<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-8-91</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Molecular evolution of dimeric &#945;-amylase inhibitor genes in wild emmer wheat and its ecological association</p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>Wang</snm>
               <fnm>Ji-Rui</fnm>
               <insr iid="I1"/>
               <email>wangjirui@gmail.com</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Wei</snm>
               <fnm>Yu-Ming</fnm>
               <insr iid="I1"/>
               <email>ymwei@sicau.edu.cn</email>
            </au>
            <au id="A3">
               <snm>Long</snm>
               <fnm>Xiang-Yu</fnm>
               <insr iid="I1"/>
               <email>yuxianglong006@163.com</email>
            </au>
            <au id="A4">
               <snm>Yan</snm>
               <fnm>Ze-Hong</fnm>
               <insr iid="I1"/>
               <email>grmb@sicau.edu.cn</email>
            </au>
            <au id="A5">
               <snm>Nevo</snm>
               <fnm>Eviatar</fnm>
               <insr iid="I2"/>
               <email>nevo@research.haifa.ac.il</email>
            </au>
            <au id="A6">
               <snm>Baum</snm>
               <mi>R</mi>
               <fnm>Bernard</fnm>
               <insr iid="I3"/>
               <email>baumbr@agr.gc.ca</email>
            </au>
            <au id="A7" ca="yes">
               <snm>Zheng</snm>
               <fnm>You-Liang</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>ylzheng@sicau.edu.cn</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Triticeae Research Institute, Sichuan Agricultural University, Yaan, Sichuan 625014, China</p>
            </ins>
            <ins id="I2">
               <p>Institute of Evolution, University of Haifa, Mt. Carmel, Haifa 31905, Israel</p>
            </ins>
            <ins id="I3">
               <p>Agriculture and Agri-Food Canada, Eastern Cereal and Oilseed Research Centre, Ottawa, Ontario K1A 0C6, Canada</p>
            </ins>
            <ins id="I4">
               <p>Key Laboratory of Crop Genetic Resources and Improvement in Southwest China, Ministry of Education, Sichuan Agricultural University, Yaan, Sichuan 625014, China</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>91</fpage>
         <url>http://www.biomedcentral.com/1471-2148/8/91</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18366725</pubid>
               <pubid idtype="doi">10.1186/1471-2148-8-91</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>03</day>
               <month>9</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>24</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>24</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Wang et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>&#945;-Amylase inhibitors are attractive candidates for the control of seed weevils, as these insects are highly dependent on starch as an energy source. In this study, we aimed to reveal the structure and diversity of dimeric &#945;-amylase inhibitor genes in wild emmer wheat from Israel and to elucidate the relationship between the emmer wheat genes and ecological factors using single nucleotide polymorphism (SNP) markers. Another objective of this study was to find out whether there were any correlations between SNPs in functional protein-coding genes and the environment.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>The influence of ecological factors on the genetic structure of dimeric &#945;-amylase inhibitor genes was evaluated by specific SNP markers. A total of 244 dimeric &#945;-amylase inhibitor genes were obtained from 13 accessions in 10 populations. Seventy-five polymorphic positions and 74 haplotypes were defined by sequence analysis. Sixteen out of the 75 SNP markers were designed to detect SNP variations in wild emmer wheat accessions from different populations in Israel. The proportion of polymorphic loci <it>P </it>(5%), the expected heterozygosity <it>He</it>, and Shannon's information index in the 16 populations were 0.887, 0.404, and 0.589, respectively. The populations of wild emmer wheat showed great diversity in gene loci both between and within populations. Based on the SNP marker data, the genetic distance of pair-wise comparisons of the 16 populations displayed a sharp genetic differentiation over long geographic distances. The values of <it>P</it>, <it>He</it>, and Shannon's information index were negatively correlated with three climatic moisture factors, whereas the same values were positively correlated by Spearman rank correlation coefficients' analysis with some of the other ecological factors.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The populations of wild emmer wheat showed a wide range of diversity in dimeric &#945;-amylase inhibitors, both between and within populations. We suggested that SNP markers are useful for the estimation of genetic diversity of functional genes in wild emmer wheat. These results show significant correlations between SNPs in the &#945;-amylase inhibitor genes and ecological factors affecting diversity. Ecological factors, singly or in combination, explained a significant proportion of the variations in the SNPs, and the SNPs could be classified into several categories as ecogeographical predictors. It was suggested that the SNPs in the &#945;-amylase inhibitor genes have been subjected to natural selection, and ecological factors had an important evolutionary influence on gene differentiation at specific loci.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Wild emmer wheat, <it>Triticum dicoccoides</it>, the progenitor of bread and pasta wheats, presumably originated in and adaptively diversified from, northeastern Israel into the Near East Fertile Crescent <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In this center of diversity, wild emmer wheat harbors rich genetic diversity and resources <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Previous studies in <it>T. dicoccoides </it>and other cereals have shown significant nonrandom adaptive molecular genetic differentiation at single and multilocus structures in either protein-coding regions or randomly amplified polymorphic DNAs among micro-ecological environments <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. It was also determined that wild emmer wheat is genetically variable and that the genetic differentiation of populations included regional and local patterns with sharp genetic differentiation over short distances <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Genetic polymorphisms of &#945;- and &#946;-amylase in wild emmer wheat have been characterized, and it was found that diversity of climatic and edaphic natural selection, rather than stochasticity or migration, was the major evolutionary force driving amylase differentiation <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>The estimates of molecular diversity derived from PCR-based techniques such as amplified restriction fragment length polymorphism (AFLP), microsatellites (short sequence repeats or SSR), single nucleotide polymorphism (SNP), and sequence comparisons are several-fold higher than enzymatic diversity <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. A substantial private and public effort has been undertaken to characterize SNPs tightly associated for genetic diversity. SNPs are identified in ESTs (expressed sequence tags), thus the polymorphisms could be directly used to map functional and expressed genes, rather than DNA sequences derived from conventional RAPD and AFLP techniques, which are typically not functional genes <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. The majority of SNPs in coding regions (cSNPs) are single-base substitutions, which may or may not result in amino acid changes. Some cSNPs may alter a functionally important amino acid residue, and these are of interest for their potential links with phenotypes <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>&#945;-Amylase is a family of enzymes that hydrolyze &#945;-D-(1,4)-glucan linkages and play an important role in the carbohydrate metabolism of many autotrophic and heterotrophic organisms <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Heterotrophic organisms use &#945;-amylase primarily to digest starch in their food sources <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Several kinds of &#945;-amylase and proteinase inhibitors in seeds and vegetative organs act to regulate the numbers of phytophagous insects <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. &#945;-Amylase inhibitors are attractive candidates for the control of seed weevils as these insects are highly dependent on starch as an energy source <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In cereal seeds, &#945;-amylase inhibitor proteins with 120&#8211;130 amino acids, which include trypsin inhibitors, as well as &#945;-amylase inhibitors, can be grouped into one large family on the basis of the homology between their amino acid sequences <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. In this family, the dimeric &#945;-amylase inhibitor has been well characterized. For weevil control, &#945;-amylase inhibitors could be manipulated through plant genetic engineering. However, many insects have several &#945;-amylases that differ in specificity, and successful utilization of a food source is dependent on the expression of a &#945;-amylase for which there is no specific inhibitor <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The dimeric &#945;-amylase inhibitor genes were located on chromosome 3BS and 3DS; there was no known evidence of a homoeologous locus or loci on chromosome 3AS of the polyploid wheats <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Therefore, the tetraploid wheats, which are lacking the D genome, have only the inhibitor genes on chromosome 3BS <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         <p>Evolutionary pressures of various kinds have often been hypothesized to cause active and rapid evolutionary changes. In a co-evolving system of plant-insect interactions, plants synthesize a variety of toxic proteinaceous and nonproteinaceous molecules for their protection against insects <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. Proteinase inhibitors are therefore a potential model system in which to study basic evolutionary processes, such as functional diversification <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>.</p>
         <p>It is well established that multiple forms of proteins are active on exogenous or endogenous &#945;-amylases in the wheat kernel, and proteinaceous dimeric &#945;-amylase inhibitors could function against &#945;-amylase from various origins <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. It is known that the bulk of wheat albumins consist of a few amylase iso-inhibitor families that are very likely phylogenetically related and coded by a small number of parental genes <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. The &#945;-amylase inhibitors have long been proposed as possible important weapons against pests whose diets make them highly dependent on &#945;-amylase activity. <it>In vitro </it>and <it>in vivo </it>trials using &#945;-amylase inhibitors, including those made under field conditions, have now fully confirmed their potential for increasing yields by controlling insect populations <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Two conflicting views confront ecologists and evolutionary biologists on the degree of symmetry in interactions between plants and phytophagous insects <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. The symmetrical view holds that insects and plants have strong effects on one another's evolutionary and ecological dynamics. The asymmetrical view acknowledges that plants have major effects on insects but claims that insects seldom impose significant effects on plants <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Plant defense mechanisms have been the subject of intense investigation <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. The genome shaping events and processes occurring at dimeric &#945;-amylase inhibitor gene loci from the B and S genomes of wheat and <it>Aegilops </it>section sitopsis, respectively, have been characterized. A Phylogenetic Median-Joining network of the haplotypes and a neighbor-joining tree analysis have indicated that the inhibitor gene sequences from common wheat and <it>T. dicoccoides </it>are closely related to those from <it>Ae. speltoides </it><abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. However, little is known about their evolution under the influence of ecology. The molecular diversity of &#945;-amylase inhibitor genes, as well as their divergence among 16 populations of wild emmer wheat from Israel, was investigated to gain insight into the correlation between plant defense proteinaceous inhibitors and ecological factors.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Isolation of the ORF of dimeric &#945;-amylase inhibitors</p>
            </st>
            <p>Using two cloning primers, genomic PCR amplifications were conducted, and one desired DNA band was detected in each accession of wild emmer wheat. Cloning the fragments yielded 244 positive clones from 13 accessions (randomly selected from 10 populations), which were subsequently sequenced (data not shown). Only three out of 244 dimeric &#945;-amylase inhibitor genes had a common three bp deletion, and those three genes were obtained from one accession derived from Mt. Hermon, whereas the other cloned fragments had 426 bp long (data not shown). It was predicted that all of the 426-bp sequences would encode functional dimeric &#945;-amylase inhibitors. Alignment of the gene sequences from emmer wheat with sequences from the species of <it>Aegilops </it>section Sitopsis (including <it>Ae. speltoides</it>, <it>Ae. bicornis</it>, <it>Ae. longissima</it>, <it>Ae. searsii</it>, and <it>Ae. sharonensis</it>), <it>Ae. tauschii</it>, einkorn wheats, and common wheat clearly indicated that the emmer wheat sequences were derived from the B genome <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>SNP and haplotype analyses of dimeric &#945;-amylase inhibitor genes</p>
            </st>
            <p>The frequency of SNPs in the dimeric &#945;-amylase inhibitor genes in emmer wheat was 1 out of 5.7 bases, which was higher than the SNPs observed for kunitz-type &#945;-amylase inhibitor and &#945;-amylase/subtilisin inhibitor genes in barley and dimeric &#945;-amylase inhibitor genes in common wheat <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. Among the 426 nucleotides, there were 351 conserved positions and 75 variable positions among the 244 &#945;-amylase inhibitor genes sequenced from 13 accessions.</p>
            <p>A total of 74 haplotypes were revealed by sequence analysis (Figure <figr fid="F1">1</figr>); 53 of these were each found in only a single sequence. Haplotype 41 was observed at the highest frequency, i.e., in 38 gene sequences, followed by haplotype 27 in 33 sequences (Figure <figr fid="F1">1</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Haplotypes of 244 dimeric &#945;-amylase inhibitors obtained from 13 accessions (10 populations) in Israel</p>
               </caption>
               <text>
                  <p>
                     <b>Haplotypes of 244 dimeric &#945;-amylase inhibitors obtained from 13 accessions (10 populations) in Israel.</b>
                  </p>
               </text>
               <graphic file="1471-2148-8-91-1"/>
            </fig>
            <p>The relationship between SNPs and amino acid changes in the &#945;-amylase inhibitor proteins is summarized in Table <tblr tid="T1">1</tblr>. The 75 SNPs resulted in 38 amino acid substitutions. The position of each SNP in the sequence, whether the predicted change was synonymous (silent) or non-synonymous (replacement), was determined. Forty percent of SNPs were found to occur at the third codon position, and as expected, most of these were synonymous (Table <tblr tid="T1">1</tblr>). A number of changes were also identified in codon positions 1 and 2, and these accounted for more than 95% of the non-synonymous changes (Table <tblr tid="T1">1</tblr>). In total, 60% of the SNPs resulted in non-synonymous changes.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>The variation of amino acids caused by the nucleotide changes in genes. The SNPs were detected by primers at the position with bold numbers in the Site column.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Number</p>
                     </c>
                     <c ca="left">
                        <p>Site</p>
                     </c>
                     <c ca="left">
                        <p>Substitution</p>
                     </c>
                     <c ca="left">
                        <p>Amino acid position</p>
                     </c>
                     <c ca="left">
                        <p>Amino acid variation</p>
                     </c>
                     <c ca="left">
                        <p>Numbers of gene sample</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>T-G-A</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Leu-Arg-His</p>
                     </c>
                     <c ca="left">
                        <p>241-1-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>19</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>G-A</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Val-Asp</p>
                     </c>
                     <c ca="left">
                        <p>59&#8211;185</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>G-T</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Ala-Ser</p>
                     </c>
                     <c ca="left">
                        <p>154-90</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>A-G-C</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Lys-Glu-Gln</p>
                     </c>
                     <c ca="left">
                        <p>59-170-15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>T-C</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Tyr-His</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>34/<b>35</b></p>
                     </c>
                     <c ca="left">
                        <p>G/A-A/A-G/G-A/G</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Asp-Asn-Gly-Ser</p>
                     </c>
                     <c ca="left">
                        <p>139-11-91-3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p><b>46</b>/<b>47</b></p>
                     </c>
                     <c ca="left">
                        <p>G/A-G/T-A/T-T/A-G/G</p>
                     </c>
                     <c ca="left">
                        <p>Signal peptide</p>
                     </c>
                     <c ca="left">
                        <p>Asp-Val-Ile-Tyr-Gly</p>
                     </c>
                     <c ca="left">
                        <p>57-74-7-91-15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>79/81</p>
                     </c>
                     <c ca="left">
                        <p>T/T-C/G</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>Tyr-Gln</p>
                     </c>
                     <c ca="left">
                        <p>129-115</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>88/89</p>
                     </c>
                     <c ca="left">
                        <p>C/A-A/A-C/G</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>Gln-Lys-Arg</p>
                     </c>
                     <c ca="left">
                        <p>174-68-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>107</p>
                     </c>
                     <c ca="left">
                        <p>G-A-C</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>Gly-Asp-Ala</p>
                     </c>
                     <c ca="left">
                        <p>224-2-18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>118</p>
                     </c>
                     <c ca="left">
                        <p>C-G-T</p>
                     </c>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>Leu-Val-Leu</p>
                     </c>
                     <c ca="left">
                        <p>62-66-116</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>125</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>Lys-Arg</p>
                     </c>
                     <c ca="left">
                        <p>219-25</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>127</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>C-G</p>
                     </c>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>Leu-Val</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>163</p>
                     </c>
                     <c ca="left">
                        <p>C-G</p>
                     </c>
                     <c ca="left">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p>Leu-Val</p>
                     </c>
                     <c ca="left">
                        <p>180-64</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>190</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>A-G-C</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c ca="left">
                        <p>Tyr-Asp-His</p>
                     </c>
                     <c ca="left">
                        <p>66-173-5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>196</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>49</p>
                     </c>
                     <c ca="left">
                        <p>Ser-Gly</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>211</p>
                     </c>
                     <c ca="left">
                        <p>T-C</p>
                     </c>
                     <c ca="left">
                        <p>54</p>
                     </c>
                     <c ca="left">
                        <p>Cys-Arg</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>215/216</p>
                     </c>
                     <c ca="left">
                        <p>A/T-G/T-A/G-G/G</p>
                     </c>
                     <c ca="left">
                        <p>55</p>
                     </c>
                     <c ca="left">
                        <p>Asp-Gly-Glu-Gly</p>
                     </c>
                     <c ca="left">
                        <p>66-166-1-11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>217</p>
                     </c>
                     <c ca="left">
                        <p>G-A</p>
                     </c>
                     <c ca="left">
                        <p>56</p>
                     </c>
                     <c ca="left">
                        <p>Ala-Thr</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>227</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>59</p>
                     </c>
                     <c ca="left">
                        <p>Asn-Ser</p>
                     </c>
                     <c ca="left">
                        <p>68&#8211;176</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p>238/239</p>
                     </c>
                     <c ca="left">
                        <p>A/G-A/A-G/A</p>
                     </c>
                     <c ca="left">
                        <p>63</p>
                     </c>
                     <c ca="left">
                        <p>Ser-Asn-Asp</p>
                     </c>
                     <c ca="left">
                        <p>222-16-6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>251</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>67</p>
                     </c>
                     <c ca="left">
                        <p>Glu-Gly</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p><b>259</b>/260</p>
                     </c>
                     <c ca="left">
                        <p>G/C-G/T-A/T</p>
                     </c>
                     <c ca="left">
                        <p>70</p>
                     </c>
                     <c ca="left">
                        <p>Ala-Val-Met</p>
                     </c>
                     <c ca="left">
                        <p>80-151-13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>262/<b>263</b></p>
                     </c>
                     <c ca="left">
                        <p>C/A-T/C-T/A</p>
                     </c>
                     <c ca="left">
                        <p>71</p>
                     </c>
                     <c ca="left">
                        <p>Gln-Ser-*</p>
                     </c>
                     <c ca="left">
                        <p>156-81-7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>287</p>
                     </c>
                     <c ca="left">
                        <p>C-A</p>
                     </c>
                     <c ca="left">
                        <p>79</p>
                     </c>
                     <c ca="left">
                        <p>Ala-Glu</p>
                     </c>
                     <c ca="left">
                        <p>225-19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>295</p>
                     </c>
                     <c ca="left">
                        <p>C-A</p>
                     </c>
                     <c ca="left">
                        <p>82</p>
                     </c>
                     <c ca="left">
                        <p>Thr-Lys</p>
                     </c>
                     <c ca="left">
                        <p>93&#8211;151</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>314</p>
                     </c>
                     <c ca="left">
                        <p>T-C</p>
                     </c>
                     <c ca="left">
                        <p>88</p>
                     </c>
                     <c ca="left">
                        <p>Val-Ala</p>
                     </c>
                     <c ca="left">
                        <p>241-3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>320</p>
                     </c>
                     <c ca="left">
                        <p>T-C</p>
                     </c>
                     <c ca="left">
                        <p>90</p>
                     </c>
                     <c ca="left">
                        <p>Leu-Pro</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>343</p>
                     </c>
                     <c ca="left">
                        <p>G-A</p>
                     </c>
                     <c ca="left">
                        <p>98</p>
                     </c>
                     <c ca="left">
                        <p>Val-Ile</p>
                     </c>
                     <c ca="left">
                        <p>236-8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>350</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>100</p>
                     </c>
                     <c ca="left">
                        <p>Lys-Arg</p>
                     </c>
                     <c ca="left">
                        <p>128-115</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>364</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>105</p>
                     </c>
                     <c ca="left">
                        <p>Ile-Val</p>
                     </c>
                     <c ca="left">
                        <p>129-114</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p>380</p>
                     </c>
                     <c ca="left">
                        <p>G-A</p>
                     </c>
                     <c ca="left">
                        <p>110</p>
                     </c>
                     <c ca="left">
                        <p>Gly-Asp</p>
                     </c>
                     <c ca="left">
                        <p>72&#8211;172</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p>382</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>111</p>
                     </c>
                     <c ca="left">
                        <p>Arg-Gly</p>
                     </c>
                     <c ca="left">
                        <p>70&#8211;174</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p>391</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>114</p>
                     </c>
                     <c ca="left">
                        <p>Ile-Val</p>
                     </c>
                     <c ca="left">
                        <p>70&#8211;174</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p>394</p>
                     </c>
                     <c ca="left">
                        <p>T-C</p>
                     </c>
                     <c ca="left">
                        <p>115</p>
                     </c>
                     <c ca="left">
                        <p>Cys-Arg</p>
                     </c>
                     <c ca="left">
                        <p>242-2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>36</p>
                     </c>
                     <c ca="left">
                        <p>401</p>
                     </c>
                     <c ca="left">
                        <p>A-G-T</p>
                     </c>
                     <c ca="left">
                        <p>117</p>
                     </c>
                     <c ca="left">
                        <p>Asp-Gly-Val</p>
                     </c>
                     <c ca="left">
                        <p>183-60-1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>37</p>
                     </c>
                     <c ca="left">
                        <p>409</p>
                     </c>
                     <c ca="left">
                        <p>A-G</p>
                     </c>
                     <c ca="left">
                        <p>120</p>
                     </c>
                     <c ca="left">
                        <p>Thr-Ala</p>
                     </c>
                     <c ca="left">
                        <p>68&#8211;176</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p>416</p>
                     </c>
                     <c ca="left">
                        <p>G-A-C</p>
                     </c>
                     <c ca="left">
                        <p>122</p>
                     </c>
                     <c ca="left">
                        <p>Arg-Gln-Pro</p>
                     </c>
                     <c ca="left">
                        <p>68-15-161</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Primer design and SNP mining of wild emmer wheat</p>
            </st>
            <p>Using the information from the 75 SNPs identified in the &#945;-amylase inhibitor genes, 16 primers (combined with the reverse cloning primer, R, as SNP markers) were successfully designed to detect the SNPs in 205 accessions from 18 populations. The primers, with the SNP (bold letters) at the 3' end and an extra mismatched nucleotide (underline) on the third nucleotide from the end are listed in Table <tblr tid="T2">2</tblr>. A total of 14 SNPs were detected with the 16 SNP markers from position 19 to 288 of the &#945;-amylase inhibitor gene, and the size of the amplified fragments ranged from 158 to 426 bp. The data was then organized in terms of genotypic frequencies ("0" or "1") to assess the population structure.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Specific primers designed from SNPs in the dimeric &#945;-amylase inhibitor genes</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>Primer</p>
                     </c>
                     <c ca="left">
                        <p>Sequences*</p>
                     </c>
                     <c ca="left">
                        <p>Fragment size</p>
                     </c>
                     <c ca="left">
                        <p>Temperature</p>
                     </c>
                     <c ca="left">
                        <p>Cycle</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W19G</p>
                     </c>
                     <c ca="left">
                        <p>ATGCTCGTGGCGACAC<ul>T</ul>C<b>G</b></p>
                     </c>
                     <c ca="left">
                        <p>426</p>
                     </c>
                     <c ca="left">
                        <p>64</p>
                     </c>
                     <c ca="left">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W24A</p>
                     </c>
                     <c ca="left">
                        <p>TCGTGGCGACACCCRTA<ul>C</ul>C<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>422</p>
                     </c>
                     <c ca="left">
                        <p>63</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W35A</p>
                     </c>
                     <c ca="left">
                        <p>ACCCATAGCAGCCCAGTAC<b>AA</b></p>
                     </c>
                     <c ca="left">
                        <p>412</p>
                     </c>
                     <c ca="left">
                        <p>62</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W46A</p>
                     </c>
                     <c ca="left">
                        <p>CGAGTACGACGCATGGA<ul>T</ul>C<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>400</p>
                     </c>
                     <c ca="left">
                        <p>65</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W47AT</p>
                     </c>
                     <c ca="left">
                        <p>AGTACGACGCATGGAG<ul>T</ul><b>AT</b></p>
                     </c>
                     <c ca="left">
                        <p>398</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W125G</p>
                     </c>
                     <c ca="left">
                        <p>CTGTCGTCCATTGCT<ul>T</ul>A<b>G</b></p>
                     </c>
                     <c ca="left">
                        <p>319</p>
                     </c>
                     <c ca="left">
                        <p>62.5</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W127G</p>
                     </c>
                     <c ca="left">
                        <p>CTGTCGTCCATTGCTGAGG<b>G</b></p>
                     </c>
                     <c ca="left">
                        <p>319</p>
                     </c>
                     <c ca="left">
                        <p>62.5</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W190C</p>
                     </c>
                     <c ca="left">
                        <p>CTGCTGCCAGCAGCTCG<ul>G</ul>C<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>256</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W195T</p>
                     </c>
                     <c ca="left">
                        <p>TGCCAGCAGCTCGCCGACAT<b>T</b></p>
                     </c>
                     <c ca="left">
                        <p>252</p>
                     </c>
                     <c ca="left">
                        <p>51</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W207T</p>
                     </c>
                     <c ca="left">
                        <p>ACATCAGCGAGTGG<ul>A</ul>G<b>T</b></p>
                     </c>
                     <c ca="left">
                        <p>236</p>
                     </c>
                     <c ca="left">
                        <p>60.5</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W259A</p>
                     </c>
                     <c ca="left">
                        <p>CATGTATAAGGAGCATG<ul>T</ul>C<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>187</p>
                     </c>
                     <c ca="left">
                        <p>61</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W263C</p>
                     </c>
                     <c ca="left">
                        <p>TATAAGGAGCATGGCGT<ul>C</ul><b>TC</b></p>
                     </c>
                     <c ca="left">
                        <p>183</p>
                     </c>
                     <c ca="left">
                        <p>62</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W263A</p>
                     </c>
                     <c ca="left">
                        <p>TATAAGGAGCATGGCGT<ul>C</ul><b>TA</b></p>
                     </c>
                     <c ca="left">
                        <p>183</p>
                     </c>
                     <c ca="left">
                        <p>65</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W276A</p>
                     </c>
                     <c ca="left">
                        <p>GCGTGTCGGAGGGACAG<ul>T</ul>C<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>170</p>
                     </c>
                     <c ca="left">
                        <p>60</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W288CG</p>
                     </c>
                     <c ca="left">
                        <p>GACAGGCRGGGACAGG<b>A</b><ul>A</ul><b>CG</b></p>
                     </c>
                     <c ca="left">
                        <p>158</p>
                     </c>
                     <c ca="left">
                        <p>66</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>W288AG</p>
                     </c>
                     <c ca="left">
                        <p>GACAGGCGGGGACAGG<b>A</b><ul>A</ul><b>AG</b></p>
                     </c>
                     <c ca="left">
                        <p>158</p>
                     </c>
                     <c ca="left">
                        <p>63.5</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*SNP positions were on the 3' end of the primers and are identified in bold letters. Extra mismatched nucleotides were also incorporated in the primers (underlined).</p>
               </tblfn>
            </tbl>
            <p>There were only 5 and 2 accessions from Yehudiyya and Achihood, respectively. Thus, the data for Yehudiyya and Achihood were not used in further analyses. Positive fragment frequency for each primer in the 16 populations is listed Additional file <supplr sid="S1">1</supplr>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>Positive fragment and the frequency of each primer in 16 Population of wild emmer wheat. This data showed the frequency of each specific primer in the 16 populations calculated by POPGENE 1.32.</p>
               </text>
               <file name="1471-2148-8-91-S1.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Genetic diversity and distance of &#945;-amylase inhibitor genes</p>
            </st>
            <p>Some genetic parameters of the 16 populations of wild emmer wheat are summarized in Table <tblr tid="T3">3</tblr>. The proportion of polymorphic loci <it>P </it>(5%), the expected heterozygosity <it>He</it>, and Shannon's information index of the 16 populations of wild emmer wheat were 0.887, 0.404, and 0.589, respectively. The values of <it>He </it>ranged from 0.182 to 0.437, and the population of Kokhav Hashahar had the highest value of <it>He </it>(0.437), followed by the population of Rosh-Pinna, whereas the population from Daliyya was characterized by the lowest <it>He </it>value of 0.182.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genetic diversity of wheat dimeric &#945;-amylase inhibitor genes, based on SNPs in 16 populations of wide emmer wheat.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Population</p>
                     </c>
                     <c ca="left">
                        <p>No.</p>
                     </c>
                     <c ca="left">
                        <p>Sample Size</p>
                     </c>
                     <c ca="left">
                        <p>Polymorphic per population <it>P </it><sup>c</sup></p>
                     </c>
                     <c ca="left">
                        <p>Genetic diversity <it>He </it><sup>d </sup>(SE)</p>
                     </c>
                     <c ca="left">
                        <p>Shannon's information index<sup>e </sup>(SE)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mt. Hermon</p>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>1.000</p>
                     </c>
                     <c ca="left">
                        <p>0.374 (0.137)</p>
                     </c>
                     <c ca="left">
                        <p>0.550 (0.164)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Qazerin</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>1.000</p>
                     </c>
                     <c ca="left">
                        <p>0.414 (0.107)</p>
                     </c>
                     <c ca="left">
                        <p>0.600 (0.122)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gamla</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>0.938</p>
                     </c>
                     <c ca="left">
                        <p>0.315 (0.169)</p>
                     </c>
                     <c ca="left">
                        <p>0.474 (0.219)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Rosh-Pinna</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>1.000</p>
                     </c>
                     <c ca="left">
                        <p>0.430 (0.097)</p>
                     </c>
                     <c ca="left">
                        <p>0.618 (0.110)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Tabiha</p>
                     </c>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>1.000</p>
                     </c>
                     <c ca="left">
                        <p>0.407 (0.083)</p>
                     </c>
                     <c ca="left">
                        <p>0.594 (0.091)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mt. Gilboa</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>0.938</p>
                     </c>
                     <c ca="left">
                        <p>0.334 (0.155)</p>
                     </c>
                     <c ca="left">
                        <p>0.499 (0.201)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mt. Gerizim</p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.334 (0.197)</p>
                     </c>
                     <c ca="left">
                        <p>0.487 (0.259)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gitit</p>
                     </c>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.338 (0.184)</p>
                     </c>
                     <c ca="left">
                        <p>0.493 (0.248)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Kokhav Hashahar</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>1.000</p>
                     </c>
                     <c ca="left">
                        <p>0.437 (0.088)</p>
                     </c>
                     <c ca="left">
                        <p>0.625 (0.098)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>J'aba</p>
                     </c>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>0.938</p>
                     </c>
                     <c ca="left">
                        <p>0.385 (0.133)</p>
                     </c>
                     <c ca="left">
                        <p>0.561 (0.176)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Amirim</p>
                     </c>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.337 (0.181)</p>
                     </c>
                     <c ca="left">
                        <p>0.493 (0.248)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Nahef</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>0.625</p>
                     </c>
                     <c ca="left">
                        <p>0.217 (0.217)</p>
                     </c>
                     <c ca="left">
                        <p>0.322 (0.303)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Beit-Oren</p>
                     </c>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.308 (0.173)</p>
                     </c>
                     <c ca="left">
                        <p>0.460 (0.235)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Daliyya</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>0.500</p>
                     </c>
                     <c ca="left">
                        <p>0.182 (0.200)</p>
                     </c>
                     <c ca="left">
                        <p>0.273 (0.292)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Bat-Shelomo</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.291 (0.180)</p>
                     </c>
                     <c ca="left">
                        <p>0.438 (0.241)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Givat-Koach</p>
                     </c>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>0.875</p>
                     </c>
                     <c ca="left">
                        <p>0.295 (0.182)</p>
                     </c>
                     <c ca="left">
                        <p>0.442 (0.245)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mean</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>198</p>
                     </c>
                     <c ca="left">
                        <p>0.887</p>
                     </c>
                     <c ca="left">
                        <p>0.404 (0.102)</p>
                     </c>
                     <c ca="left">
                        <p>0.589 (0.118)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>The genetic distances (<it>D</it>) were calculated for comparisons of all 16 populations based on the positive fragment of SNP markers among all population pairs (see Additional file <supplr sid="S2">2</supplr>). The highest genetic distance (0.263) was obtained between populations of Kokhav Hashahar and Daliyya, whereas the most related populations were Qazzrin and Gamla with a genetic distance of 0.017. However, lower <it>D </it>values (&lt; 0.050) were observed between some populations from different areas, and, for the most part, the estimates of <it>D </it>value were geographically independent. Large genetic distances and sharp genetic differentiation over long geographic distances could be found. For example, Kokhav Hashahar in southern Israel had higher <it>D </it>values with the populations from Gamla (0.221), Nahef (0.247), Beit-Oren (0.215), Daliyya (0.263), and Bat-Shelomo (0.224) in northeast Israel.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>Nei's genetic distance of the inhibitor genes in the 16 populations. This data showed the genetic distances (<it>D</it>) based on the positive fragment of SNP markers among all population pairs.</p>
               </text>
               <file name="1471-2148-8-91-S2.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Principle components &amp; multiple regression analysis of environmental variables and SNPs</p>
            </st>
            <p>To assess if some of the ecological factors are correlated to each other, principle components analysis (PCA) was carried out using 23 ecological factors as variables. A combination of the first four components could give us a high cumulative percent (88.81%) according to the eigenvalues of the correlation matrix (see Additional file <supplr sid="S3">3A</supplr>; <supplr sid="S4">4</supplr>), which could be used to explain the ecological associations. The main ecological factors of the first component were Rd and Ev (two water availability factors) that could give 40.60% eigenvalues, and the second component could give 28.66% eigenvalues (see Additional file <supplr sid="S3">3</supplr>). And from PCA analysis, it was known that the accessions from Mt. Hermon were affected the most by ecological factors (see Additional file <supplr sid="S3">3C</supplr>).</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p>Principal components analysis. This data showed the eigenvalues of correlation matrix, eigenvectors and factor coodinates of 16 populations.</p>
               </text>
               <file name="1471-2148-8-91-S3.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p>Principal components analysis of the ecological factors. This data showed the projection of the variables on the ecological factor-plane and eigenvalues of correlation matrix.</p>
               </text>
               <file name="1471-2148-8-91-S4.bmp">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>After analyzed of the factors by projection of the variables on the factor-plane (see Additional file <supplr sid="S4">4</supplr>) and consulted the correlations of these factors (see Additional file <supplr sid="S5">5</supplr>), 11 independent ecological factors were chosen. And then, multiple regression analysis was done using these 11 factors to investigate the relationship between environmental variables and SNPs.</p>
            <suppl id="S5">
               <title>
                  <p>Additional file 5</p>
               </title>
               <text>
                  <p>Correlations of the Factors. This data showed the correlation of the 20 ecological factors that separated into four groups.</p>
               </text>
               <file name="1471-2148-8-91-S5.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>The geographical, temperature, water, and solar radiation factors in Table <tblr tid="T4">4</tblr>, singly or in combination, explained a significant proportion of the diversity in the SNPs (Table <tblr tid="T5">5</tblr>). The best variable predictors of <it>P</it>, <it>He</it>, and Shannon's information index, significantly explaining 0.264 &#8211; 0.355 of the variance, was the water availability factor Hu-an. The combination of three variable predictors accounting for geographic and water availability factors Hu-an, Ev, and Lt (mean annual humidity, mean annual evaporation and latitude) accounted significantly (p &lt; 0.05) for about 0.55 of the genetic diversity. The addition of a fourth variable predictor, Rad (total solar radiation per year), or Sh (mean number of Sharav days) to the first three factors accounted for approximately 0.65 of the diversity (significant at p &lt; 0.05) (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>The eco-geographical background of populations in this study</p>
               </caption>
               <tblbdy cols="26">
                  <r>
                     <c ca="left">
                        <p>No.</p>
                     </c>
                     <c ca="left">
                        <p>Population*</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>Ln</p>
                     </c>
                     <c ca="center">
                        <p>Lt</p>
                     </c>
                     <c ca="center">
                        <p>Al</p>
                     </c>
                     <c ca="center">
                        <p>Tm</p>
                     </c>
                     <c ca="center">
                        <p>Ta</p>
                     </c>
                     <c ca="center">
                        <p>Tj</p>
                     </c>
                     <c ca="center">
                        <p>Td</p>
                     </c>
                     <c ca="center">
                        <p>Tdd</p>
                     </c>
                     <c ca="center">
                        <p>Rn</p>
                     </c>
                     <c ca="center">
                        <p>Rd</p>
                     </c>
                     <c ca="center">
                        <p>Hu 14</p>
                     </c>
                     <c ca="center">
                        <p>Hu an</p>
                     </c>
                     <c ca="center">
                        <p>Dw</p>
                     </c>
                     <c ca="center">
                        <p>Sh</p>
                     </c>
                     <c ca="center">
                        <p>Th</p>
                     </c>
                     <c ca="center">
                        <p>Trd</p>
                     </c>
                     <c ca="center">
                        <p>Ev</p>
                     </c>
                     <c ca="center">
                        <p>Sz</p>
                     </c>
                     <c ca="center">
                        <p>Ma</p>
                     </c>
                     <c ca="center">
                        <p>So</p>
                     </c>
                     <c ca="center">
                        <p>Rv</p>
                     </c>
                     <c ca="center">
                        <p>Rr</p>
                     </c>
                     <c ca="center">
                        <p>Rad</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="26">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>Mt. Hermon</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>35.73</p>
                     </c>
                     <c ca="center">
                        <p>33.30</p>
                     </c>
                     <c ca="center">
                        <p>1300</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>1400</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>80</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>150</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>185</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>Qzzrin</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>35.67</p>
                     </c>
                     <c ca="center">
                        <p>32.99</p>
                     </c>
                     <c ca="center">
                        <p>350</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>530</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>189</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>Yehudiyya</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>35.70</p>
                     </c>
                     <c ca="center">
                        <p>32.93</p>
                     </c>
                     <c ca="center">
                        <p>200</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>27</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>550</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                     <c ca="center">
                        <p>42</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>160</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>189</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>Gamla</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>35.74</p>
                     </c>
                     <c ca="center">
                        <p>32.88</p>
                     </c>
                     <c ca="center">
                        <p>200</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>470</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>Rosh-Pinna</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>35.52</p>
                     </c>
                     <c ca="center">
                        <p>32.95</p>
                     </c>
                     <c ca="center">
                        <p>700</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>697</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>75</p>
                     </c>
                     <c ca="center">
                        <p>-10</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>150</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>184</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>Tabiha</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>35.53</p>
                     </c>
                     <c ca="center">
                        <p>32.90</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>436</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>-30</p>
                     </c>
                     <c ca="center">
                        <p>120</p>
                     </c>
                     <c ca="center">
                        <p>160</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>188</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>Mt. Gilboa</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>35.42</p>
                     </c>
                     <c ca="center">
                        <p>32.50</p>
                     </c>
                     <c ca="center">
                        <p>150</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>400</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>40</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>-30</p>
                     </c>
                     <c ca="center">
                        <p>160</p>
                     </c>
                     <c ca="center">
                        <p>165</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>189</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>Mt. Gerizim</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>35.28</p>
                     </c>
                     <c ca="center">
                        <p>32.20</p>
                     </c>
                     <c ca="center">
                        <p>800</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>700</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>42</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>186</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>Gitit</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>35.40</p>
                     </c>
                     <c ca="center">
                        <p>32.10</p>
                     </c>
                     <c ca="center">
                        <p>300</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>360</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-25</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>170</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>195</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>Kokhav Hashahar</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>35.34</p>
                     </c>
                     <c ca="center">
                        <p>31.95</p>
                     </c>
                     <c ca="center">
                        <p>600</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>400</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>80</p>
                     </c>
                     <c ca="center">
                        <p>-20</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>165</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>195</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>Jaba</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>35.08</p>
                     </c>
                     <c ca="center">
                        <p>31.67</p>
                     </c>
                     <c ca="center">
                        <p>660</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>500</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>90</p>
                     </c>
                     <c ca="center">
                        <p>-20</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>186</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>Amirim</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>35.45</p>
                     </c>
                     <c ca="center">
                        <p>32.93</p>
                     </c>
                     <c ca="center">
                        <p>600</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>850</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>85</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>153</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>182</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>Nahef</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>35.32</p>
                     </c>
                     <c ca="center">
                        <p>32.93</p>
                     </c>
                     <c ca="center">
                        <p>275</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>670</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>181</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>Achihood</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>35.17</p>
                     </c>
                     <c ca="center">
                        <p>32.91</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>590</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>40</p>
                     </c>
                     <c ca="center">
                        <p>-5</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>148</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>180</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>Beit-Oren</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>35.03</p>
                     </c>
                     <c ca="center">
                        <p>32.73</p>
                     </c>
                     <c ca="center">
                        <p>400</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>700</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                     <c ca="center">
                        <p>69</p>
                     </c>
                     <c ca="center">
                        <p>80</p>
                     </c>
                     <c ca="center">
                        <p>41</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>142</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>183</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>Daliyya</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>35.06</p>
                     </c>
                     <c ca="center">
                        <p>32.59</p>
                     </c>
                     <c ca="center">
                        <p>200</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>670</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>67</p>
                     </c>
                     <c ca="center">
                        <p>78</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>-10</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>160</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>181</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>Bat-Shelomo</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>35.02</p>
                     </c>
                     <c ca="center">
                        <p>32.60</p>
                     </c>
                     <c ca="center">
                        <p>75</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>650</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>68</p>
                     </c>
                     <c ca="center">
                        <p>77</p>
                     </c>
                     <c ca="center">
                        <p>40</p>
                     </c>
                     <c ca="center">
                        <p>-10</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>150</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>182</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p>Givat-Koach</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>34.92</p>
                     </c>
                     <c ca="center">
                        <p>32.03</p>
                     </c>
                     <c ca="center">
                        <p>75</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>540</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                     <c ca="center">
                        <p>42</p>
                     </c>
                     <c ca="center">
                        <p>-20</p>
                     </c>
                     <c ca="center">
                        <p>105</p>
                     </c>
                     <c ca="center">
                        <p>160</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>180</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Population numbers and ecological factors definitions was according to Nevo and Beiles 1989.</p>
                  <p>* Populations Yehudiyya (7) and Achihood (26) do not have enough accessions to do further statistical analysis.</p>
                  <p>
                     <it>Symbols of Variables</it>
                  </p>
                  <p>i. <b>Geographical</b>: Ln = Longitude; Lt = latitude; Al = altitude</p>
                  <p>ii. <b>Temperature</b>: Tm = mean annual temperature; Ta = mean August temperature; Tj = mean January temperature; Td = seasonal temperature difference; Tdd = day-night temperature difference; Trd = mean number of tropical days (tropical days is defined by meteorologists check internet or atlases); Sh = mean number of Sharav days, i.e., hot and dry days</p>
                  <p>iii. <b>Water availability</b>: Rn = mean annual rainfall; Rd = mean number of rainy days; Hu-an: = mean annual humidity; Hu-14 = mean humidity at 14:00 h; Dw = mean number of dewy nights in summer; Th = Thornthwaite's moisture index (indicator of the supply of water in an area relative to the demand under prevailing climatic conditions); Ev = mean annual evaporation; Rv = mean inter-annual variability of rainfall; Rr = mean relative variability of rainfall</p>
                  <p>iv. <b>Edaphic</b>: So = soil type: 1 = terra-rossa (t.r.); 2 = rendzina; 5 = basalt</p>
                  <p>v. <b>Biotic</b>: Ma = marginality (A measure of the ecological distance and direction by which the mean of the species distribution differs from the mean of the global distribution): 1 = North margin, 2 = West margin, 3 = Southeast margin, 5 = central population; Sz = estimate of population size: 1 = small (from a dozen to few hundred plants), 2 = intermediate, 3 = large</p>
                  <p>vi. <b>Solar radiation</b>: Rad = total solar radiation per year</p>
               </tblfn>
            </tbl>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Coefficient of multiple regressions of genetic indices and allele frequencies and environmental variables in 16 populations of wild emmer wheat as independent variables. *** = p &lt; 0.001; ** = p &lt; 0.01; * = p &lt; 0.05; @ = p &lt; 0.10; ns = p > 0.10. The definitions of factors were in Table 4.</p>
               </caption>
               <tblbdy cols="10">
                  <r>
                     <c ca="left">
                        <p>Genetic indices</p>
                     </c>
                     <c cspan="9" ca="left">
                        <p>Stepwise model by ecogeographical variables</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>STEP1</p>
                     </c>
                     <c ca="left">
                        <p>STEP2</p>
                     </c>
                     <c ca="left">
                        <p>STEP3</p>
                     </c>
                     <c ca="left">
                        <p>STEP4</p>
                     </c>
                     <c ca="left">
                        <p>STEP5</p>
                     </c>
                     <c ca="left">
                        <p>STEP6</p>
                     </c>
                     <c ca="left">
                       