<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-7-51</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Evolutionary hierarchies of conserved blocks in 5'-noncoding sequences of dicot <it>rbcS </it>genes</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Weeks</snm>
               <mi>E</mi>
               <fnm>Katie</fnm>
               <insr iid="I1"/>
               <email>k.e.weeks@cs.cardiff.ac.uk</email>
            </au>
            <au id="A2">
               <snm>Chuzhanova</snm>
               <mi>A</mi>
               <fnm>Nadia</fnm>
               <insr iid="I2"/>
               <email>nchuzhanova@uclan.ac.uk</email>
            </au>
            <au id="A3">
               <snm>Donnison</snm>
               <mi>S</mi>
               <fnm>Iain</fnm>
               <insr iid="I3"/>
               <email>iain.donnison@bbsrc.ac.uk</email>
            </au>
            <au id="A4" ca="yes">
               <snm>Scott</snm>
               <mi>M</mi>
               <fnm>Ian</fnm>
               <insr iid="I4"/>
               <email>ias@aber.ac.uk</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Cardiff School of Computer Science, Cardiff University, Queen's Buildings, 5 The Parade, Roath, Cardiff, CF24 3AA, UK</p>
            </ins>
            <ins id="I2">
               <p>Department of Biological Sciences, University of Central Lancashire, Preston, PR1 2HE, UK</p>
            </ins>
            <ins id="I3">
               <p>Institute of Grassland and Environmental Research, Aberystwyth, Ceredigion, SY23 3EB, UK</p>
            </ins>
            <ins id="I4">
               <p>Institute of Biological Sciences, University of Wales, Aberystwyth, Ceredigion, SY23 3DA, UK</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2007</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>51</fpage>
         <url>http://www.biomedcentral.com/1471-2148/7/51</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17407546</pubid>
               <pubid idtype="doi">10.1186/1471-2148-7-51</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>02</day>
               <month>10</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>02</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>02</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Weeks et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Evolutionary processes in gene regulatory regions are major determinants of organismal evolution, but exceptionally challenging to study. We explored the possibilities of evolutionary analysis of phylogenetic footprints in 5'-noncoding sequences (NCS) from 27 ribulose-1,5-bisphosphate carboxylase small subunit (<it>rbcS</it>) genes, from three dicot families (Brassicaceae, Fabaceae and Solanaceae).</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Sequences of up to 400 bp encompassing proximal promoter and 5'-untranslated regions were analyzed. We conducted phylogenetic footprinting by several alternative methods: generalized Lempel-Ziv complexity (<it>C</it><sub><it>LZ</it></sub>), multiple alignments with DIALIGN and ALIGN-M, and the MOTIF SAMPLER Gibbs sampling algorithm. These tools collectively defined 36 conserved blocks of mean length 12.8 bp. On average, 12.5 blocks were found in each 5'-NCS. The blocks occurred in arrays whose relative order was absolutely conserved, confirming the existence of 'conserved modular arrays' in promoters. Identities of half of the blocks confirmed past <it>rbcS </it>research, including versions of the I-box, G-box, and GT-1 sites such as Box II. Over 90% of blocks overlapped DNase-protected regions in tomato 5'-NCS. Regions characterized by low <it>C</it><sub><it>LZ </it></sub>in sliding-window analyses were also frequently associated with DNase-protection. Blocks could be assigned to evolutionary hierarchies based on taxonomic distribution and estimated age. Lineage divergence dates implied that 13 blocks found in all three plant families were of Cretaceous antiquity, while other family-specific blocks were much younger. Blocks were also dated by formation of multigene families, using genome and coding sequence information. Dendrograms of evolutionary relations of the 5'-NCS were produced by several methods, including: cluster analysis using pairwise <it>C</it><sub><it>LZ </it></sub>values; evolutionary trees of DIALIGN sequence alignments; and cladistic analysis of conserved blocks.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Dicot 5'-NCS contain conserved modular arrays of recurrent sequence blocks, which are coincident with functional elements. These blocks are amenable to evolutionary interpretation as hierarchies in which ancient, taxonomically widespread blocks can be distinguished from more recent, taxon-specific ones.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Promoter sequences have been described as a vast and largely uncharted territory for evolutionary biologists <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. One impediment to exploration is the difficulty of motif prediction in noncoding sequences (NCS): motif-discovery tools achieved detection rates of only 22&#8211;35% for transcription factor (TF) binding sites in recent benchmark studies <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Although it has long been recognized in principle <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> that evidence for motifs can be enhanced by comparing sequences of common ancestry, 'phylogenetic footprinting' of higher eukaryotes is still in a development and evaluation phase <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. There are also perceived challenges in the use of sequence alignment for phylogenetic analysis of NCS <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, as complex mutational processes (slipped-strand mispairing, stem-loop secondary structure excision/repair, minute inversions, intramolecular recombination) are prevalent. In practice, however, Bremer et al. <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> found chloroplast NCS to be of similar utility to coding sequences in phylogenetic tree construction for asterids. This result confirmed that plant NCS contain evolutionary signal, which might be hypothesized to reside in the conserved motifs sought in phylogenetic footprinting. The present study sought to explore the extent to which phylogenetic footprints in plant 5'-NCS could be subjected to evolutionary analysis and interpretation. For this objective, we needed to conduct sufficiently comprehensive phylogenetic footprinting for meaningful evolutionary analysis of conserved sequence blocks.</p>
         <p>We employed a greater taxonomic range than other phylogenetic footprinting studies of plant NCS, which have been confined to single families <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B8">8</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp> or to a couple of species <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Much of the interest in promoter evolution lies in comparisons of paralogous genes (i.e. genes that diverged after a duplication event). In consequence, it must be noted, our dataset included several multigene families, and therefore was not optimized to investigate taxonomic phylogenies in the manner of Bremer et al. <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>Recognizing limitations in individual motif discovery tools <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B7">7</abbr></abbrgrp>, we sought to maximize detection of conservation by combining distinct methodologies. Analysis of generalized Lempel-Ziv complexity (<it>C</it><sub><it>LZ</it></sub>), played several roles in our study. <it>C</it><sub><it>LZ </it></sub>measures the complexity of a text as the minimal number of steps in a defined procedure of its synthesis with the parsing rule: the next phrase is the longest seen previously. Many text compression algorithms are based on Lempel-Ziv parsing <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Computation of <it>C</it><sub><it>LZ </it></sub>thus involves a decomposition of the text into repeated blocks, and an application to the discovery of structural regularities in genetic 'texts' was realized by Gusev et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. This method has identified arrays of conserved sequence blocks in NCS of vertebrates from fish to humans <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. <it>C</it><sub><it>LZ </it></sub>analysis has also been used to study human mutagenic mechanisms <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp> and genomic architecture <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>Our second tool was MOTIF SAMPLER, in which the probability of finding a particular motif is estimated using Gibbs sampling and modelling of the background sequence with a Markov model <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>We complemented these tools with sequence alignment, including the DIALIGN and ALIGN-M algorithms designed for highly divergent sequences with only localized similarities, as seen in 5'-NCS. DIALIGN is based on a segment-to-segment comparison <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>, while ALIGN-M uses a non-progressive local approach to guide alignments <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
         <p>We focused on 5'-NCS of ribulose-1,5-bisphosphate carboxylase small subunit (<it>rbcS</it>) genes because of the exceptional corpus of knowledge against which analytical outcomes could be benchmarked. As the earliest nuclear protein-coding sequences in plants to be cloned, <it>rbcS </it>genes became paradigms for functional studies of plant promoters <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>, and several classes of <it>cis</it>-elements were originally defined in <it>rbcS </it>promoters. Thus, the prototype of trihelix TFs was the nuclear protein GT-1, which binds to the 14-bp Box II and related motifs in light-responsive regions of the pea <it>rbcS-3A </it>promoter <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Box II versions featured in the earliest <it>rbcS </it>promoter alignments <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr></abbrgrp>, and occur in other light-responsive genes <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, where they may be targets of calcium/calmodulin phototransduction <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>.</p>
         <p>Two further <it>cis</it>-elements discovered in <it>rbcS </it>promoters, the G-box and I-box, are common features in light-responsive promoters <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B30">30</abbr></abbrgrp>, and have been functionally characterized as dual components of a minimal light-responsive unit <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. G-box binding factors (GBFs), identified using tomato <it>rbcS-3A </it>upstream sequences <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>, are basic leucine zipper TFs interacting with the G-box core, CACGTG <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Dicot <it>rbcS </it>G-boxes interact with the HY5 GBF, which mediates phytochrome and cryptochrome signals in concert with COP and DET regulators <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B35">35</abbr></abbrgrp>.</p>
         <p>The I-box, core motif GATAAGR, was also defined in <it>rbcS </it>promoters <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B33">33</abbr><abbr bid="B36">36</abbr></abbrgrp>. Its reverse, YCTTATC, was highlighted in <it>rbcS </it>and other light-regulated promoters by early motif searches <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr></abbrgrp>. Binding factors for the I-box are still being clarified. Functional interactions occurred in yeast between I-box sequences and recombinant zinc-finger GATA TFs from <it>Arabidopsis </it><abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. I-box binding nuclear proteins reported in several species <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp> may therefore include GATA TFs, though the first cloned I-box binding protein was a tomato Myb-like TF <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. While the above <it>rbcS cis-</it>elements are the most studied, there is evidence for numerous further elements and DNA-protein interactions in <it>rbcS </it>promoters <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B32">32</abbr><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>.</p>
         <p>There is a particularly extensive history of characterization of <it>rbcS </it>promoters from pea, <it>Petunia </it>and tomato <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B49">49</abbr></abbrgrp>. We analyzed these along with other studied <it>rbcS </it>5'-NCS such as those of <it>Arabidopsis </it><abbrgrp><abbr bid="B50">50</abbr></abbrgrp> to provide a gradation of taxonomic relations and evolutionary distances. Conserved features shared by the plant families analyzed would have persisted since the Cretaceous, to which can be dated the divergence of eurosids I (represented by the Fabaceae) from eurosids II (Brassicaeae), and both from asterids (Solanaceae) <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Phylogenetic footprinting</p>
            </st>
            <p>5'-NCS of up to 400 bp including proximal promoter and 5'-untranslated regions (5'-UTRs) were analyzed for 27 dicot <it>rbcS </it>genes. The rosid complement comprised all four <it>Arabidopsis </it>genes (three from a tandem locus), plus genes from <it>Brassica </it>and the legumes <it>Phaseolus</it>, <it>Medicago </it>and <it>Pisum </it>(pea). The <it>Lycopersicon </it>(tomato), <it>Solanum </it>(potato), <it>Petunia </it>and <it>Nicotiana </it>genes included representatives of all three solanaceous <it>rbcS </it>loci, which are distinguished by features including an extra (third) intron in 'locus 2' genes, and tandem duplicates at 'locus 3' <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Phylogenetic footprinting analyses were performed on the entire dataset, and separately on various subgroups, e.g. rosid, brassica, legume, or solanaceous genes, or genes of each solanaceous locus. Three methodologies were employed:</p>
            <p>(1) <it>C</it><sub><it>LZ </it></sub>analysis was used as proposed by Gusev et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> to search for recurrent sequence blocks in the <it>rbcS </it>5'-NCS. The <it>C</it><sub><it>LZ </it></sub>measure is based on representation of a sequence by fragments that have been encountered before (in the same or other sequences). Let <it>S </it>= <it>s</it><sub>1 </sub>... <it>s</it><sub><it>L </it></sub>be a nucleotide sequence of length <it>L</it>. Denote by <it>S </it>[<it>i</it>:<it>j</it>] the substring of <it>S </it>that starts at position <it>i </it>and ends at position <it>j</it>. A Lempel-Ziv decomposition of <it>S </it>is a partition of <it>S </it>into <it>m </it>consecutive fragments, <it>S </it>= <it>S </it>[1:<it>i</it><sub>1</sub>] <it>S </it>[<it>i</it><sub>1</sub>+1:<it>i</it><sub>2</sub>]...<it>S </it>[<it>i</it><sub><it>m</it>-1</sub>:<it>L</it>], such that the <it>k</it>-th component <it>S </it>[<it>i</it><sub>k-1</sub>+1:<it>i</it><sub><it>k</it></sub>] is the longest fragment downstream of position <it>i</it><sub><it>k</it>-1 </sub>for which an exact repeat has been encountered somewhere upstream of position <it>i</it><sub><it>k</it>-1</sub>+1. The number of fragments in the decomposition, <it>C</it><sub><it>LZ </it></sub>(<it>S</it>) = <it>m</it>, is called the complexity of <it>S </it>with respect to direct repeats. For example, if <it>S </it>= TCGATCGAGAT, then the decomposition of <it>S </it>with respect to direct repeats is T-C-G-A-TCGA-GAT. Fragments 1, 2, 3 and 4 in this decomposition are of length one since respective nucleotides T, C, G and A occur for the first time. Exact copies of fragments 5 and 6 occur in positions 1 and 3 respectively. The <it>C</it><sub><it>LZ </it></sub>of the sequence with respect to direct repeats equals 6. To find fragments repeated in different <it>rbcS </it>5'-NCS, we concatenated multiple sequences for <it>C</it><sub><it>LZ </it></sub>analysis.</p>
            <p>(2) Overrepresented motifs were sought with MOTIF SAMPLER, using a range of program options for prior probabilities, lengths, numbers and overlaps of motifs. MOTIF SAMPLER can also vary the background Markov model order (i.e. dependency on a given number of preceding sequence positions). Thijs et al. <abbrgrp><abbr bid="B52">52</abbr></abbrgrp> found higher order models improved robustness of motif recovery in <it>Arabidopsis </it>data. We found that the optimal Markov model order differed for different motifs: in 40 repeat runs, optimal model orders were zero for detection of blocks 06, 22 and 29, first for 10, 25 and 30, second for 23 and 28, and third for 08 and 20. (Blocks are defined in Table <tblr tid="T1">1</tblr>.)</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Conserved Blocks in <it>rbcS </it>5'-NCS</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Block</p>
                     </c>
                     <c ca="left">
                        <p>Definition<sup>a</sup></p>
                     </c>
                     <c ca="left">
                        <p>Associated motifs<sup>b</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>01</p>
                     </c>
                     <c ca="left">
                        <p>GCGTCTGATTT</p>
                     </c>
                     <c ca="left">
                        <p>(?)ARR1 site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>02</p>
                     </c>
                     <c ca="left">
                        <p>AAGGAGCCAAAAGC</p>
                     </c>
                     <c ca="left">
                        <p>(?)Dof site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>03</p>
                     </c>
                     <c ca="left">
                        <p>AACCGATCAAGTGGAGA</p>
                     </c>
                     <c ca="left">
                        <p>(?)MYC site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>04</p>
                     </c>
                     <c ca="left">
                        <p>AAAAATGAAAAACTTGTC</p>
                     </c>
                     <c ca="left">
                        <p>(?)GT-1 site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>05</p>
                     </c>
                     <c ca="left">
                        <p>AACCATACACA</p>
                     </c>
                     <c ca="left">
                        <p>(?)MYB site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>06*</p>
                     </c>
                     <c ca="left">
                        <p>ATCACACATT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>Box III* [32]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>07</p>
                     </c>
                     <c ca="left">
                        <p>ATATCCTCTTCCTACCCCCAT</p>
                     </c>
                     <c ca="left">
                        <p>(?)PHR1 site; (?)MYB site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>08*</p>
                     </c>
                     <c ca="left">
                        <p>GATGAGATAAGA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>I-box [31]; <it>rbcS</it>-CMA5 [28]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>09*</p>
                     </c>
                     <c ca="left">
                        <p>TTTGAGATAAGGA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>I-box [31]; Manzara 5 [27]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10*</p>
                     </c>
                     <c ca="left">
                        <p>ACACGTGGCA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>G-box [31]; <it>rbcS</it>-CMA4/5 [28]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11*</p>
                     </c>
                     <c ca="left">
                        <p>TCCTATTGGTGGCT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA4 [28]; Manzara 4/8 [27]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12*</p>
                     </c>
                     <c ca="left">
                        <p>GATAAGGCT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>I-box [31]; <it>rbcS</it>-CMA4 [28]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>TCAACACCTTTCCTT</p>
                     </c>
                     <c ca="left">
                        <p>(?)RAV1-A site; (?)Dof site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>GGCACTTAGCTCCAATT</p>
                     </c>
                     <c ca="left">
                        <p>(?)CCAAT-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>TTTCCAACC</p>
                     </c>
                     <c ca="left">
                        <p>(?)MYB site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16*</p>
                     </c>
                     <c ca="left">
                        <p>AGGGGTTAAA</p>
                     </c>
                     <c ca="left">
                        <p>Manzara 6 [27]; (?)GT1-core [32]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17*</p>
                     </c>
                     <c ca="left">
                        <p>ATCTTGTGTGGTTAAT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>Box II [32]; <it>rbcS</it>-CMA3 [28]; Manzara 8 [27]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>AACGACGTTATCATGAAT</p>
                     </c>
                     <c ca="left">
                        <p>(?)ACGT element; (-)I-box [27]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19*</p>
                     </c>
                     <c ca="left">
                        <p>GCAAAGTTT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>3AF-5 site [43]; <it>rbcS</it>-CMA3 [28]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20*</p>
                     </c>
                     <c ca="left">
                        <p>TGTAATGTCA</p>
                     </c>
                     <c ca="left">
                        <p>Manzara 9 [49]; (?)(-)W-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21*</p>
                     </c>
                     <c ca="left">
                        <p>ATCATTTTCAC</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>Box III [32]; <it>rbcS</it>-CMA3 [28]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22*</p>
                     </c>
                     <c ca="left">
                        <p>CCACATAA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA2 [28]; Manzara 10 [49]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23*</p>
                     </c>
                     <c ca="left">
                        <p>TCCAATGGTTA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA2 [28]; Manzara 12&#8211;13 [49]; CAAT-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>ACCCTTTGATCATTA</p>
                     </c>
                     <c ca="left">
                        <p>(?)(-)Dof site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25*</p>
                     </c>
                     <c ca="left">
                        <p>TCTAAGATGAGGTTTGCT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA2 [28]; Manzara 15 [49]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>TACCACAATTT</p>
                     </c>
                     <c ca="left">
                        <p>(?)CAAT-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>ACCATAATATTGGAA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA1 [28]; (?)(-)CCAAT-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28*</p>
                     </c>
                     <c ca="left">
                        <p>TTGTGTCCGTTAGATG</p>
                     </c>
                     <c ca="left">
                        <p>Manzara 16 [49]; (?)MYB site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29*</p>
                     </c>
                     <c ca="left">
                        <p>CCTTATCAT</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA1 [28]; LRE [49]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30*</p>
                     </c>
                     <c ca="left">
                        <p>TATATAAA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS</it>-CMA1 [28]; TATA-box [49]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>GAGGGGGA</p>
                     </c>
                     <c ca="left">
                        <p>(?)WT-1 site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p>ATGACAAAACCA</p>
                     </c>
                     <c ca="left">
                        <p>(?)W-box; (?)MYB site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33*</p>
                     </c>
                     <c ca="left">
                        <p>AAGCTTTGCAA</p>
                     </c>
                     <c ca="left">
                        <p><it>rbcS </it>Box V [90]; (?)(-)Dof site</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p>GCAATAACCCTCTT</p>
                     </c>
                     <c ca="left">
                        <p>(?)CAAT-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p>AAGAAGAAGA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>36</p>
                     </c>
                     <c ca="left">
                        <p>TTTTCAGCA</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Typical instances (full list in Additional File <supplr sid="S1">1</supplr>). <sup>b</sup>(?)PLACE database match; (-)reverse-strand motif. *Noted previously in <it>rbcS </it>genes: references in square brackets.</p>
               </tblfn>
            </tbl>
            <p>(3) Sites of local congruence were sought in multiple sequence alignments produced by CLUSTALW, ALIGN-M and DIALIGN, with various gap penalty options for the first two. Collation of methodologies by mapping output from <it>C</it><sub><it>LZ </it></sub>and Gibbs sampling analyses onto alignments yielded useful synergies. In particular, the alignments revealed arrays of blocks that occurred in several sequences in the same order, which increased confidence in less conserved block versions that occurred in the appropriate position relative to other blocks.</p>
            <p>Our initial <it>C</it><sub><it>LZ </it></sub>procedure specified blocks &#8805; 8 bp with up to two mismatches, which identified 218 instances of 34 conserved blocks (on average 90% identical with their definitions in Table <tblr tid="T1">1</tblr>). Relaxation of the mismatch criterion for DIALIGN-aligned versions of these 34 <it>C</it><sub><it>LZ</it></sub>-defined blocks exposed an additional 109 instances (of average 76% identity with definitions).</p>
            <p>Conversely, mapping blocks from other tools clarified often complex alignments. When the full dataset was aligned by DIALIGN, 67% of aligned blocks split into an average 3.5 fragments, and 86% of blocks were co-aligned on average with 1.7 others. Nonetheless, with support from <it>C</it><sub><it>LZ </it></sub>and MOTIF SAMPLER, 323 instances of 35 blocks were identified within alignments. MOTIF SAMPLER used independently found 291 instances of 35 blocks.</p>
            <p>The complementarity of our different phylogenetic footprinting methods was demonstrated by the benchmarking exercise in Figure <figr fid="F1">1</figr>. In this exercise, each tool independently analyzed the full set of 27 5'-NCS, to test performance (versus the methodological consensus) in scoring each instance of the 12 most frequent blocks. Performance parameters, following Tompa et al. <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>, were:</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Comparison of phylogenetic footprinting tools in predicting the 12 most frequent blocks in the 27 dicot <it>rbcS </it>5'-NCS</p>
               </caption>
               <text>
                  <p><b>Comparison of phylogenetic footprinting tools in predicting the 12 most frequent blocks in the 27 dicot <it>rbcS </it>5'-NCS</b>. See text for Sensitivity (equation 1) and PPV (equation 2) performance parameters. MOTIF SAMPLER was run 8 times each for background model orders 0&#8211;3, and with the prior probability of motif (<it>p</it>) at 0.3, the empirical value from the analytical consensus. Other option settings were <it>s </it>0, <it>M </it>1, <it>n </it>3, <it>w </it>11, <it>x </it>0, <it>r </it>5. Gap penalties for CLUSTALW (1) were: opening 15.0, extension 6.66; and for ALIGN-M and CLUSTALW (2): opening 8.0, extension 0.5. Mean performance parameters shown with standard deviation bars. Values sharing alphabet labels were not significantly different (Mann-Whitney <it>U </it>test, <it>P </it>> 0.05).</p>
               </text>
               <graphic file="1471-2148-7-51-1"/>
            </fig>
            <p>
               <display-formula id="M1">Sensitivity = <it>nTP</it>/(<it>nTP</it>+<it>nFN</it>)</display-formula>
            </p>
            <p>
               <display-formula id="M2">Positive Predictive Value (PPV) = <it>nTP</it>/(<it>nTP</it>+<it>nFP</it>)</display-formula>
            </p>
            <p>where <it>nTP </it>= number of 'true' positives (identified blocks found also by other tools), <it>nFN </it>= 'false' negatives (blocks not found though supported by other tools), and <it>nFP </it>= 'false' positives (blocks found but not supported by other tools). (Since every block instance had not been verified as a <it>cis</it>-element, the 'true' and 'false' concepts in these equations reflected sequence analysis performance rather than functionality prediction.)</p>
            <p><it>C</it><sub><it>LZ </it></sub>analysis and MOTIF SAMPLER showed greater PPV in block prediction, but weaker sensitivities, than the best alignment methods (Figure <figr fid="F1">1</figr>). MOTIF SAMPLER's sensitivity for individual blocks correlated (<it>r </it>= 0.85, <it>P </it>&lt; 0.001) with its log-likelihood statistic <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> that is optimized during Gibbs sampling. Among the alignment tools, DIALIGN and ALIGN-M, designed for highly divergent sequences with localized alignments, outperformed the CLUSTALW global alignment algorithm (Figure <figr fid="F1">1</figr>). The performance of CLUSTALW was significantly improved by reducing the gap penalties, though the PPV of DIALIGN and ALIGN-M remained superior (Figure <figr fid="F1">1</figr>).</p>
            <p>MOTIF SAMPLER outputs statistical data, which helped estimate the significance of our phylogenetic footprinting results. Ten dummy datasets with different randomizations of every sequence were analyzed by MOTIF SAMPLER using background model orders 0&#8211;3. Randomization caused MOTIF SAMPLER to find on average 6.5-fold fewer pseudo-motif instances. Log-likelihood scores <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> for pseudo-motifs in the 10 dummy datasets were much lower (mean = 49.6, standard deviation = 17.3) than those of the original sequence motifs (mean = 188.7, standard deviation = 60.2), which differed from random at significance levels of <it>P </it>&lt; 0.0001 (Kruskal-Wallis tests).</p>
            <p>In summation, phylogenetic footprinting defined 36 conserved blocks, representing contiguous nucleotide sequences occurring in two or more <it>rbcS </it>5'-NCS, and being of sufficient length, sequence fidelity and positional similarity to make their common evolutionary origin probable. A total of 338 instances of these blocks were identified in the dataset. A large majority (275 instances of 33 blocks) were supported by all three methodologies. Of these 33 blocks, another 37 instances were supported only by <it>C</it><sub><it>LZ </it></sub>and alignments, and 5 more only by <it>C</it><sub><it>LZ </it></sub>and MOTIF SAMPLER. Two other blocks (11 instances) were defined using only MOTIF SAMPLER and alignments, and a single block (10 instances) only by <it>C</it><sub><it>LZ </it></sub>analysis.</p>
         </sec>
         <sec>
            <st>
               <p>Conserved blocks</p>
            </st>
            <p>All block instances are mapped for the rosid (brassica and legume) 5'-NCS in Figure <figr fid="F2">2</figr>, and solanaceous 5'-NCS in Figure <figr fid="F3">3</figr>. An average of 12.5 blocks were found in each gene. The blocks occurred in arrays whose relative order was absolutely conserved, so that the number-codes detailed in Table <tblr tid="T1">1</tblr> consistently reflect relative block positions from 5' to 3' in all sequences. We therefore confirmed observations of Arg&#252;ello-Astorga and Herrera-Estrella <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> on the existence in light-responsive plant promoters of 'conserved modular arrays' (CMAs), which they defined as 'short promoter regions, including at least two different DNA stretches larger than 6 bp (putative individual factor binding sites or phylogenetic footprints), in which nucleotidic sequence, spacing, and position relative to the transcription start site are conserved in a phylogenetic series'.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Block structures of rosid <it>rbcS </it>5'-NCS</p>
               </caption>
               <text>
                  <p><b>Block structures of rosid <it>rbcS </it>5'-NCS</b>. Blocks individually coloured, and numbered (as Table 1) on first appearance from top. Horizontal dimension = block length (bp), vertical dimension proportional to identity with definitions in Table 1 (range: 40&#8211;100%). Complete [06-08-10-11] CMAs in dotted-line boxes. Blocks common to brassica and legume 5'-NCS joined by lines with block numbers in boxes. Blocks also found in solanaceous 5'-NCS indicated by unfilled arrowheads on <it>Arabidopsis ats1A </it>and <it>Phaseolus rbcS-2</it>. Red arrowheads show experimentally determined transcription start sites [46, 50, 86, 87].</p>
               </text>
               <graphic file="1471-2148-7-51-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Block structures of solanaceous rbcS 5'-NCS</p>
               </caption>
               <text>
                  <p><b>Block structures of solanaceous rbcS 5'-NCS</b>. Sequences grouped as the 3 loci of Dean et al. [25]. Blocks individually coloured, and numbered (as Table 1) on first appearance from top. Horizontal dimension = block length (bp), vertical dimension proportional to identity with Table 1 definitions (range: 47&#8211;100%). Complete [06-08-10-11] CMAs in dotted-line boxes. Blocks also in rosid 5'-NCS indicated by unfilled arrowheads on <it>Nicotiana rbcS-8B</it>. Red arrowheads show experimentally determined transcription start sites [53, 54, 88, 89]. <it>Stowaway-Le2 </it>transposable element is mapped in tomato <it>rbcS-1 </it>[56].</p>
               </text>
               <graphic file="1471-2148-7-51-3"/>
            </fig>
            <p>Over a third of blocks were conserved in two or more plant families, but the remainder were distinctive to single families, or, in the case of the solanaceous genes, to particular orthologous loci identified by Dean et al. <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
            <p>Blocks are listed in Table <tblr tid="T1">1</tblr> with 'definitions' as typical instances, since for variable blocks a consensus would be dominated by ambiguous IUPAC code. The degree of conservation of each instance relative to the 'definition' is indicated by the vertical block dimensions in Figures <figr fid="F2">2</figr> and <figr fid="F3">3</figr>; the 'definitions' were chosen to maximize these dimensions and do not necessarily represent importance in functional terms. Full sequences and locations of all block instances are in Additional File <supplr sid="S1">1</supplr>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>Conserved blocks in <it>rbcS </it>5'-NCS. Alignments and locations of conserved blocks in all sequences.</p>
               </text>
               <file name="1471-2148-7-51-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>The 18 blocks asterisked in Table <tblr tid="T1">1</tblr> have been recognized in past <it>rbcS </it>research. Of these, the motif most represented was the I-box (blocks 08, 09, 12, 18, 29). The reverse-strand I-box (block 29) immediately upstream of the TATA-box (block 30) was found by Grob and St&#252;ber <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, who termed it the light-responsive element (LRE).</p>
            <p>The I-box block 08 functions in a light-responsive dual unit with the G-box block 10 <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. The I-G boxes unit represented by blocks [08&#8211;10] was found to be common in light-responsive promoters, and termed <it>rbcS</it>-CMA5 by Arg&#252;ello-Astorga and Herrera-Estrella <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. In rosid NCS, a second I-box downstream (block 12) occurred in an I-G-I boxes array postulated as ancestral by these authors. The TG-rich block 11, between the G-box (10) and second I-box (12), formed part of <it>rbcS</it>-CMA4 of Arg&#252;ello-Astorga and Herrera-Estrella <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Block 11 usually corresponded to Motif 4 of Manzara and Gruissem <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> (but see later on Box II).</p>
            <p>In the present study, the largest CMA found in all three plant families comprised blocks [06-08-10-11], in dotted-line boxes in Figures <figr fid="F2">2</figr> and <figr fid="F3">3</figr>. Block 06 is a previously overlooked motif, but we found identical versions in similar relative locations in the caryophyllid genes <it>Mesembryanthemum crystallinum rbcS-1 </it>[EMBL <ext-link ext-link-type="embl" ext-link-id="L10212">L10212</ext-link>, -241 bp] and <it>Spinacia oleracea rbcS-1 </it>[EMBL <ext-link ext-link-type="embl" ext-link-id="X73236">X73236</ext-link>, -363 bp]. In pea <it>rbcS-3A</it>, block 06 overlapped the 5' flank of the box III* inverted GT-1 site <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>, and so might be a site for a factor like 3AF5, a light-regulated phosphoprotein that binds the 5' flank of the similar downstream Box III <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. The pea <it>rbcS-3A </it>3AF5 and Box III sites themselves corresponded to legume-specific blocks 19 and 21, which with block 17 are equivalent to <it>rbcS</it>-CMA3 of Arg&#252;ello-Astorga and Herrera-Estrella <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>.</p>
            <p>Block 17 coincided with the pea <it>rbcS-3A </it>Box II element, which is the prototype of GT-1 trihelix TF binding sites and a target of the calcium phototransduction pathway <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B29">29</abbr></abbrgrp>. The variability of Box II-like motifs <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> was reflected in the low MOTIF SAMPLER consensus score <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> for block 17 (1.04), but this block was recognized by MOTIF SAMPLER with 85% sensitivity, and aligned in all dicot NCS by DIALIGN and ALIGN-M on its relatively conserved TGTGG sub-fragment. The Box II motifs of earlier alignments <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr></abbrgrp> corresponded to block 17 for most sequences, but to block 11 for tomato <it>rbcS-2 </it>and <it>rbcS-3A</it>. (Local alignments of sequences not available to the earlier authors confirm our assignments.)</p>
            <p>The solanaceous 5'-NCS (Figure <figr fid="F2">2</figr>) yielded further previously identified motifs, whose functions generally remain uncertain. Blocks 22, 23 and 25 were components of <it>rbcS</it>-CMA2 <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and identified by Manzara et al. <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> (Table <tblr tid="T1">1</tblr>). Likewise, the blocks 20 and 28 flanking <it>rbcS</it>-CMA2 were found by Manzara et al. <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> (Table <tblr tid="T1">1</tblr>).</p>
            <p>On average, 10.2% of the length of those sequences with known transcription start sites was occupied by 5'-UTRs, though these were highly variable in extent (Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>). Blocks 32&#8211;34 occurred in the proximities of transcription start sites. Only two blocks, 35 and 36, were located fully within 5'-UTRs, but each featured in multiple sequences in several species (Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>).</p>
            <p>Precisely half the blocks in Table <tblr tid="T1">1</tblr> were newly identified in this study. These novel blocks were confined to single plant families, apart from the brassica blocks 02, 24 and 35 also found in a legume species. In most of the novel blocks, potential <it>cis</it>-elements could be speculatively identified using promoter databases (Table <tblr tid="T1">1</tblr>).</p>
            <p>Protein-DNA interactions in tomato <it>rbcS </it>5'-NCS have been extensively mapped by Gruissem and colleagues, using DNase I footprinting of promoter fragments in nuclear extracts from different organs <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr></abbrgrp>. As shown for locus 3 (Figure <figr fid="F4">4</figr>), over 90% of our conserved blocks overlapped with DNase-protected regions in the 5'-NCS where these authors had defined DNase footprints for both DNA strands. DNase-protected regions also included blocks 31, 34, 36, which have not been defined in past studies.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Protein binding relative to sequence structure in rbcS 5'-NCS of tomato locus 3</p>
               </caption>
               <text>
                  <p><b>Protein binding relative to sequence structure in rbcS 5'-NCS of tomato locus 3</b>. Round-cornered rectangles with alphabet labels correspond to mapped regions of DNase protection, colour-coded by organ [53, 54]. Square-cornered rectangles are conserved blocks as Figure 3. Line plots show local <it>C</it><sub><it>LZ </it></sub>bp<sup>-1 </sup>with respect to the [AT][GC] alphabet in 6-bp sliding-window profiles in 2-bp steps.</p>
               </text>
               <graphic file="1471-2148-7-51-4"/>
            </fig>
            <p>On the other hand, one-third of DNase-protected regions did not overlap with well defined blocks (Figure <figr fid="F4">4</figr>). These additional DNase-protected sequences tended to be very variable between genes and dominated by particular nucleotides (e.g. AT-rich regions). The latter feature can be formally translated as low complexity, as shown by the sliding-window profiles of <it>C</it><sub><it>LZ </it></sub><abbrgrp><abbr bid="B55">55</abbr></abbrgrp> with respect to the [AT] [GC] alphabet in Figure <figr fid="F4">4</figr>. The association of DNase-protection with <it>C</it><sub><it>LZ </it></sub>troughs implied functional roles for low-complexity regions.</p>
            <p>One characterized mechanism for the introduction of AT-richness (and thus low <it>C</it><sub><it>LZ</it></sub>) into an <it>rbcS </it>5'-NCS sequence is the <it>Stowaway-Le2 </it>inverted repeat element in the tomato <it>rbcS-1 </it>sequence (Figure <figr fid="F3">3</figr>) <abbrgrp><abbr bid="B56">56</abbr><abbr bid="B57">57</abbr></abbrgrp>. Sliding-window <it>C</it><sub><it>LZ </it></sub>profiles confirmed the <it>Stowaway-Le2 </it>sequence as one of the main low-complexity regions of the tomato <it>rbcS-1 </it>5'-NCS (not shown). DNase-protected regions do occur within the <it>Stowaway-Le2 </it>sequence <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B56">56</abbr><abbr bid="B57">57</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Evolutionary analysis</p>
            </st>
            <p>The absolutely conserved relative order of blocks indicated common ancestry of all the dicot 5'-NCS studied (Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>). This provided basic confirmation of the potential for evolutionary analysis of phylogenetic footprints, as these must share the evolutionary history of the plant taxa or gene loci with which they are associated. Minimum ages for blocks found in different species were estimated by reference to molecular clock dates for relevant taxon divergences (Table <tblr tid="T2">2</tblr>). For blocks common to paralogous loci, further evidence on minimum ages was available from recent studies of ancestral genome duplications (Table <tblr tid="T2">2</tblr>). Blanc et al. <abbrgrp><abbr bid="B58">58</abbr></abbrgrp> produced a database of 45 duplicate chromosome segment pairs in the <it>Arabidopsis </it>genome, one of which (Figure <figr fid="F5">5</figr>) encompassed the <it>ats1A </it>and <it>B </it>genes. Comparisons of synonymous substitutions (<it>Ks</it>) in the duplicate genes indicated the relevant polyploidy event was roughly twice as ancient as the <it>Brassica</it>-<it>Arabidopsis </it>divergence <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. Bowers et al. <abbrgrp><abbr bid="B59">59</abbr></abbrgrp> similarly identified a duplication event, prior to the <it>Brassica</it>-<it>Arabidopsis </it>split, that generated 34 chromosome segment pairs, of which their segment &#945; 25 encompassed the <it>ats1A </it>and <it>B </it>genes.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Minimum Age Estimates for <it>rbcS </it>5'-NCS Blocks</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Blocks</p>
                     </c>
                     <c ca="left">
                        <p>Occurrence</p>
                     </c>
                     <c ca="left">
                        <p>Minimum age (10<sup>6 </sup>years)</p>
                     </c>
                     <c ca="left">
                        <p>Calibration events</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>04, 07, 09, 14, 15, 16, 22, 25, 28, 31, 34, 36</p>
                     </c>
                     <c ca="left">
                        <p>Solanaceae</p>
                     </c>
                     <c ca="left">
                        <p>18&#8211;23</p>
                     </c>
                     <c ca="left">
                        <p>Duplication of ancestral <it>rbcS </it>loci [62]; divergence of <it>Petunia </it>clade [51]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19, 26, 27</p>
                     </c>
                     <c ca="left">
                        <p><it>Pisum </it>&amp;<it>Medicago</it></p>
                     </c>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p><it>Pisum-Medicago </it>divergence [91]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>01</p>
                     </c>
                     <c ca="left">
                        <p>Brassicaceae</p>
                     </c>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p><it>Arabidopsis</it>-<it>Brassica </it>divergence [92]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>02, 03, 05, 13, 18, 32</p>
                     </c>
                     <c ca="left">
                        <p>Brassicaceae</p>
                     </c>
                     <c ca="left">
                        <p>48</p>
                     </c>
                     <c ca="left">
                        <p>Duplication of ancestral <it>ats </it>loci [58]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21, 33</p>
                     </c>
                     <c ca="left">
                        <p>Fabaceae</p>
                     </c>
                     <c ca="left">
                        <p>54</p>
                     </c>
                     <c ca="left">
                        <p>Divergence of <it>Phaseolus </it>clade [91]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>02, 12, 24, 35</p>
                     </c>
                     <c ca="left">
                        <p>Brassicaceae, Fabaceae</p>
                     </c>
                     <c ca="left">
                        <p>105</p>
                     </c>
                     <c ca="left">
                        <p>Divergence of eurosids I &amp; II [51]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>06, 08, 10, 11, 17, 20, 23, 29, 30</p>
                     </c>
                     <c ca="left">
                        <p>Brassicaceae and/or Fabaceae, Solanaceae</p>
                     </c>
                     <c ca="left">
                        <p>125</p>
                     </c>
                     <c ca="left">
                        <p>Divergence of rosids &amp; asterids [51]</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Duplicated segment pairs on <it>Arabidopsis </it>chromosomes 1 and 5 encompassing <it>ats1A </it>and <it>B </it>family genes</p>
               </caption>
               <text>
                  <p><b>Duplicated segment pairs on <it>Arabidopsis </it>chromosomes 1 and 5 encompassing <it>ats1A </it>and <it>B </it>family genes</b>. Duplicate genes linked by inter-chromosome lines, with dotted lines for tandem arrays. Gene labels are for clarity, and may refer merely to putative functions. Based on block 0105451100840, PARALOGONS IN <it>ARABIDOPSIS THALIANA </it>database [73].</p>
               </text>
               <graphic file="1471-2148-7-51-5"/>
            </fig>
            <p>Within the duplicate segments containing the <it>ats1A </it>and <it>B </it>genes, the latter were among several examples of tandem arrays, others including LRK10L receptor-like Ser/Thr kinases <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. Such tandem arrays, presumed due to unequal crossing over, account for up to 17% of all <it>Arabidopsis </it>genes <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>, but their age range is currently uncertain <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>.</p>
            <p>In the Solanaceae, a large-scale genome duplication was dated to 18&#8211;23 million years ago (mya) from <it>Ks </it>distributions of duplicate tomato and potato genes <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. <it>Ks </it>values for inter-locus comparisons of tomato <it>rbcS </it>coding sequences were consistent with formation of the 3 loci in this event (Figure <figr fid="F6">6</figr>). This must have occurred in a common ancestor, as <it>Ks </it>values for tomato and potato <it>rbcS </it>orthologues (Figure <figr fid="F6">6</figr>) were consistent with the much more recent speciation date estimated at 1.6&#8211;3.3 mya by Blanc and Wolfe <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Levels of synonymous substitutions (<it>Ks</it>) in solanaceous <it>rbcS </it>coding sequences</p>
               </caption>
               <text>
                  <p><b>Levels of synonymous substitutions (<it>Ks</it>) in solanaceous <it>rbcS </it>coding sequences</b>. Mean <it>Ks </it>(with standard deviation bars) are shown for comparisons of: all gene pairs from the 3 loci within tomato (white bars) or potato (black bars); or all paired tomato-potato (T-P) orthologues (grey bar). Brackets indicate <it>Ks </it>distribution peaks attributed by Blanc and Wolfe [62] to genome duplication or speciation events.</p>
               </text>
               <graphic file="1471-2148-7-51-6"/>
            </fig>
            <p>Estimated dates for major lineage divergences implied that 13 taxonomically widespread blocks were of Cretaceous antiquity at least (Table <tblr tid="T2">2</tblr>). These included the [06-08-10-11] CMA, block 12 (the second I-box in rosids), and blocks 17 (Box II), 23 (CAAT-box), 29 (LRE) and 30 (TATA-box). Another, block 20, remains poorly characterized in functional terms, but does bind protein (Figure <figr fid="F4">4</figr>), and was further noted in genes from the Amaranthaceae (<it>Spinacia oleracea rbcS-1 </it>[EMBL <ext-link ext-link-type="embl" ext-link-id="X73236">X73236</ext-link>, -191 bp]), and Malvaceae (<it>Gossypium hirsutum rbcS </it>[EMBL <ext-link ext-link-type="embl" ext-link-id="X54091">X54091</ext-link>, -186 bp]). Other Cretaceous blocks were three rosid blocks (02, 24 and 35) discovered in the present study. The remaining blocks were found only in single families but could be dated by clade divergence or gene duplication events to 18&#8211;54 mya (Table <tblr tid="T2">2</tblr>).</p>
            <p>The occurrence of particular phylogenetic footprints at different levels in the taxonomic hierarchy (Table <tblr tid="T2">2</tblr>) indicated that the 5'-NCS might be amenable to phylogenetic analysis. Opinions differ, however, about phylogenetic analysis of NCS, particularly at higher taxonomic levels. NCS are seen as problematic for alignment and phylogenetic analysis because of their structural constraints, non-randomness of evolution, and mutational changes such as slipped-strand mispairing, stem-loop secondary structure excision/repair, minute inversions, and intramolecular recombination <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. In practice, however, Bremer et al. <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> found chloroplast NCS to be of similar utility to coding sequences for asterid phylogenetics.</p>
            <p>In view of the technical uncertainties and limited precedents for exploring evolutionary relations between 5'-NCS <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>, we compared several distinct methodologies. First, given the role of <it>C</it><sub><it>LZ </it></sub>analysis in our phylogenetic footprinting, comparison of the 5'-NCS based on this methodology was pertinent. A set of <it>N </it>sequences can be described in terms of their pairwise complexities, in the form of <it>N </it>vectors each containing <it>N </it>components. The (<it>i</it>,<it>j</it>) component is the pairwise <it>C</it><sub><it>LZ </it></sub>with respect to direct repeats between sequences <it>i </it>and <it>j</it>. To some extent, pairwise <it>C</it><sub><it>LZ </it></sub>measures an evolutionary distance between sequences by the number of steps required to produce sequence <it>j </it>from sequence <it>i </it>using it as a source of building blocks. Hierarchical cluster analysis of 5'-NCS in this format produced the dendrogram in Figure <figr fid="F7">7A</figr>. (As <it>C</it><sub><it>LZ </it></sub>depends on sequence length, 5'-NCS shorter than the maximum length of 400 bp had the potential to yield anomalous results. Short sequences were therefore analyzed only if overall topology was robust to their inclusion; only <it>Petunia SSU11A </it>was omitted in consequence.)</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Dendrograms of <it>rbcS </it>5'-NCS relations constructed by 3 methods</p>
               </caption>
               <text>
                  <p><b>Dendrograms of <it>rbcS </it>5'-NCS relations constructed by 3 methods</b>. Groupings highlighted for rosid (brassica and legume) genes, and the 3 solanaceous loci. Non-unique gene symbols prefixed with binomial species initials. (A) Hierarchical cluster analysis, with each sequence defined as vector of <it>C</it><sub><it>LZ </it></sub>values from pairwise decomposition by each of the others. Numerals indicate nodes with multiscale bootstrap resampling values &#8805; 50% obtained by PVCLUST. (B) Parsimony analysis by PAUP* of DIALIGN alignments. 50% majority-rule consensus of 234 most-parsimonious trees shown with bootstrap values &#8805; 50%. (C) Parsimony analysis by PAUP* of sequences defined by block characters. 50% majority-rule consensus of 882 most-parsimonious trees shown with bootstrap values &#8805; 50%.</p>
               </text>
               <graphic file="1471-2148-7-51-7"/>
            </fig>
            <p>Secondly, more conventional analyses based on DNA parsimony or distance were applied to 5'-NCS aligned using DIALIGN, or CLUSTALW with the gap penalties found to be most effective in phylogenetic footprinting (Figure <figr fid="F1">1</figr>). (ALIGN-M was not usable as it does not produce complete alignments where sequence tracts are too divergent.) Figure <figr fid="F7">7B</figr> shows a consensus of most-parsimonious trees of DIALIGN-aligned 5'-NCS. (The short <it>Petunia SSU11A </it>sequence was also omitted from this tree for reasons discussed for Figure <figr fid="F7">7A</figr>.)</p>
            <p>Our third method (Figure <figr fid="F7">7C</figr>) was a cladistic analysis of character-states defined as presence or absence of conserved blocks. All blocks in Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr> were included: of these 96.9% had &#8805; 50% identity with the definitions in Table <tblr tid="T1">1</tblr>. The remainder averaged 45.6% identity, and all but one had been found by three phylogenetic footprinting methods. Close inspections of aligned locations scored as absences were often suggestive of degenerate residues of blocks.</p>
            <p>Several points of congruence between the dendrograms produced by these diverse analyses were identifiable, though bootstrap support for nodes was often moderate or weak (Figure <figr fid="F7">7</figr>). Themes included the clustering of the 5'-NCS by gene loci rather than by species. Thus, 5'-NCS of the <it>Arabidopsis atsB </it>tandem locus showed more affinity with the <it>Brassica </it>sequence than with <it>Arabidopsis ats1A</it>. This accorded with the conclusion of Bowers et al. <abbrgrp><abbr bid="B59">59</abbr></abbrgrp> that the ancestral &#945; duplication event occurred prior to the <it>Brassica</it>-<it>Arabidopsis </it>split, because 49&#8211;64% of relevant <it>Brassica </it>genes were more similar to one <it>Arabidopsis </it>gene than was the <it>Arabidopsis </it>duplicate.</p>
            <p>Another theme was the segregation of the solanaceous 5'-NCS as the three loci deduced by Dean et al. <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> (Figure <figr fid="F7">7</figr>). Pairings of tomato and potato orthologues received particularly strong bootstrap support, consistent with a recent speciation <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. In contrast, the coding sequences of tomato and potato locus3 instead segregated by species (Figure <figr fid="F8">8</figr>). Similar discrepancies between noncoding- and coding-sequence trees in several organisms have been attributed to gene conversion processes that have a greater effect on coding sequences <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>. Also consistent with gene conversion in the locus3 coding sequences were very low intralocus <it>Ks </it>values that would imply tandem duplication near the tomato-potato speciation time (Figure <figr fid="F6">6</figr>), which would be hard to reconcile with the more ancient relationships of their 5'-NCS to <it>Petunia </it>orthologues (Figure <figr fid="F7">7</figr>). Gene conversion in the <it>Petunia </it>locus 3 genes themselves was suggested by Dean et al. <abbrgrp><abbr bid="B64">64</abbr></abbrgrp>.</p>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>Parsimony analysis of solanaceous <it>rbcS </it>coding sequences aligned by CLUSTALW</p>
               </caption>
               <text>
                  <p><b>Parsimony analysis of solanaceous <it>rbcS </it>coding sequences aligned by CLUSTALW</b>. 50% majority-rule consensus of 182 most-parsimonious trees from branch-and-bound search shown with pea <it>rbcS-3C </it>as outgroup. Numerals indicate bootstrap values of nodes. Gene labels as Figure 7.</p>
               </text>
               <graphic file="1471-2148-7-51-8"/>
            </fig>
            <p>The locus 3 5'-NCS presented a consistent picture in that the tomato and potato <it>A </it>genes were resolved as basal members of a monophyletic group (Figure <figr fid="F7">7</figr>). In fact, tomato <it>rbcS-3A </it>was the only gene retaining the ancestral [06-08-10-11] CMA in the analyzed region (Figure <figr fid="F3">3</figr>). The most likely counterpart among the <it>Petunia </it>5'-NCS analyzed was <it>SSU11A </it>(Figure <figr fid="F7">7C</figr>). <it>Petunia SSU112</it>, <it>SSU491 </it>and <it>SSU911 </it>grouped with the more derived 5'-NCS of the tomato and potato <it>B </it>and <it>C </it>genes.</p>
            <p>The remaining solanaceous 5'-NCS grouped into loci 1 and 2 (Figure <figr fid="F7">7</figr>). In evolutionary trees based on CLUSTALW rather than DIALIGN alignments, the <it>Petunia </it>locus 1 gene <it>SSU611 </it>formed the outgroup to locus 2, while the tomato and potato locus 1 genes grouped with the <it>A </it>genes of locus 3 (not shown). The DIALIGN trees were preferred as they were supported by the alternative dendrograms, and because we rated the alignments from this algorithm most highly (Figure <figr fid="F1">1</figr>). Moreover, CLUSTALW alignments of transit peptides supported affinity of <it>SSU611 </it>with the other solanaceous locus 1 genes (not shown).</p>
            <p>The basal solanaceous locus could not be confidently identified, as the basal position of locus 2 in two of the dendrograms in Figure <figr fid="F7">7</figr> had only moderate bootstrap support. Clear guidance was not forthcoming from the coding sequence <it>Ks </it>values (Figure <figr fid="F6">6</figr>), or from parsimony analyses (Figure <figr fid="F8">8</figr>), in which outgroup choice influenced topology with respect to these two loci.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Conserved blocks revealed by phylogenetic footprinting in dicot <it>rbcS </it>5'-NCS formed an evolutionary hierarchy, from those common to plant families that diverged in the Cretaceous, to family-specific blocks with minimum estimated ages of only about 20 million years. Similar heterogeneity in longevity and clade-specificity of promoter motifs has been found in other organisms of ancient divergence. Among homologous human and rodent TF binding sites, for example, Dermitzakis and Clark <abbrgrp><abbr bid="B65">65</abbr></abbrgrp> found 33 with shared functions, while 14 were human-specific and 17 rodent-specific.</p>
         <p>The most ancient conserved blocks we found included those recognized earliest in <it>rbcS </it>research on the basis of functional importance (I-boxes, G-box, Box II, CAAT-box, TATA-box) <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr><abbr bid="B32">32</abbr></abbrgrp>, though several relatively unknown ones also fell in this category. Furthermore, we were able to extend CMAs postulated in previous studies <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Younger blocks were generally of less widely recognized function, and presumably had acquired roles in the more recent clades in which they had evolved. Simulations by Stone and Wray <abbrgrp><abbr bid="B66">66</abbr></abbrgrp> of the acquisition by point mutation of novel TF binding sites, and their subsequent fixation within populations, indicated the evolution of new sites must be virtually inevitable over millions of years. In a theoretical population of 10<sup>6 </sup><it>Arabidopsis </it>plants with two generations per year, the fixation time for two 6-bp binding sites in a 200-bp region was only 270,000 years.</p>
         <p>Evolutionary information in the 5'-NCS was sufficient for several formal computational methods to produce dendrograms in accordance with the existing classification of solanaceous <it>rbcS </it>loci based descriptively on sequence similarities, intron features and linkage relations <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr><abbr bid="B67">67</abbr></abbrgrp>. The solanaceous locus 2 genes are distinguished as the only land plant <it>rbcS </it>genes with introns at three positions, while locus 3 is a distinctive tandem array of three 2-intron <it>rbcS </it>genes in tomato and potato, and probably six in <it>Petunia</it>. Gene duplications appear to have provided additional impetus in functional evolution of <it>rbcS </it>genes. For instance, the strongly expressed locus 3 tomato genes <it>rbcS-3B </it>and <it>rbcS-3C </it><abbrgrp><abbr bid="B68">68</abbr></abbrgrp> represented the most derived members of tandem arrays according to our dendrograms. It has been suggested that gene duplicates are conserved and subfunctionalized by regulatory mutations, because each duplicate must survive to complement lost expression for essential subfunctions in the other <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>. Duplicate gene preservation by such a process could be &lt; 4 million years for a gene with &#8805; 5 regulatory elements and a mutation rate of 10<sup>-7 </sup>per year <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>. Such a rapid preservation of duplicates may need to be invoked for locus 3, because of coincident estimates (18&#8211;23 mya) for the major ancestral genome duplication event <abbrgrp><abbr bid="B62">62</abbr></abbrgrp> and for divergence of the <it>Petunia </it>clade <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. In our dendrograms, segregation of <it>Petunia SSU112</it>, <it>SSU491 </it>and <it>SSU911 </it>with the more derived tomato and potato genes of locus 3 indicated that tandem duplications at locus 3 had occurred prior to the <it>Petunia </it>divergence, and had undergone relatively little subsequent sequence evolution.</p>
         <p>Point mutations do not appear to have been the only evolutionary processes governing protein interactions in the <it>rbcS </it>5'-NCS. Mechanisms such as slipped-strand mispairing <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> probably generated the relatively extensive and variable low-complexity tracts that coincided with known DNase footprints in the locus 3 tomato genes. Another example of the gross mutational processes that can occur in 5'-NCS was the <it>Stowaway-Le2 </it>transposable element in the tomato <it>rbcS-1 </it>sequence (Figure <figr fid="F3">3</figr>). The absence of this transposable element from the potato sequence <abbrgrp><abbr bid="B57">57</abbr></abbrgrp> implies a recent insertion event in tomato.</p>
         <p>A primary factor that facilitated our study was a suite of phylogenetic footprinting tools that complemented and cross-validated each other. The least known member of our toolkit was probably <it>C</it><sub><it>LZ </it></sub>analysis, whose use deserves to increase with its availability as an internet tool <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. Its intuitive process of sequence decomposition by repeated fragments proved useful not only for identification of conserved motifs, but also for highlighting low-complexity regions such as AT-rich tracts, and as a similarity measure for global sequence comparisons and hence dendogram construction. Otu and Sayood <abbrgrp><abbr bid="B70">70</abbr></abbrgrp> formally examined <it>C</it><sub><it>LZ </it></sub>as a new sequence distance measure for phylogenetic tree construction, and demonstrated that its lack of dependence on alignments or evolutionary models was particularly suited for sequences subject to segment-based modifications, including whole mitochondrial genomes of eutherian mammals. Promising alternative alignment-independent methods of sequence comparison have also been proposed using the general information theoretical concept of Kolmogorov complexity <abbrgrp><abbr bid="B71">71</abbr><abbr bid="B72">72</abbr></abbrgrp>, of which <it>C</it><sub><it>LZ </it></sub>is one explicitly computable implementation.</p>
         <p>The dendrograms we produced using <it>C</it><sub><it>LZ</it></sub>, and those obtained by parsimony analysis of DIALIGN alignments or block characters, were of sufficient consistency to confirm the presence of evolutionary information in plant 5'-NCS. The dataset was not designed to investigate taxonomic phylogenies, as it included several multigene families. Moreover, we would not claim that the dendrograms rival in quality those produced using coding sequences, as bootstrap support for nodes was often moderate or weak, and there were points of variance between the dendrograms. Further investigation is needed to establish the extent to which NCS might contribute to molecular phylogenetics. We do, however, conclude that current computational methods provide the potential for analysis of the evolution of gene expression in terms of promoter structure.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Comprehensive phylogenetic footprinting of dicot 5'-NCS revealed conserved modular arrays of recurrent sequence blocks. Transcriptional functionality was confirmed as an evolutionary basis for this conservation by coincidence of recurrent blocks with <it>cis</it>-elements and protein-binding sites. Evolutionary hierarchies were discernible within the assemblage of blocks, such that taxonomically widespread, and hence ancient, blocks could be distinguished from taxon-specific, more recent, ones.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Database information</p>
            </st>
            <p>Noncoding sequences (NCS) up to 400 bp including and immediately 5' to the ATG codon were obtained for the following genes [accession numbers, bp analyzed]: <it>Arabidopsis thaliana ats1A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X13611">X13611</ext-link>, 400], <it>ats1B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X14564">X14564</ext-link>, 400], <it>ats2B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X14564">X14564</ext-link>, 400], <it>ats3B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X14564">X14564</ext-link>, 400]; <it>Brassica napus rbcS </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X61097">X61097</ext-link>, 400]; <it>Phaseolus vulgaris rbcS-2 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="AF028707">AF028707</ext-link>, 400]; <it>Pisum sativum rbcS-E9 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X00806">X00806</ext-link>, 400], <it>rbcS-3A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="M21356">M21356</ext-link>, 400], <it>rbcS-3C </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X04334">X04334</ext-link>, 331]; <it>Medicago sativa rbcSK-1A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X96847">X96847</ext-link>, 400]; <it>Lycopersicon esculentum rbcS-1 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X05982">X05982</ext-link>, 338], <it>rbcS-2 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X05983">X05983</ext-link>, 400], <it>rbcS-3A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X05984">X05984</ext-link>, 380], <it>rbcS-3B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X05985">X05985</ext-link>, 283], <it>rbcS-3C </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X05986">X05986</ext-link>, 300]; <it>Petunia &#215; hybrida SSU112 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X12990">X12990</ext-link>, 351], <it>SSU11A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X03821">X03821</ext-link>, 281], <it>SSU301 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X12986">X12986</ext-link>, 400], <it>SSU491 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X12988">X12988</ext-link>, 400], <it>SSU611 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X12987">X12987</ext-link>, 400], <it>SSU911 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X12989">X12989</ext-link>, 400]; <it>Nicotiana plumbaginifolia rbcS-8B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X13711">X13711</ext-link>, 400]; <it>Solanum tuberosum rbcS-1 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X69759">X69759</ext-link>, 400], <it>rbcS-2A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X69760">X69760</ext-link>, 400], <it>rbcS-2B </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X69761">X69761</ext-link>, 400], <it>rbcS-2C </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X69762">X69762</ext-link>, 400], <it>rbcS-3 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X69763">X69763</ext-link>, 382]; <it>Zea mays rbcSZm1 </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="S42508">S42508</ext-link>, 400]. Coding sequences were from the same accessions, except <it>P. sativum rbcS-3A </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="X04333">X04333</ext-link>] and <it>Zea mays ZmrbcS </it>[EMBL:<ext-link ext-link-type="embl" ext-link-id="Y00322">Y00322</ext-link>].</p>
            <p>Duplicated ancestral chromosome segments encompassing the Arabidopsis <it>ats </it>genes were identified (as block 0105451100840) in the PARALOGONS IN <it>ARABIDOPSIS THALIANA </it>database <abbrgrp><abbr bid="B58">58</abbr><abbr bid="B73">73</abbr></abbrgrp>. Potential <it>cis</it>-elements in the 5'-NCS were identified using the PLACE <abbrgrp><abbr bid="B74">74</abbr><abbr bid="B75">75</abbr></abbrgrp> database.</p>
         </sec>
         <sec>
            <st>
               <p>Sequence analysis</p>
            </st>
            <p>Recurrent sequence blocks were identified in <it>rbcS </it>5'-NCS by Lempel-Ziv complexity (<it>C</it><sub><it>LZ</it></sub>) decomposition. Lempel and Ziv <abbrgrp><abbr bid="B76">76</abbr></abbrgrp> suggested measurement of sequence complexity by the number of steps required for the iterative generation (recovery) of a given sequence <it>S </it>from scratch, using two possible 'recovery' operations per iteration: either copy a fragment that has already been encountered in the recovered part of the sequence; or add (generate) a new symbol not encountered before. This iterative process, called a <it>decomposition</it>, represents a sequence <it>S </it>as a concatenation of <it>m </it>consecutive fragments, <it>H</it>(<it>S</it>) = <it>S </it>[1:<it>i</it><sub>1</sub>]<it>S </it>[<it>i</it><sub>1</sub>+1: <it>i</it><sub>2</sub>]...<it>S </it>[<it>i</it><sub><it>m</it>-1</sub>+1: <it>i</it><sub><it>m </it></sub>= <it>N</it>], where S [<it>i</it><sub><it>k</it>-1</sub>+1: <it>i</it><sub><it>k</it></sub>] is a fragment copied or generated at <it>k</it>-th step, <it>N </it>is the length of the sequence and <it>m </it>= <it>m</it><sub><it>H</it></sub>(<it>S</it>) is the number of steps in decomposition process. Among all possible decompositions the one with the minimum number of steps defines sequence complexity, i.e. <inline-formula><m:math name="1471-2148-7-51-i1" xmlns:m="http://www.w3.org/1998/Math/MathML"><m:semantics><m:mrow><m:msub><m:mi>C</m:mi><m:mrow><m:mi>L</m:mi><m:mi>Z</m:mi></m:mrow></m:msub><m:mo stretchy="false">(</m:mo><m:mi>S</m:mi><m:mo stretchy="false">)</m:mo><m:mo>=</m:mo><m:munder><m:mrow><m:mi>min</m:mi><m:mo>&#8289;</m:mo></m:mrow><m:mi>H</m:mi></m:munder><m:mo>{</m:mo><m:msub><m:mi>m</m:mi><m:mi>h</m:mi></m:msub><m:mo stretchy="false">(</m:mo><m:mi>S</m:mi><m:mo stretchy="false">)</m:mo><m:mo>}</m:mo></m:mrow><m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaacqWGdbWqdaWgaaWcbaGaemitaWKaemOwaOfabeaakiabcIcaOiabdofatjabcMcaPiabg2da9maaxababaGagiyBa0MaeiyAaKMaeiOBa4galeaacqWGibasaeqaaOGaei4EaSNaemyBa02aaSbaaSqaaiabdIgaObqabaGccqGGOaakcqWGtbWucqGGPaqkcqGG9bqFaaa@4287@</m:annotation></m:semantics></m:math></inline-formula>. The minimum is ensured by copying at each step of the decomposition process the longest fragment that has been encountered before. Similarly, one can define a pair-wise complexity of sequences <it>S </it>and <it>Q</it>, <it>C</it>(<it>S</it>|<it>Q</it>), as the number of steps needed to recover <it>Q </it>from <it>S </it>(or <it>S </it>from <it>Q</it>). In this case, each fragment in the decomposition of <it>Q </it>is the longest one whose copy occurs anywhere in sequence <it>S</it>. Gusev et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> proposed a linear algorithm for sequence decomposition and computation of <it>C</it><sub><it>LZ </it></sub>with respect to various types of repeat (including direct and inverted repeats or any combination of them). Its implementation is available online at LZCOMPOSER <abbrgrp><abbr bid="B55">55</abbr><abbr bid="B77">77</abbr></abbrgrp>.</p>
            <p>The full algorithm used in this study follows. <b>Step 1</b>. For <it>N </it>5'-NCS denoted as <it>S</it><sub>1</sub>,..., <it>S</it><sub><it>N </it></sub>(with corresponding lengths |<it>S</it><sub>1</sub>|,..., |<it>S</it><sub><it>N</it></sub>|), a new, concatenated sequence <it>&#331; </it>= <it>S</it><sub>1</sub>#...# <it>S</it><sub><it>N </it></sub>of length <it>L </it>= &#931; |<it>S</it><sub><it>i</it></sub>|, <it>i </it>= 1,..., <it>N </it>was defined. (The arbitrary symbol # separated the concatenated sequences.) <b>Step 2</b>. A Lempel-Ziv decomposition of <it>&#331; </it>into <it>m </it>consecutive fragments, <it>&#331; </it>[1:<it>i</it><sub>1</sub>]<it>&#331; </it>[<it>i</it><sub>1</sub>+1:<it>i</it><sub>2</sub>] ... <it>&#331; </it>[<it>i</it><sub><it>m</it>-1</sub>: <it>L</it>], was computed, such that <it>&#331; </it>[<it>i</it><sub><it>k</it>-1</sub>+1:<it>i</it><sub><it>k</it></sub>] was the longest fragment downstream of position <it>i</it><sub><it>k-1 </it></sub>for which a direct repeat occurred starting from position <it>j</it>(<it>k</it>) somewhere upstream of position <it>i</it><sub><it>k</it>-1</sub>+1, and <it>&#331; </it>[<it>i</it><sub><it>k-1</it></sub>+1:<it>i</it><sub><it>k</it></sub>] did not contain #. Pointers <it>j</it>(<it>k</it>) were expressed as pairs (sequence number, position within the sequence). <b>Step 3</b>. Fragments &#8805; 8 bp that were common for at least two sequences were included in a vocabulary of 'blocks'. Only exact matches were considered in the decomposition process. However, when two or more consecutive fragments of a decomposition were identical to the respective substrings in another sequence, and when these fragments were separated by a similar number of nucleotides (&#177; 1) then they were merged into a single block. All remaining sequences from the given dataset were scanned for the occurrence of these blocks. For each block, the origin in the decomposition and the entire track of occurrences in different sequences were traced, ensuring that the fragments found were independent of the sequence order in <it>&#331;</it>. <b>Step 4</b>. Fragments defined as the same block were aligned, including an extra 10 bp either side to check for possible block extension, and their consensus sequence was defined allowing for a given number of mismatches (initially two). <b>Step 5</b>. All sequences were then scanned for each block defined by its consensus. No steps involved <it>a priori </it>knowledge of <it>cis</it>-elements. A similar algorithm was used to search for inverted repeats <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, but we found too few of these for detailed analysis. The decomposition process is available online at LZCOMPOSER <abbrgrp><abbr bid="B55">55</abbr><abbr bid="B77">77</abbr></abbrgrp>.</p>
            <p>Matrices (<it>N </it>&#215; <it>N</it>) of pairwise <it>C</it><sub><it>LZ </it></sub>values for <it>N </it>sequences were produced on LZCOMPOSER (using the symmetrized matrix output with diagonals adjusted to 0). Sliding-window profiles of local <it>C</it><sub><it>LZ </it></sub>along single sequences were also generated on LZCOMPOSER.</p>
            <p>Overrepresented motifs in the 5'-NCS were also sought using MOTIF SAMPLER v3.1 <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. The 5'-NCS were analyzed in 19 combinations, with program options in the following ranges: search (s), single stranded; prior probability of motif (<it>p</it>), 0.3&#8211;0.8; length of motif (<it>w</it>), 9&#8211;25 bp; number of different motifs (<it>n</it>), 3&#8211;20; number of instances of each motif per sequence (<it>M</it>), 1, 2 or undefined; allowed overlap (<it>x</it>), 1&#8211;9 bp; program repeat runs (<it>r</it>), 0&#8211;99. Background models of order 0&#8211;3 were used in the analysis.</p>
            <p>Multiple alignments of 5'-NCS were performed with three algorithms: CLUSTALW v1.83 <abbrgrp><abbr bid="B78">78</abbr></abbrgrp>; DIALIGN 2 <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> in the QALIGN v1.10T software of Sammeth et al. <abbrgrp><abbr bid="B79">79</abbr></abbrgrp>; and ALIGN-M v2.3 <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Unless stated, gap penalties in both CLUSTALW and the S2P step of ALIGN-M were: opening 8.0; extension0.5. In the search process for conserved blocks, a total of 26 different sequence combinations were aligned with DIALIGN and/or ALIGN-M, and the blocks from <it>C</it><sub><it>LZ </it></sub>analysis and MOTIF SAMPLER were mapped in the alignments.</p>
            <p>Levels of synonymous substitutions (<it>Ks</it>) were obtained by multiple alignment of all the tomato and potato <it>rbcS </it>coding sequences by CLUSTALW (default gap penalties), followed by estimation of the matrix of pairwise <it>Ks </it>values by the method of Li <abbrgrp><abbr bid="B80">80</abbr></abbrgrp> implemented in the R package SEQINR <abbrgrp><abbr bid="B81">81</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Dendrograms</p>
            </st>
            <p>Three strategies were used to produce dendrograms of the 27 dicot sequences, with the 5'-NCS of <it>Zea rbcSZm1 </it>included as outgroup. (1) Hierarchical cluster analysis was performed on matrices of pairwise <it>C</it><sub><it>LZ </it></sub>values (see above), using Euclidean distance to measure similarity of the different rows. Dendrograms were produced by the unweighted pair group method with arithmetic mean (UPGMA), using PAST v1.34 <abbrgrp><abbr bid="B82">82</abbr></abbrgrp> and the R package PVCLUST <abbrgrp><abbr bid="B81">81</abbr></abbrgrp>. Statistical support was assessed using PVCLUST to calculate the approximately unbiased (AU) values of Shimodaira <abbrgrp><abbr bid="B83">83</abbr></abbrgrp> by multiscale bootstrap resampling of 1000 pseudoreplications. (2)Evolutionary trees were produced from multiple sequence alignments created with DIALIGN or CLUSTALW. Trees were obtained, using PAUP* v4.0b10 <abbrgrp><abbr bid="B84">84</abbr></abbrgrp> and PHYLIP v3.64 <abbrgrp><abbr bid="B85">85</abbr></abbrgrp>, by DNA parsimony or, by the neighbour-joining, UPGMA or Fitch-Margoliash methods, from DNA distance matrices produced with the Jukes-Cantor substitution model. (3)Cladistic analysis, using PAUP* v4.0b10 and PAST v1.34, was performed on the conserved blocks identified by sequence analyses. A character-state matrix of absence (0) or presence (1) of each block was created. Characters were assigned equal weight and Dollo status (i.e. a block could evolve only once, but could disappear at several points on the tree). The tree-bisection-reconnection heuristic was used to search for the most parsimonious topologies. For methods (2) and (3), the <it>Zea </it>sequence <it>rbcSZm1 </it>was specified as outgroup, and nodal support was estimated from 100 tenfold-replicated bootstrap pseudoreplicates.</p>
            <p>Evolutionary trees of coding sequences were obtained by bootstrapped parsimony analysis in PAUP*v4.0b10 of sequences aligned by CLUSTALW (default gap penalties) or DIALIGN.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>List of abbreviations</p>
         </st>
         <p><it>C</it><sub><it>LZ</it></sub>, Lempel-Ziv complexity; CMA, conserved modular array; GBF, G-box binding factor; LRE, light-responsive element; <it>Ks</it>, level of synonymous substitutions; mya, million years ago; PPV, Positive Predictive Value; NCS, noncoding sequences; TF, transcription factor; UPGMA, unweighted pair group method with arithmetic mean; UTR, untranslated region.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>Bioinformatic and dendrogram analyses were carried out by KW, NC and IS. The study was designed and coordinated by NC, ID and IS. The manuscript was drafted by IS with contributions and approval by all authors.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This research was funded by the BBSRC Genes and Developmental Biology Committee. We are also grateful to Prof. N.J. Fiddian of Cardiff University School of Computer Science for his support.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The evolution of transcriptional regulation in eukaryotes</p>
            </title>
            <aug>
               <au>
                  <snm>Wray</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Hahn</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Abouheif</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Balhoff</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Pizer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rockman</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Romano</snm>
                  <fnm>LA</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2003</pubdate>
            <volume>20</volume>
            <fpage>1377</fpage>
            <lpage>1419</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msg140</pubid>
                  <pubid idtype="pmpid" link="fulltext">12777501</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Limitations and potentials of current motif discovery algorithms</p>
            </title>
            <aug>
               <au>
                  <snm>Hu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kihara</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <fpage>4889</fpage>
            <lpage>4913</lpage>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Assessing computational tools for the discovery of transcription factor binding sites</p>
            </title>
            <aug>
               <au>
                  <snm>Tompa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bailey</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Church</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Eskin</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Favorov</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Frith</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Fu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kent</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Makeev</snm>
                  <fnm>VJ</fnm>
               </au>
               <au>
                  <snm>Mironov</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Noble</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Pavesi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Pesole</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>R&#233;gnier</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Simonis</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sinha</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Van Helden</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vandenbogaert</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Weng</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Workman</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ye</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>Z</fnm>
               </au>
            </aug>
            <source>Nature Biotech</source>
            <pubdate>2005</pubdate>
            <volume>23</volume>
            <fpage>137</fpage>
            <lpage>144</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/nbt1053</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>DNA sequence comparisons of the human, mouse, and rabbit immunoglobulin kappa gene</p>
            </title>
            <aug>
               <au>
                  <snm>Karlin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ghandour</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Foulser</snm>
                  <fnm>DE</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1985</pubdate>
            <volume>2</volume>
            <fpage>35</fpage>
            <lpage>52</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3939702</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The search for meaning in noncoding DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Clark</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <fpage>1319</fpage>
            <lpage>1320</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gr.201601</pubid>
                  <pubid idtype="pmpid" link="fulltext">11483570</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Conserved noncoding sequences among cultivated cereal genomes identify candidate regulatory sequence elements and patterns of promoter evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Guo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Moose</snm>
                  <fnm>SP</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2003</pubdate>
            <volume>15</volume>
            <fpage>1143</fpage>
            <lpage>1158</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">153722</pubid>
                  <pubid idtype="pmpid" link="fulltext">12724540</pubid>
                  <pubid idtype="doi">10.1105/tpc.010181</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A novel approach to identifying regulatory motifs in distantly related genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Van Hellemont</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Monsieurs</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>de Peer</snm>
                  <fnm>YV</fnm>
               </au>
               <au>
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>13</issue>
            <fpage>R113</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1414112</pubid>
                  <pubid idtype="pmpid" link="fulltext">16420672</pubid>
                  <pubid idtype="doi">10.1186/gb-2005-6-13-r113</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Using cauliflower to find conserved non-coding regions in Arabidopsis</p>
            </title>
            <aug>
               <au>
                  <snm>Colinas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Birnbaum</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Benfey</snm>
                  <fnm>PN</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2002</pubdate>
            <volume>129</volume>
            <fpage>451</fpage>
            <lpage>454</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1540231</pubid>
                  <pubid idtype="pmpid" link="fulltext">12068091</pubid>
                  <pubid idtype="doi">10.1104/pp.002501</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>The evolution of non-coding chloroplast DNA and its application in plant systematics</p>
            </title>
            <aug>
               <au>
                  <snm>Kelchner</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>Ann Mo Bot Gard</source>
            <pubdate>2000</pubdate>
            <volume>87</volume>
            <fpage>482</fpage>
            <lpage>498</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2666142</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Phylogenetics of asterids based on 3 coding and 3 non-coding chloroplast DNA markers and the utility of non-coding DNA at higher taxonomic levels</p>
            </title>
            <aug>
               <au>
                  <snm>Bremer</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bremer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Heidari</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Erixon</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Olmstead</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Anderberg</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>K&#228;llersj&#246;</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barkhordian</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2002</pubdate>
            <volume>24</volume>
            <fpage>274</fpage>
            <lpage>301</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1055-7903(02)00240-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12144762</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Comparative genomics and regulatory evolution: conservation and function of the Chs and Apetala3 promoters</p>
            </title>
            <aug>
               <au>
                  <snm>Koch</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Weisshaar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kroymann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Haubold</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mitchell-Olds</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <fpage>1882</fpage>
            <lpage>1891</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11557794</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Utility and distribution of conserved noncoding sequences in the grasses</p>
            </title>
            <aug>
               <au>
                  <snm>Kaplinsky</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Braun</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Penterman</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Goff</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Freeling</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>6147</fpage>
            <lpage>6151</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">122917</pubid>
                  <pubid idtype="pmpid" link="fulltext">11972021</pubid>
                  <pubid idtype="doi">10.1073/pnas.052139599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Promoter analysis of MADS-box genes in eudicots through phylogenetic footprinting</p>
            </title>
            <aug>
               <au>
                  <snm>De Bodt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Theissen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Van de Peer</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2006</pubdate>
            <volume>23</volume>
            <fpage>1293</fpage>
            <lpage>1303</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msk016</pubid>
                  <pubid idtype="pmpid" link="fulltext">16581940</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Fifty years of Shannon theory</p>
            </title>
            <aug>
               <au>
                  <snm>Verd&#250;</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>IEEE T Inform Theory</source>
            <pubdate>1998</pubdate>
            <volume>44</volume>
            <fpage>2057</fpage>
            <lpage>2078</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1109/18.720531</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>On the complexity measures of genetic sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Gusev</snm>
                  <fnm>VD</fnm>
               </au>
               <au>
                  <snm>Nemytikova</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>NA</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <fpage>994</fpage>
            <lpage>999</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/15.12.994</pubid>
                  <pubid idtype="pmpid" link="fulltext">10745989</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Promoter shuffling has occurred during the evolution of the vertebrate growth hormone gene</p>
            </title>
            <aug>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Krawczak</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nemytikova</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Gusev</snm>
                  <fnm>VD</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>2000</pubdate>
            <volume>254</volume>
            <fpage>9</fpage>
            <lpage>18</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1119(00)00308-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">10974531</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>The evolution of the vertebrate beta-globin gene promoter</p>
            </title>
            <aug>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Krawczak</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nemytikova</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Gusev</snm>
                  <fnm>VD</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2002</pubdate>
            <volume>56</volume>
            <fpage>224</fpage>
            <lpage>232</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1554/0014-3820(2002)056[0224:TEOTVG]2.0.CO;2</pubid>
                  <pubid idtype="pmpid">11926491</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Breakpoints of gross deletions coincide with non-B DNA conformations</p>
            </title>
            <aug>
               <au>
                  <snm>Bacolla</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jaworski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Larson</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Jakupciak</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Abeysinghe</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>14162</fpage>
            <lpage>14167</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">521098</pubid>
                  <pubid idtype="pmpid" link="fulltext">15377784</pubid>
                  <pubid idtype="doi">10.1073/pnas.0405974101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Meta-analysis of indels causing human genetic disease: Mechanisms of mutagenesis and the role of local DNA sequence complexity</p>
            </title>
            <aug>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Anassis</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Ball</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Krawczak</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2003</pubdate>
            <volume>21</volume>
            <fpage>28</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.10146</pubid>
                  <pubid idtype="pmpid" link="fulltext">12497629</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Breakpoint analysis of the pericentric inversion distinguishing human chromosome 4 from the homologous chromosome in the chimpanzee (Pan troglodytes)</p>
            </title>
            <aug>
               <au>
                  <snm>Kehrer-Sawatzki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sandig</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chuzhanova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Goidts</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Szamalek</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Tanzer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Platzer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>DN</fnm>
               </au>
               <au>
                  <snm>Hameister</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2005</pubdate>
            <volume>25</volume>
            <fpage>45</fpage>
            <lpage>55</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.20116</pubid>
                  <pubid idtype="pmpid" link="fulltext">15580561</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes</p>
            </title>
            <aug>
               <au>
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lescot</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rombauts</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>de Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rouz&#233;</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Moreau</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Comput Biol</source>
            <pubdate>2002</pubdate>
            <volume>9</volume>
            <fpage>447</fpage>
            <lpage>464</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/10665270252935566</pubid>
                  <pubid idtype="pmpid" link="fulltext">12015892</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>DIALIGN 2: improvement of the segment-to-segment approach to multiple sequence alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Morgenstern</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <fpage>211</fpage>
            <lpage>218</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/15.3.211</pubid>
                  <pubid idtype="pmpid" link="fulltext">10222408</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>DIALIGN: Finding local similarities by multiple sequence alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Morgenstern</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Frech</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Dress</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Werner</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <fpage>290</fpage>
            <lpage>294</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/14.3.290</pubid>
                  <pubid idtype="pmpid" link="fulltext">9614273</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Align-m - a new algorithm for multiple alignment of highly divergent sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Van Walle</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lasters</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Wyns</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <fpage>1428</fpage>
            <lpage>1435</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bth116</pubid>
                  <pubid idtype="pmpid" link="fulltext">14962914</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Structure, evolution and regulation of RbcS genes in higher plants</p>
            </title>
            <aug>
               <au>
                  <snm>Dean</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pichersky</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Dunsmuir</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Annu Rev Plant Physiol Plant Mol Biol</source>
            <pubdate>1989</pubdate>
            <volume>40</volume>
            <fpage>415</fpage>
            <lpage>439</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1146/annurev.pp.40.060189.002215</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Characterization of a gene encoding a DNA binding protein with specificity for a light-responsive element</p>
            </title>
            <aug>
               <au>
                  <snm>Gilmartin</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Memelink</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hiratsuka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kay</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1992</pubdate>
            <volume>4</volume>
            <fpage>839</fpage>
            <lpage>849</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160179</pubid>
                  <pubid idtype="pmpid" link="fulltext">1392598</pubid>
                  <pubid idtype="doi">10.1105/tpc.4.7.839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Organization and expression of the genes encoding ribulose-1,5-bisphosphate carboxylase in higher plants</p>
            </title>
            <aug>
               <au>
                  <snm>Manzara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Photosynth Res</source>
            <pubdate>1988</pubdate>
            <volume>16</volume>
            <fpage>117</fpage>
            <lpage>139</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00039489</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways</p>
            </title>
            <aug>
               <au>
                  <snm>Arg&#252;ello-Astorga</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Herrera-Estrella</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1996</pubdate>
            <volume>112</volume>
            <fpage>1151</fpage>
            <lpage>1166</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">158042</pubid>
                  <pubid idtype="pmpid" link="fulltext">8938415</pubid>
                  <pubid idtype="doi">10.1104/pp.112.3.1151</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Calcium and cGMP target distinct phytochrome-responsive elements</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hiratsuka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Neuhaus</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Plant J</source>
            <pubdate>1996</pubdate>
            <volume>10</volume>
            <fpage>1149</fpage>
            <lpage>1154</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-313X.1996.10061149.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9011095</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Evolution of light-regulated plant promoters</p>
            </title>
            <aug>
               <au>
                  <snm>Arg&#252;ello-Astorga</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Herrera-Estrella</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Annu Rev Plant Physiol Plant Mol Biol</source>
            <pubdate>1998</pubdate>
            <volume>49</volume>
            <fpage>525</fpage>
            <lpage>555</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.arplant.49.1.525</pubid>
                  <pubid idtype="pmpid" link="fulltext">15012245</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Functional properties and regulatory complexity of a minimal RBCS light-responsive unit activated by phytochrome, cryptochrome, and plastid signals</p>
            </title>
            <aug>
               <au>
                  <snm>Mart&#237;nez-Hern&#225;ndez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>L&#243;pez-Ochoa</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Arg&#252;ello-Astorga</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Herrera-Estrella</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2002</pubdate>
            <volume>128</volume>
            <fpage>1223</fpage>
            <lpage>1233</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">154250</pubid>
                  <pubid idtype="pmpid" link="fulltext">11950971</pubid>
                  <pubid idtype="doi">10.1104/pp.010678</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Molecular light switches for plant genes</p>
            </title>
            <aug>
               <au>
                  <snm>Gilmartin</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Sarokin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Memelink</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1990</pubdate>
            <volume>2</volume>
            <fpage>369</fpage>
            <lpage>378</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159894</pubid>
                  <pubid idtype="pmpid" link="fulltext">2152164</pubid>
                  <pubid idtype="doi">10.1105/tpc.2.5.369</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene</p>
            </title>
            <aug>
               <au>
                  <snm>Guiliano</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Pichersky</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Malik</snm>
                  <fnm>VS</fnm>
               </au>
               <au>
                  <snm>Timko</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Scolnik</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Cashmore</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1988</pubdate>
            <volume>85</volume>
            <fpage>7089</fpage>
            <lpage>7093</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">282129</pubid>
                  <pubid idtype="pmpid" link="fulltext">2902624</pubid>
                  <pubid idtype="doi">10.1073/pnas.85.19.7089</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Plant bZIP G-box binding factors</p>
            </title>
            <aug>
               <au>
                  <snm>Sib&#233;ril</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Doireau</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gantet</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>2001</pubdate>
            <volume>268</volume>
            <fpage>5655</fpage>
            <lpage>5666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.0014-2956.2001.02552.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11722549</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Arabidopsis bZIP protein HY5 directly interacts with light-responsive promoters in mediating light control of gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Chattopadhyay</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ang</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Puente</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Deng</snm>
                  <fnm>XW</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1998</pubdate>
            <volume>10</volume>
            <fpage>673</fpage>
            <lpage>683</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">144028</pubid>
                  <pubid idtype="pmpid" link="fulltext">9596629</pubid>
                  <pubid idtype="doi">10.1105/tpc.10.5.673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS1A promoter</p>
            </title>
            <aug>
               <au>
                  <snm>Donald</snm>
                  <fnm>RGK</fnm>
               </au>
               <au>
                  <snm>Cashmore</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>1990</pubdate>
            <volume>9</volume>
            <fpage>1717</fpage>
            <lpage>1726</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">551874</pubid>
                  <pubid idtype="pmpid">2347304</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Discrimination of phytochrome dependent light inducible from non-light inducible plant genes. Prediction of a common light-responsive element (LRE) in phytochrome dependent light inducible plant genes</p>
            </title>
            <aug>
               <au>
                  <snm>Grob</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>St&#252;ber</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1987</pubdate>
            <volume>15</volume>
            <fpage>9957</fpage>
            <lpage>9973</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">306543</pubid>
                  <pubid idtype="pmpid" link="fulltext">3697087</pubid>
                  <pubid idtype="doi">10.1093/nar/15.23.9957</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Differential expression of the 8 genes of the petunia ribulose bisphosphate carboxylase small subunit multi-gene family</p>
            </title>
            <aug>
               <au>
                  <snm>Dean</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Vandenelzen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tamaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dunsmuir</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bedbrook</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>1985</pubdate>
            <volume>4</volume>
            <fpage>3055</fpage>
            <lpage>3061</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">554622</pubid>
                  <pubid idtype="pmpid">16453647</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Arabidopsis thaliana GATA factors: organisation, expression and DNA-binding characteristics</p>
            </title>
            <aug>
               <au>
                  <snm>Teakle</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Manfield</snm>
                  <fnm>IW</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Gilmartin</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2002</pubdate>
            <volume>50</volume>
            <fpage>43</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1016062325584</pubid>
                  <pubid idtype="pmpid" link="fulltext">12139008</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Constitutive, light-responsive and circadian clock-responsive factors compete for the different I box elements in plant light-regulated promoters</p>
            </title>
            <aug>
               <au>
                  <snm>Borello</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Ceccarelli</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Guiliano</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Plant J</source>
            <pubdate>1993</pubdate>
            <volume>4</volume>
            <fpage>611</fpage>
            <lpage>619</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-313X.1993.04040611.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">8252065</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>A light-regulated DNA-binding activity interacts with a conserved region of a Lemna gibba rbcS promoter</p>
            </title>
            <aug>
               <au>
                  <snm>Buzby</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Yamada</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tobin</snm>
                  <fnm>EM</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1990</pubdate>
            <volume>2</volume>
            <fpage>805</fpage>
            <lpage>814</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159932</pubid>
                  <pubid idtype="pmpid" link="fulltext">2152129</pubid>
                  <pubid idtype="doi">10.1105/tpc.2.8.805</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>The tomato I-box binding factor LeMYB1 is a member of a novel class of Myb-like proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Rose</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meier</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Wienand</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Plant J</source>
            <pubdate>1999</pubdate>
            <volume>20</volume>
            <fpage>641</fpage>
            <lpage>652</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-313X.1999.00638.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10652136</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Binding sites for two novel phosphoproteins, 3AF5 and 3AF3, are required for rbcS-3A expression</p>
            </title>
            <aug>
               <au>
                  <snm>Sarokin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1992</pubdate>
            <volume>4</volume>
            <fpage>473</fpage>
            <lpage>483</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160146</pubid>
                  <pubid idtype="pmpid" link="fulltext">1498605</pubid>
                  <pubid idtype="doi">10.1105/tpc.4.4.473</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>A metal-dependent DNA-binding protein interacts with a constitutive element of a light-responsive promoter</p>
            </title>
            <aug>
               <au>
                  <snm>Lam</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kano-Murakami</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gilmartin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Niner</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1990</pubdate>
            <volume>2</volume>
            <fpage>857</fpage>
            <lpage>866</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159936</pubid>
                  <pubid idtype="pmpid" link="fulltext">2152132</pubid>
                  <pubid idtype="doi">10.1105/tpc.2.9.857</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Organ-specific differential regulation of a promoter subfamily for the ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit genes in tomato</p>
            </title>
            <aug>
               <au>
                  <snm>Meier</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Callan</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Fleming</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1995</pubdate>
            <volume>107</volume>
            <fpage>1105</fpage>
            <lpage>1118</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">157243</pubid>
                  <pubid idtype="pmpid" link="fulltext">7770521</pubid>
                  <pubid idtype="doi">10.1104/pp.107.4.1105</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>A sucrose repression element in the Phaseolus vulgaris rbcS2 gene promoter resembles elements responsible for sugar stimulation of plant and mammalian genes</p>
            </title>
            <aug>
               <au>
                  <snm>Urwin</snm>
                  <fnm>NAR</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>GI</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1997</pubdate>
            <volume>35</volume>
            <fpage>929</fpage>
            <lpage>942</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1005950915499</pubid>
                  <pubid idtype="pmpid" link="fulltext">9426611</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Level of expression of the tomato rbcS-3A gene is modulated by a far upstream promoter element in a developmentally regulated manner</p>
            </title>
            <aug>
               <au>
                  <snm>Ueda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Pichersky</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Malik</snm>
                  <fnm>VS</fnm>
               </au>
               <au>
                  <snm>Cashmore</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1989</pubdate>
            <volume>1</volume>
            <fpage>217</fpage>
            <lpage>227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159754</pubid>
                  <pubid idtype="pmpid" link="fulltext">2535544</pubid>
                  <pubid idtype="doi">10.1105/tpc.1.2.217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Binding of a pea nuclear protein to promoters of certain photoregulated genes is modulated by phosphorylation</p>
            </title>
            <aug>
               <au>
                  <snm>Datta</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cashmore</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1989</pubdate>
            <volume>1</volume>
            <fpage>1069</fpage>
            <lpage>1077</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159844</pubid>
                  <pubid idtype="pmpid" link="fulltext">2562560</pubid>
                  <pubid idtype="doi">10.1105/tpc.1.11.1069</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Developmental and organ-specific changes in promoter DNA-protein interactions in the tomato rbcS gene family</p>
            </title>
            <aug>
               <au>
                  <snm>Manzara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Carrasco</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1991</pubdate>
            <volume>3</volume>
            <fpage>1305</fpage>
            <lpage>1316</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160093</pubid>
                  <pubid idtype="pmpid" link="fulltext">1840899</pubid>
                  <pubid idtype="doi">10.1105/tpc.3.12.1305</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Four genes in two diverged subfamilies encode the ribulose-1,5-bisphosphate carboxylase small subunit polypeptides of Arabidopsis thaliana</p>
            </title>
            <aug>
               <au>
                  <snm>Krebbers</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Seurinck</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Herdies</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Cashmore</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Timko</snm>
                  <fnm>MP</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1988</pubdate>
            <volume>11</volume>
            <fpage>745</fpage>
            <lpage>759</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00019515</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Evolution of the angiosperms: calibrating the family tree</p>
            </title>
            <aug>
               <au>
                  <snm>Wikstr&#246;m</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Savolainen</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Chase</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Proc R Soc Lond B</source>
            <pubdate>2001</pubdate>
            <volume>268</volume>
            <fpage>2211</fpage>
            <lpage>2220</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1098/rspb.2001.1782</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>A higher-order background model improves the detection of promoter regulatory elements by Gibbs sampling</p>
            </title>
            <aug>
               <au>
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lescot</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Rombauts</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rouze</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Moreau</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2001</pubdate>
            <volume>17</volume>
            <fpage>1113</fpage>
            <lpage>1122</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/17.12.1113</pubid>
                  <pubid idtype="pmpid" link="fulltext">11751219</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Developmental and organ-specific changes in DNA-protein interactions in the tomato rbcS1, rbcS2 and rbcS3A promoter regions</p>
            </title>
            <aug>
               <au>
                  <snm>Manzara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Carrasco</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1993</pubdate>
            <volume>21</volume>
            <fpage>69</fpage>
            <lpage>88</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00039619</pubid>
                  <pubid idtype="pmpid">8425051</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Developmental and organ-specific changes in DNA-protein interactions in the tomato rbcS3B and rbcS3C promoter regions</p>
            </title>
            <aug>
               <au>
                  <snm>Carrasco</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Manzara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1993</pubdate>
            <volume>21</volume>
            <fpage>1</fpage>
            <lpage>15</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00039613</pubid>
                  <pubid idtype="pmpid">8425041</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Complexity: an internet resource for analysis of DNA sequence complexity</p>
            </title>
            <aug>
               <au>
                  <snm>Orlov</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Potapov</snm>
                  <fnm>VN</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2004</pubdate>
            <volume>32</volume>
            <fpage>W628</fpage>
            <lpage>W633</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">441604</pubid>
                  <pubid idtype="pmpid" link="fulltext">15215465</pubid>
                  <pubid idtype="doi">10.1093/nar/gkh466</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Identification of transposon-like elements in non-coding regions of tomato ACC oxidase genes</p>
            </title>
            <aug>
               <au>
                  <snm>Blume</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Barry</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Bouzayen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Grierson</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1997</pubdate>
            <volume>254</volume>
            <fpage>297</fpage>
            <lpage>303</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s004380050419</pubid>
                  <pubid idtype="pmpid">9150264</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Stowaway: a new family of inverted repeat elements associated with the genes of both monocotyledonous and dicotyledonous plants</p>
            </title>
            <aug>
               <au>
                  <snm>Bureau</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Wessler</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1994</pubdate>
            <volume>6</volume>
            <fpage>907</fpage>
            <lpage>916</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160488</pubid>
                  <pubid idtype="pmpid" link="fulltext">8061524</pubid>
                  <pubid idtype="doi">10.1105/tpc.6.6.907</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>A recent polyploidy superimposed on older large-scale duplications in the Arabidopsis genome</p>
            </title>
            <aug>
               <au>
                  <snm>Blanc</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Hokamp</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Wolfe</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2003</pubdate>
            <volume>13</volume>
            <fpage>137</fpage>
            <lpage>144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">420368</pubid>
                  <pubid idtype="pmpid" link="fulltext">12566392</pubid>
                  <pubid idtype="doi">10.1101/gr.751803</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events</p>
            </title>
            <aug>
               <au>
                  <snm>Bowers</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Rong</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Paterson</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>422</volume>
            <fpage>433</fpage>
            <lpage>438</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature01521</pubid>
                  <pubid idtype="pmpid" link="fulltext">12660784</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis</p>
            </title>
            <aug>
               <au>
                  <snm>Shiu</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Bleecker</snm>
                  <fnm>AB</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2003</pubdate>
            <volume>132</volume>
            <fpage>530</fpage>
            <lpage>543</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">166995</pubid>
                  <pubid idtype="pmpid" link="fulltext">12805585</pubid>
                  <pubid idtype="doi">10.1104/pp.103.021964</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Does recombination shape the distribution and evolution of tandemly arrayed genes (TAGs) in the Arabidopsis thaliana genome?</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gaut</snm>
                  <fnm>BS</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2003</pubdate>
            <volume>13</volume>
            <fpage>2533</fpage>
            <lpage>2540</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">403795</pubid>
                  <pubid idtype="pmpid" link="fulltext">14656961</pubid>
                  <pubid idtype="doi">10.1101/gr.1318503</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Widespread paleopolyploidy in model plant species inferred from age distributions of duplicate genes</p>
            </title>
            <aug>
               <au>
                  <snm>Blanc</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wolfe</snm>
                  <fnm>KH</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2004</pubdate>
            <volume>16</volume>
            <fpage>1667</fpage>
            <lpage>1678</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">514152</pubid>
                  <pubid idtype="pmpid" link="fulltext">15208399</pubid>
                  <pubid idtype="doi">10.1105/tpc.021345</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Evidence of gene conversion events between paralogous sequences produced by tetraploidization in Salmoninae fish</p>
            </title>
            <aug>
               <au>
                  <snm>Angers</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Gharbi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Estoup</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>2002</pubdate>
            <volume>54</volume>
            <fpage>501</fpage>
            <lpage>510</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00239-001-0041-x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11956688</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Molecular characterization of the rbcS multi-gene family of Petunia (Mitchell)</p>
            </title>
            <aug>
               <au>
                  <snm>Dean</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>van den Elzen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tamaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Black</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dunsmuir</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bedbrook</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1987</pubdate>
            <volume>206</volume>
            <fpage>465</fpage>
            <lpage>474</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00428887</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Evolution of transcription factor binding sites in mammalian gene regulatory regions: conservation and turnover</p>
            </title>
            <aug>
               <au>
                  <snm>Dermitzakis</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2002</pubdate>
            <volume>19</volume>
            <fpage>1114</fpage>
            <lpage>1121</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12082130</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Rapid evolution of cis-regulatory sequences via local point mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Stone</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Wray</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <fpage>1764</fpage>
            <lpage>1770</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11504856</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>The gene family encoding the ribulose-(1,5)-bisphosphate carboxylase/oxygenase (Rubisco) small subunit of potato</p>
            </title>
            <aug>
               <au>
                  <snm>Fritz</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Wolter</snm>
                  <fnm>FP</fnm>
               </au>
               <au>
                  <snm>Schenkemeyer</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Herget</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Schreier</snm>
                  <fnm>PH</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>1993</pubdate>
            <volume>137</volume>
            <fpage>271</fpage>
            <lpage>274</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0378-1119(93)90019-Y</pubid>
                  <pubid idtype="pmpid">8299958</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Developmental, organ-specific, and light-dependent expression of the tomato ribulose-1,5-bisphosphate carboxylase small subunit gene family</p>
            </title>
            <aug>
               <au>
                  <snm>Sugita</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gruissem</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1987</pubdate>
            <volume>84</volume>
            <fpage>7104</fpage>
            <lpage>7108</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">299238</pubid>
                  <pubid idtype="pmpid" link="fulltext">3478683</pubid>
                  <pubid idtype="doi">10.1073/pnas.84.20.7104</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>Preservation of duplicate genes by complementary, degenerative mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Force</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pickett</snm>
                  <fnm>FB</fnm>
               </au>
               <au>
                  <snm>Amores</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Postlethwait</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1999</pubdate>
            <volume>151</volume>
            <fpage>1531</fpage>
            <lpage>1545</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1460548</pubid>
                  <pubid idtype="pmpid" link="fulltext">10101175</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>A new sequence distance measure for phylogenetic tree construction</p>
            </title>
            <aug>
               <au>
                  <snm>Otu</snm>
                  <fnm>HH</fnm>
               </au>
               <au>
                  <snm>Sayood</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>2122</fpage>
            <lpage>2130</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg295</pubid>
                  <pubid idtype="pmpid" link="fulltext">14594718</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>Transformation distances: a family of dissimilarity measures based on movements of segments</p>
            </title>
            <aug>
               <au>
                  <snm>Varr&#233;</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Delahaye</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Rivals</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <fpage>194</fpage>
            <lpage>202</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/15.3.194</pubid>
                  <pubid idtype="pmpid" link="fulltext">10222406</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>An information-based sequence distance and its application to whole mitochondrial genome phylogeny</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Badger</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Kwong</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kearney</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2001</pubdate>
            <volume>17</volume>
            <fpage>149</fpage>
            <lpage>154</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/17.2.149</pubid>
                  <pubid idtype="pmpid" link="fulltext">11238070</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Paralogons in Arabidopsis thaliana</p>
            </title>
            <url>http://wolfe.gen.tcd.ie/athal/dup</url>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Plant cis-acting regulatory DNA elements (PLACE) database: 1999</p>
            </title>
            <aug>
               <au>
                  <snm>Higo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ugawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Iwamoto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Korenaga</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1999</pubdate>
            <volume>27</volume>
            <fpage>297</fpage>
            <lpage>300</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">148163</pubid>
                  <pubid idtype="pmpid" link="fulltext">9847208</pubid>
                  <pubid idtype="doi">10.1093/nar/27.1.297</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B75">
            <title>
               <p>Plant cis-acting regulatory DNA elements (PLACE) database</p>
            </title>
            <url>http://www.dna.affrc.go.jp/PLACE/</url>
         </bibl>
         <bibl id="B76">
            <title>
               <p>Complexity of finite sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Lempel</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ziv</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>IEEE T Inform Theory</source>
            <pubdate>1976</pubdate>
            <volume>22</volume>
            <issue>1</issue>
            <fpage>75</fpage>
            <lpage>81</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1109/TIT.1976.1055501</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B77">
            <title>
               <p>LZcomposer</p>
            </title>
            <url>http://wwwmgs.bionet.nsc.ru/mgs/programs/lzcomposer/complete.html</url>
         </bibl>
         <bibl id="B78">
            <title>
               <p>CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B79">
            <title>
               <p>QAlign: quality-based multiple alignments with dynamic phylogenetic analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Sammeth</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rothg&#228;nger</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Esser</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Albert</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stoye</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Harmsen</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>1592&#8211;1593</fpage>
         </bibl>
         <bibl id="B80">
            <title>
               <p>Unbiased estimation of the rates of synonymous and nonsynonymous substitution</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1993</pubdate>
            <volume>36</volume>
            <fpage>96</fpage>
            <lpage>99</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02407308</pubid>
                  <pubid idtype="pmpid">8433381</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B81">
            <title>
               <p>The R Project for Statistical Computing</p>
            </title>
            <url>http://www.r-project.org/</url>
         </bibl>
         <bibl id="B82">
            <title>
               <p>PAST: paleontological statistics software package for education and data analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Hammer</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Harper</snm>
                  <fnm>DAT</fnm>
               </au>
               <au>
                  <snm>Ryan</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Palaeontologia Electronica</source>
            <pubdate>2001</pubdate>
            <volume>4(1)</volume>
            <fpage>http://palaeo</fpage>
            <lpage>electronica.org</lpage>
         </bibl>
         <bibl id="B83">
            <title>
               <p>An approximately unbiased test of phylogenetic tree selection</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <fpage>492</fpage>
            <lpage>508</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/10635150290069913</pubid>
                  <pubid idtype="pmpid" link="fulltext">12079646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B84">
            <title>
               <p>PAUP*: Phylogenetic Analysis using Parsimony (* and Other Methods). Version 4</p>
            </title>
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <publisher>Sunderland, Massachusetts , Sinauer Associates</publisher>
            <pubdate>1998</pubdate>
            <xrefbib>
               <pubid idtype="pmpid">12064242</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B85">
            <title>
               <p>PHYLIP (Phylogeny Inference Package)</p>
            </title>
            <aug>
               <au>
                  <snm>Felsenstein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <publisher>Seattle , University of Washington</publisher>
            <edition>Version 3.64</edition>
            <pubdate>2004</pubdate>
         </bibl>
         <bibl id="B86">
            <title>
               <p>5'-upstream cis-elements and binding factor(s) potentially involved in light-regulated expression of a Brassica napus rbcS gene</p>
            </title>
            <aug>
               <au>
                  <snm>Fiebig</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Link</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Curr Genet</source>
            <pubdate>1992</pubdate>
            <volume>21</volume>
            <fpage>161</fpage>
            <lpage>168</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00318476</pubid>
                  <pubid idtype="pmpid">1339323</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B87">
            <title>
               <p>Expression dynamics of the pea rbcS multigene family and organ distribution of the transcripts</p>
            </title>
            <aug>
               <au>
                  <snm>Fluhr</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Moses</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Morelli</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Coruzzi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>1986</pubdate>
            <volume>5</volume>
            <fpage>2063</fpage>
            <lpage>2071</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1167083</pubid>
                  <pubid idtype="pmpid">16453702</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B88">
            <title>
               <p>Confirmation of the relative expression levels of the Petunia (Mitchell) rbcS genes</p>
            </title>
            <aug>
               <au>
                  <snm>Dean</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Favreau</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dunsmuir</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bedbrook</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1987</pubdate>
            <volume>15</volume>
            <fpage>4655</fpage>
            <lpage>4668</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">340887</pubid>
                  <pubid idtype="pmpid" link="fulltext">3588304</pubid>
                  <pubid idtype="doi">10.1093/nar/15.11.4655</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B89">
            <title>
               <p>Dissection of 5' upstream sequences for selective expression of the Nicotiana plumbaginifolia rbcS-8B gene</p>
            </title>
            <aug>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1988</pubdate>
            <volume>214</volume>
            <fpage>16</fpage>
            <lpage>23</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00340173</pubid>
                  <pubid idtype="pmpid">3226423</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B90">
            <title>
               <p>Localization and conditional redundancy of regulatory elements in rbcS-3A, a pea gene encoding the small subunit of ribulose-bisphosphate carboxylase</p>
            </title>
            <aug>
               <au>
                  <snm>Kuhlemeier</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cuozzo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Goyvaerts</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1988</pubdate>
            <volume>85</volume>
            <fpage>4662</fpage>
            <lpage>4666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">280495</pubid>
                  <pubid idtype="pmpid" link="fulltext">3387433</pubid>
                  <pubid idtype="doi">10.1073/pnas.85.13.4662</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B91">
            <title>
               <p>Evolutionary rates analysis of Leguminosae implicates a rapid diversification of lineages during the Tertiary</p>
            </title>
            <aug>
               <au>
                  <snm>Lavin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herendeen</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Wojciechowski</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <fpage>530&#8211;549</fpage>
            <xrefbib>
               <pubid idtype="doi">10.1080/10635150590947131</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B92">
            <title>
               <p>Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related genera (Brassicaceae)</p>
            </title>
            <aug>
               <au>
                  <snm>Koch</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Haubold</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mitchell-Olds</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2000</pubdate>
            <volume>17</volume>
            <fpage>1483</fpage>
            <lpage>1498</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11018155</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
