74^a

92.13 ± 1.85^b

¹SL = shank length; SD = shank diameter; BW = body weight. ²Numbers in bracket referred to sample size for each genotype. ^a,bMeans within a row with no common superscript differ significantly (P < 0.05). ^A,BMeans within a row with no common superscript differ highly significantly (P < 0.01).

Table 3

Associations of MR5 with chicken growth traits

Traits¹

P value

Least squares Mean ± S.E²

CC (331)

CT (92)

TT (28)

BW at 21 days (g)

0.0469

211.8 ± 1.92^a

206.4 ± 3.67^ab

196.4 ± 5.83^b

BW at 28 days (g)

0.0045

313.3 ± 3.04^A

301.8 ± 5.83^A

281.0 ± 9.11^B

BW at 35 days (g)

0.0153

441.3 ± 4.73^a

415.6 ± 9.11^b

402.5 ± 14.24^b

SD at 63 days (mm)

0.0284

9.45 ± 0.13^ab

8.93 ± 0.23^a

9.69 ± 0.36^b

ADG at 0–4 weeks (g/d)

0.0051

10.11 ± 0.11^A

9.74 ± 0.21^A

8.96 ± 0.32^B

¹BW = body weight; SD = shank diameter at 63 d of age; ADG = average daily gain. ²Numbers in bracket referred to sample size for each genotype. ^a,bMeans within a row with no common superscript differ significantly (P < 0.05). ^A,BMeans within a row with no common superscript differ highly significantly (P < 0.01).

None of these polymorphisms was significantly associated with any of chicken carcass and fatty traits (P > 0.05).

Association of PIT1 haplotypes with chicken production traits

As far as haplotypes were concerned, a total of 428 individuals with 10 diplotypes (271 of H1H1, 62 of H1H2, 24 of H1H3, 15 of H1H6, 13 of H1H4, 10 of H1H5, 9 of H2H5, 8 of H2H4, 8 of H2H6, 8 of H2H7) were used in association analysis. Results showed that MR1-MR5 haplotypes were significantly associated with growth traits of HW (P = 0.0252), BW at 28 days (P = 0.0390) and SD at 56 days (P = 0.0400). Among ten diplotypes, H2H4 had much higher value of HW (mean = 30.2), BW at 28 days (mean = 352.6) and SD at 56 days (mean = 9.24) compared with other ones. Nevertheless, the PIT1 haplotypes were not significantly associated with any of chicken carcass and fatty traits (P > 0.05).

It was concluded that polymorphisms of PIT1 gene were associated with chicken growth traits, but not with carcass and fatty traits.

Discussion and Conclusion

In this study, polymorphisms of the PIT1 gene were related to chicken growth traits. Until now, associations of the PIT1 gene with growth traits were reported in human 31, pig 1920212223 and cattle 2526. In chicken, a non-synonymous SNP (Asn299Ile) in exon 6 of the PIT1 gene was significantly associated with body weight at 8 wk, and its allele frequencies differed significantly between meat-type and lay-type chickens 28. Another SNP in exon 6 (MR5) was associated with ADG at 0–4 weeks, BW at 21, 28, 35 days and SD at 63 days as indicated by this study. Furthermore, three adjacent SNP in intron 5 (MR2-MR4) were associated with ADG at 0–4 and 4–8 weeks, BW at 28, 42 and 84 days, SL at 63, 77, and 84 days, as well as SD at 77 days. Until now, some QTL for body weight were identified in GGA1 32333435, however, only one reported QTL covered the 96 Mb region (total chromosomal size of 201 Mb) where the chicken PIT1 gene located 36. It seemed that these SNP may be in linkage disequilibrium with causative mutation(s), which situated in this region and played crucial roles on chicken growth.

It was interesting that the PIT1 gene polymorphisms were associated with none of chicken carcass and fatty traits. In previous studies, variations of the PIT1 gene were related to carcass and fatty traits in pig 20212224, carcass traits in cattle 25. However, no association was found of five polymorphisms in the PIT1 gene with 26 carcass and fatty traits in this study. In addition, haplotype analysis also provided similar results. This was surprising because some carcass traits were correlated with growth traits to some extent, and therefore it still required further study for confirmation.

It was further indicated that polymorphisms of the PIT1 gene affected chicken growth at different stages. MR2, MR3 and MR5 seemed to have higher effects on chicken early growth, as they were associated with ADG at 0–4 and 4–8 weeks, BW at 21, 28, 35 and 42 days, and SD at 63 days, respectively. Otherwise, MR1 and MR4 seemed to have higher effects on chicken growth in middle stage, as they were associated with SL at 63, 77 and 84 days, SD at 77 and 84 days, and BW at 84 days. As far as different genotypes were compared, both T allele of MR4 and C allele of MR5 were advantageous for chicken growth.

It was concluded that polymorphisms of PIT1 gene and their haplotypes were associated with chicken growth traits.

Authors' contributions

QN analyzed the data and drafted the manuscript. MF, XL and MZ participated in the data analyses. Both of ZL, GW, WB, CL and WZ carried out the genotyping studies. QN and XZ conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.

Acknowledgements

This work was funded by projects under the Major State Basic Research Development Program, China, project no. 2006CB102100, and the National Natural Science Foundation of China (project number: 30600429). Many thanks were given to Dr. Menghua Li (MTT, Biotechnology and Food Research, Jokioinen, Finland) for his good suggestions and comments on this manuscript.

The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein Bodner M Castrillo JL Theill LE Deerinck T Ellisman M Karin M Cell 1988 55 505 518 10.1016/0092-8674(88)90037-2 2902927 Role of Pit-1 in the gene expression of growth hormone, prolactin, and thyrotropin Cohen LE Wondisford FE Radovick S Endocrinol Metab Clin North Am 1996 25 523 540 10.1016/S0889-8529(05)70339-X 8879985 Induction of GH, PRL, and TSH beta mRNA by transfection of Pit-1 in a human pituitary adenoma-derived cell line Miyai S Yoshimura S Iwasaki Y Takekoshi S Lloyd RV Osamura RY Cell Tissue Res 2005 322 269 277 10.1007/s00441-005-0033-z 16133148 Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1 Li S Crenshaw EB Rawson EJ Simmons DM Swanson LW Rosenfeld MG Nature 1990 347 528 533 10.1038/347528a0 1977085 Anterior pituitary development and Pit-1/GHF-1 transcription factor de la Hoya M Vila V Jimenez O Castrillo JL Cell Mol Life Sci 1998 54 1059 1066 10.1007/s000180050234 9817984 Function of the homeodomain protein GHF1 in pituitary cell proliferation Castrillo JL Theill LE Karin M Science 1991 253 197 199 10.1126/science.1677216 1677216 Absent or delayed adrenarche in Pit-1/POU1F1 deficiency Taha D Mullis PE Ibanez L de Zegher F Horm Res 2005 64 175 179 10.1159/000088793 16210857 The Pit-1 transcription factor gene is a candidate for the murine Snell dwarf mutation Camper SA Saunders TL Katz RW Reeves RH Genomics 1990 8 586 590 10.1016/0888-7543(90)90050-5 1981057 Pituitary transcription factor-1 induces transient differentiation of adult hepatic stem cells into prolactin-producing cells in vivo Lee EJ Russell T Hurley L Jameson JL Mol Endocrinol 2005 19 964 971 10.1210/me.2004-0034 15637144 Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism Sornson MW Wu W Dasen JS Flynn SE Norman DJ O'Connell SM Gukovsky I Carriere C Ryan AK Miller AP Zuo L Gleiberman AS Andersen B Beamer WG Rosenfeld MG Nature 1996 384 327 333 10.1038/384327a0 8934515 Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors Simmons DM Voss JW Ingraham HA Holloway JM Broide RS Rosenfeld MG Swanson LW Genes Dev 1990 4 695 711 10.1101/gad.4.5.695 2379827 Nucleotide sequence of the complementary DNA for human Pit-1/GHF-1 Tatsumi K Notomi T Amino N Miyai K Biochim Biophys Acta 1992 129 231 234 Complementary DNA cloning and expression of Pit-1/GHF-1 from the domestic turkey Wong EA Silsby JL el Halawani ME DNA Cell Biol 1992 11 651 660 1418622 Molecular cloning of fish Pit-1 cDNA and its functional binding to promoter of gene expressed in the pituitary Yamada S Hata J Yamashita S J Biol Chem 1993 268 24361 24366 8226986 cDNA cloning and developmental alterations in gene expression of the two Pit-1/GHF-1 transcription factors in the chicken pituitary Tanaka M Yamamoto I Ohkubo T Wakita M Hoshino S Nakashima K Gen Comp Endocrinol 1999 114 441 448 10.1006/gcen.1999.7270 10336832 Complementary DNA cloning and ontogenic expression of pituitary-specific transcription factor of chickens (Gallus domesticus) from the pituitary gland Van As P Buys N Onagbesan OM Decuypere E Gen Comp Endocrinol 2000 120 127 136 10.1006/gcen.2000.7529 11078624 An alternatively spliced Pit-1 isoform altered in its ability to trans-activate Morris AE Kloss B McChesney RE Bancroft C Chasin LA Nucleic Acids Res 1992 20 1355 1361 312183 1561093 10.1093/nar/20.6.1355 Functional isoforms of Pit-1 generated by alternative messenger RNA splicing Konzak KE Moore DD Mol Endocrinol 1992 6 241 247 10.1210/me.6.2.241 1569967 MGC/ORFeome Chicken Genome Browser Gateway http://mgc.ucsc.edu/cgi-bin/hgGateway Association of PIT1 polymorphisms with growth and carcass traits in pigs Yu TP Tuggle CK Schmitz CB Rothschild MF J Anim Sci 1995 73 1282 1288 7665359 Effect of genetic variability of the porcine pituitary-specific transcription factor (PIT-1) on carcas traits in pigs Stancekova K Vasicek D Peskovicova D Bulla J Kubek A Anim Genet 1999 30 313 315 10.1046/j.1365-2052.1999.00484.x 10467708 Analysis of associations of PIT1 genotypes with growth, meat quality and carcass composition traits in pigs Brunsch C Sternstein I Reinecke P Bieniek J J Appl Genet 2002 43 85 91 12084973 MspI polymorphisms in the 3rd intron of the swine POU1F1 gene and their associations with growth performance Song C Gao B Teng Y Wang X Wang Z Li Q Mi H Jing R Mao J J Appl Genet 2005 46 285 289 16110185 Association of PIT1, GH and GHRH polymorphisms with performance and carcass traits in Landrace pigs Franco MM Antunes RC Silva HD Goulart LR J Appl Genet 2005 46 195 200 15876687 Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle Zhao Q Davis ME Hines HC J Anim Sci 2004 82 2229 2233 15318718 Effect of genetic variations of the POU1F1 gene on growth traits of Nanyang cattle Xue K Chen H Wang S Cai X Liu B Zhang CF Lei CZ Wang XZ Wang YM Niu H Yi Chuan Xue Bao 2006 33 901 907 17046590 Identification and characterization of single nucleotide polymorphisms in 12 chicken growth-correlated genes by denaturing high performance liquid chromatography Nie Q Lei M Ouyang J Zeng H Yang G Zhang X Genet Sel Evol 2005 37 339 360 10.1051/gse:2005005 15823239 A new single nucleotide polymorphism in the chicken pituitary-specific transcription factor (POU1F1) gene associated with growth rate Jiang R Li J Qu L Li H Yang N Anim Genet 2004 35 344 346 10.1111/j.1365-2052.2004.01164.x 15265078 Single nucleotide polymorphisms of the chicken insulin-like factor binding protein 2 gene associated with chicken growth and carcass traits Lei M Nie Q Peng X Zhang D Zhang X Poult Sci 2005 84 1191 1198 16156202 Phase software website http://www.stat.washington.edu/stephens/software.html Pituitary dwarfism in the R271W Pit-1 gene mutation Aarskog D Eiken HG Bjerknes R Myking OL Eur J Pediatr 1997 156 829 834 10.1007/s004310050722 9392392 Quantitative trait loci with parent-of-origin effects in chicken Tuiskula-Haavisto M de Koning DJ Honkatukia M Schulman NF Maki-Tanila A Vilkki J Genet Res 2004 84 57 66 10.1017/S0016672304006950 15663259 Review of quantitative trait loci identified in the chicken Abasht B Dekkers JC Lamont SJ Poult Sci 2006 85 2079 2096 17135661 Identification of trait loci affecting white meat percentage and other growth and carcass traits in commercial broiler chickens McElroy JP Kim JJ Harry DE Brown SR Dekkers JC Lamont SJ Poult Sci 2006 85 593 605 16615342 The Chicken Quantitative Trait Loci database (ChickenQTLdb) http://www.animalgenome.org/QTLdb/chicken.html Mapping of quantitative trait loci for body weight at three, six, and nine weeks of age in a broiler layer cross Sewalem A Morrice DM Law A Windsor D Haley CS Ikeobi CO Burt DW Hocking PM Poult Sci 2002 81 1775 1781 12512565