<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2105-9-233</ui>
   <ji>1471-2105</ji>
   <fm>
      <dochead>Software</dochead>
      <bibl>
         <title>
            <p>Triad pattern algorithm for predicting strong promoter candidates in bacterial genomes</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Dekhtyar</snm>
               <fnm>Michael</fnm>
               <insr iid="I1"/>
               <email>Michael.Dekhtyar@tversu.ru</email>
            </au>
            <au id="A2">
               <snm>Morin</snm>
               <fnm>Amelie</fnm>
               <insr iid="I2"/>
               <email>Amelie.Morin@cancer.org.uk</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Sakanyan</snm>
               <fnm>Vehary</fnm>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>Vehary.Sakanyan@univ-nantes.fr</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>University of Tver, 33 Jelyabova, 170000 Tver, Russia</p>
            </ins>
            <ins id="I2">
               <p>Laboratoire de Biotechnologie, UMR CNRS 6204, Universit&#233; de Nantes, 2 rue de la Houssini&#232;re, 44322 Nantes, France</p>
            </ins>
            <ins id="I3">
               <p>ProtNeteomix, 2 rue de la Houssini&#232;re, 44322 Nantes, France</p>
            </ins>
         </insg>
         <source>BMC Bioinformatics</source>
         <issn>1471-2105</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>233</fpage>
         <url>http://www.biomedcentral.com/1471-2105/9/233</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18471287</pubid>
               <pubid idtype="doi">10.1186/1471-2105-9-233</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>19</day>
               <month>11</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>09</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>09</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Dekhtyar et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Bacterial promoters, which increase the efficiency of gene expression, differ from other promoters by several characteristics. This difference, not yet widely exploited in bioinformatics, looks promising for the development of relevant computational tools to search for strong promoters in bacterial genomes.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We describe a new triad pattern algorithm that predicts strong promoter candidates in annotated bacterial genomes by matching specific patterns for the group I &#963;<sup>70 </sup>factors of <it>Escherichia coli </it>RNA polymerase. It detects promoter-specific motifs by consecutively matching three patterns, consisting of an UP-element, required for interaction with the &#945; subunit, and then optimally-separated patterns of -35 and -10 boxes, required for interaction with the &#963;<sup>70 </sup>subunit of RNA polymerase. Analysis of 43 bacterial genomes revealed that the frequency of candidate sequences depends on the A+T content of the DNA under examination. The accuracy of <it>in silico </it>prediction was experimentally validated for the genome of a hyperthermophilic bacterium, <it>Thermotoga maritima</it>, by applying a cell-free expression assay using the predicted strong promoters. In this organism, the strong promoters govern genes for translation, energy metabolism, transport, cell movement, and other as-yet unidentified functions.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The triad pattern algorithm developed for predicting strong bacterial promoters is well suited for analyzing bacterial genomes with an A+T content of less than 62%. This computational tool opens new prospects for investigating global gene expression, and individual strong promoters in bacteria of medical and/or economic significance.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Efficient promoter recognition is crucial in the synthesis of the gene-encoded products required by bacteria to allow them to grow rapidly and to adapt to different environmental conditions. The general architecture and protein-DNA interaction interfaces appear to be conserved in RNA polymerases of different bacteria, to judge by a comparison of the resolved structures of the multi-subunit protein or its subunits <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. This structural information suggests that the principles of DNA recognition by RNA polymerases are universal, and this constitutes a basis for <it>in silico </it>prediction of promoters that are recognized by families of sigma factors. Research in bioinformatics has developed approximate matching methods to detect conserved sequences in nucleic acids <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>, including promoter-specific sequences that are invaluable in helping to elucidate the overall organization of transcriptional signals and regulatory circuits in evolutionarily distant bacteria <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Most promoter prediction programs so far proposed use statistical or motif-based methods, and take into consideration what is known about experimentally defined promoter architectures, and extract conserved sequences from the genomes under analysis. Attempts have been made to improve promoter prediction by introducing statistical mechanical methods to measure the stress-induced destabilization or bendability of the duplex DNA region located upstream of the transcription initiation site required for the local dissociation of strands to start mRNA synthesis <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. The steady increase in the number of sequenced bacterial genomes of medical and economic significance means that there is an increasing need for computational tools to predict promoters, especially those responsible for high-level gene expression in organisms, of which there has been little experimental investigation.</p>
         <p>Many housekeeping genes in <it>Escherichia coli </it>are transcribed from promoters possessing the recognition elements referred to as -35 and -10 sites (boxes), for which the TTGACA and TATAAT consensi, respectively, have been identified by compiling characterized RNA polymerase-binding regions in the DNA <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. The -35 and -10 sites, which are separated from each other by a 15&#8211;20-bp spacer <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, are specifically recognized by E&#963;<sup>70 </sup>RNA polymerase, an RNA polymerase holoenzyme bearing the group I &#963;<sup>70 </sup>factor <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Experimental data have shown that high transcription rates of genes correlate with the level of conservation of three promoter parameters, with the consensus -35 and -10 hexanucleotide boxes, and with the 17 &#177; 1-bp spacer separating them <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. This fact has been widely used to construct vectors for protein overexpression in bacterial cells <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>.</p>
         <p>However, the strength of strong promoters also depends on a fourth parameter, an AT-rich UP element 17&#8211;20 bp length, which is located just upstream of the -35 site, and which is recognized by the &#945; subunit of E&#963;<sup>70 </sup>RNA polymerase, which was first discovered for ribosomal RNA promoters <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. The C-terminal domain of this subunit binds both to the UP element and to transcription regulation proteins, whereas the N-terminal domain makes contact with other subunits during the assembly of RNA polymerase <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. A 17-bp consensus 5'AAAWWTWTTTTNNNAAA (where W is A or T, and N can be any of the four bases) has been identified for the UP element by analyzing the patterns, selected by the SELEX method, which mediate increases of between 10- and 300-fold in gene expression in <it>E. coli </it>cells <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. Two preferred sub-sites have been identified within the UP element. They are centered approximately at the -42 and the -52 positions respectively, and appear to be specifically recognized by one or two monomers of a dimeric &#945; subunit in the RNA polymerase.</p>
         <p>It is noteworthy, that a virtual analysis of patterns located upstream from the consensus -35 had since long time suggested their functional significance <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The sequences reminiscent of UP element have been detected in the <it>E. coli </it>genome by the algorithms PWM <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> and PlatPram <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. A software-based (GCG, version 9.0) dissection of regions located upstream of the <it>E. coli </it>promoters had made it possible to detect putative promoters with &#8804; 4 mismatches in the full UP element consensus <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Several UP elements have also been visually identified, and characterized by their ability to direct high level gene expression <it>in vivo </it>or <it>in vitro </it>in <it>Bacillus subtilis </it><abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, <it>Geobacillus </it>(formerly <it>Bacillus</it>) <it>stearothermophilus </it><abbrgrp><abbr bid="B32">32</abbr></abbrgrp> and <it>Vibrio natrigens </it><abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. Recently, a comparative analysis of E&#963;<sup>70</sup>-specific promoter and non-promoter regions indicated that upstream regions of <it>E. coli </it>ribosomal and T4 phage early promoters possess electrostatic elements that could be responsible for modulating promoter activities due to ADP-ribosylation of RNA polymerase &#945; subunit <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. However, no specific algorithms have yet been proposed to detect strong promoters in bacterial genomes, and so this remains an important task for genomic and proteomic research in microbiology.</p>
         <p>In this study, we have developed a triad pattern algorithm that detects strong promoter candidates composed of a UP-element, and two consensi, -35 and -10 boxes, which are optimally distanced from each other. All four parameters are required for efficient DNA recognition, and the initiation of mRNA synthesis by an E&#963;<sup>70</sup>-like RNA polymerase. The data presented indicate that the frequency of strong promoters is a function of the A+T content of the corresponding genomes. The proposed prediction program is flexible, and can be modified by users to modulate the search stringency criteria depending on the promoter features of the genome under analysis. The accuracy of detection has been experimentally validated for putative strong promoters predicted in a hyperthermophilic bacterium <it>Thermotoga maritima</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Implementation</p>
         </st>
         <sec>
            <st>
               <p>Overview of the approach</p>
            </st>
            <p>The promoter activity in cells is determined by regulatory proteins (activators and repressors) that can recognize overlapping sequences specific for E&#963;<sup>70 </sup>RNA polymerase sites, and thereby mask the true promoter strength. In addition, almost 20% of <it>E. coli </it>RNA polymerase E&#963;<sup>70</sup>-specific promoters possess an extended -10 sequence that might compensate for the absence of a clear -35 site <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Different prediction programs based on statistical and motif-searching approaches have been developed to detect a variety of binding sites in DNA, and both position-specific weight matrices <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> and hidden Markov models <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> have been used to improve the accuracy of the prediction of promoter sequences in bacterial genomes <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. These programs usually detect hexanucleotide dyad patterns of RNA polymerase-promoter binding sites, such as -35 and -10 boxes, and none of them is free of false-positives, which correspond to similar, non-promoter sequences in bacterial genomes [for a review, see <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>].</p>
            <p>In this study, we exploited the strengths of the "triad pattern" approach to develop an algorithm able to detect strong promoters by matching three nucleotide sequences recognized by the &#963;<sup>70 </sup>and &#945; subunits of bacterial RNA polymerase. Theoretically, the presence of a UP element may not be essential for relatively strong promoter activity if two -35 and -10 boxes are well conserved and optimally distanced. Similarly, the presence of a well conserved UP element may compensate for a poor -35 box in some promoters. However, it seems very likely that the strongest promoters probably possess all three essential sequences. The specific interaction between the UP element and the &#945; subunit significantly amplifies the association of RNA polymerase with promoter DNA <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. Therefore, to improve the filter to exclude possible false-positive due to short hexanucleotide similar sequences scattered throughout the genome, our algorithm starts by first matching the UP element, and only then identifying the -35 and -10 boxes located further downstream.</p>
         </sec>
         <sec>
            <st>
               <p>Design of the triad pattern algorithm</p>
            </st>
            <p>We designed an algorithm able to detect the triad nucleotide patterns in bacterial genomes. The core of the algorithm is the FIND_TRIAD procedure, which given an input nucleotide string, <it>s</it>, returns the substring <it>s' </it>of <it>s</it>, which is the best approximation of a given triad pattern of the form <it>(pat(1),L1)-(l1,l2)-(pat(2),L2)-(d1,d2)-(pat(3),L3)</it>, where each <it>pat(i), i = 1,2,3</it>, is a nucleotide string, <it>Li </it>is its length, <it>l1 </it>and <it>l2 </it>are the minimum and maximum distances respectively between the first and the second patterns, and <it>d1 </it>and <it>d2 </it>are the minimum and maximum distances respectively between the second and the third patterns. To avoid making a "bad" approximation, three scores <it>Sc1, Sc2 </it>and <it>Sc3 </it>are used as input parameters for the procedure. The resulting substring, <it>s'</it>, can then be represented as (s<it>pat(1),Ls1)-ls1-(spat(2),Ls2)-ls2- (spat(3),Ls3)</it>, where each <it>spat(i), i = 1,2,3</it>, is a substring of <it>s </it>aligned to <it>pat(i)</it>, <it>Lsi </it>is its length, <it>ls1 </it>is the distance between s<it>pat(1) </it>and s<it>pat(2)</it>, and <it>ls2 </it>is the distance between s<it>pat(2) </it>and s<it>pat(3)</it>. This result for <it>s' </it>satisfies the following conditions:</p>
            <p>(1) for each <it>i = 1,2,3 </it>the similarity score (weight) <it>Wi </it>of the match or alignment of <it>pat(i) </it>and <it>spat(i) </it>is not less than <it>Sci </it>(or the number of "mismatches" does not exceed <it>(Li - Sci)</it>);</p>
            <p>(2) <it>(l1 &#8804; ls1 &#8804; l2)</it> and <it>(d1 &#8804; ls2 &#8804; d2)</it>.</p>
            <p>For each of the three patterns, one can either forbid insertions/deletions or allow them. In the former case, <it>Lsi = Li </it>and the weight = <it>W</it>i are computed as the sum of matching pairwise symbols, whereas in the latter case, the difference |<it>Lsi - Li</it>| between <it>spat(i) </it>and <it>pat(i) </it>is bounded by a value <it>Ri </it>for the permissible deletions/insertions (gaps), an optimum alignment, and its weight, <it>Wi</it>, are computed by the standard dynamic programming method for global string alignment <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. In both cases, a symbol scoring matrix <it>Mi(x,j) </it>is used to define the weight of the symbol <it>x </it>in the position <it>j, 1 &#8804; j &#8804; Lsi</it>, of <it>spat(i)</it>. If symbol <it>x </it>occurs in position <it>j </it>of <it>pat(i)</it>, then <it>Mi(x,j) = 1</it>, otherwise <it>Mi(x,j) &#8804; 1</it>. To choose the best approximation of the triad pattern from substrings satisfying conditions (i) and (ii), FIND_TRIAD uses a total score function with the form:</p>
            <p>
               <display-formula id="M1"><it>tot_sc = C1*nsc1(L1,W1)+D12*nsc_dist12(11,l2,ls1) + C2*nsc2(L2,W2) + D23*nsc_dist23(d1,d2,ls2) + C3*nsc3(L3,W3)</it>,</display-formula>
            </p>
            <p>where <it>nsci(Li,Wi), i = 1,2,3</it>, are normalized scores of matching (alignments) of <it>pat(i) </it>and <it>spat(i), 0 &#8804; nsci(Li,Wi) &#8804; 1</it>, and <it>nsc_dist12(11,l2,ls1) </it>and <it>nsc_dist23(d1,d2,ls2) </it>are the normalized scores of the distances between the first and the second, and the second and the third patterns, respectively, and <it>0 &#8804; nsc_dist12(11,l2,ls1), nsc_dist23(d1d2,ls2) &#8804; 1</it>. The linear coefficients <it>C1, C2, C3, D12</it>, and <it>D13 </it>are chosen so that their sum is equal to 1. They indicate the relative importance of the corresponding sub-patterns of the triads; and the distances between them. So, the best value of <it>tot_sc </it>is 1.</p>
         </sec>
         <sec>
            <st>
               <p>Application of the algorithm to searching for strong promoter candidates</p>
            </st>
            <p>Here we describe the main parameters of the FIND_TRIAD procedure used to detect strong promoter candidates in bacterial genomes. In this study, a bacterial promoter is assumed to be a nucleotide sequence, located upstream from genes encoding proteins, tRNAs or rRNAs that could be recognized by an RNA polymerase holoenzyme containing a major &#963; factor (using <it>E. coli </it>E&#963;<sup>70 </sup>RNAP as the reference). The triad patterns defined for strong promoter candidates include three specific nucleotide sub-regions: (i), a UP element, which is a 17-nt prefix of the strong promoter, and has the following consensus pattern: <it>pat(1) </it>= <b><it>P<sub>UP </sub></it></b>= <it>aaaWWtWttttNNNaaa</it>; (ii) the -35 site, which is located downstream of the UP element, and has the pattern <it>pat(2) </it>= <b><it>P<sub>35 </sub></it></b>= <it>tc<ul>ttgaca</ul>t </it>(underlining indicates a commonly used consensus for group I &#963;<sup>70 </sup>factors; however, the &#963;<sub>4 </sub>domain of these factors appears to be in contact with 9 nucleotides in the region extending from -30 to -38 <abbrgrp><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>); (iii) the -10 site, which is located downstream of the -35 site, and has the pattern <it>pat(3) </it>= <b><it>P<sub>10 </sub></it></b>= <it>tataat </it>(this site is highly conserved). We used the following boundaries for the distances between the sub-regions: l1 = 0, l2 = 5 (these boundaries were extracted from the examples of UP-elements in <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>), d1 = 14, d2 = 20 (these boundaries are standard for the distance between the -35 site and the -10 site). To search for the first pattern <it>pat(1) </it>of the UP-element, the simple matching algorithm was chosen with an <it>a </it>and <it>t </it>mismatch score of 0.5. The reason is that in the full UP-element consensus and the consensuses of two of its subsides &#8211; distal and proximal &#8211; in some places do not distinguish between <it>a </it>and <it>t</it>. We assumed that the consensus for the -35 site of length 9 is less conserved than that of the -10 site, and so in order to detect the second pattern <it>pat(2</it>) of the -35 site we used a dynamic programming algorithm to search for optimal alignment, with boundaries for the number of permissible deletions/insertions of <it>R2 = 2</it>. For the most of -35 sites, which were detected by algorithm, no insertions/deletions were applied. However, this scoring system allowed us to identify some stronger promoter candidates. Thus, the insertion of C between two AA in the sequence TCTTGAAT of TM1016, increases the score of a putative promoter (see below). The -10 site is better conserved, and so we used the straightforward matching algorithm to detect this site.</p>
            <p>To define the total score function, <it>tot_sc </it>(formula 1), we chose the following normalized scores for the three patterns and for the distance between the -35 site and -10 site (no information was available about the best values for the distance between the UP element and the -35 site):</p>
            <p>
               <display-formula id="M2"><b><it>nsc1(17,W1) </it></b>= <it>nsc_up = 1 - (17 - W1)/20</it>,</display-formula>
            </p>
            <p>
               <display-formula id="M3"><b><it>nsc2(9,W2) </it></b>= <it>nsc_35 = 1 - (9 - W2)/10</it>,</display-formula>
            </p>
            <p>
               <display-formula id="M4"><b><it>nsc3(6,W3) </it></b>= <it>nsc_10 = 1 - (6 - W3)</it><sup>2</sup><it>/10</it>,</display-formula>
            </p>
            <p>and the values of the normalized distance score, <it>nsc_dist23(14,20,ls2) = nsc_dist</it>, are defined as follows:</p>
            <p>
               <display-formula>
                  <m:math name="1471-2105-9-233-i1" xmlns:m="http://www.w3.org/1998/Math/MathML">
                     <m:semantics>
                        <m:mrow>
                           <m:mtable columnalign="left">
                              <m:mtr columnalign="left">
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mi>l</m:mi>
                                       <m:mi>s</m:mi>
                                       <m:mn>2</m:mn>
                                       <m:mo>:</m:mo>
                                       <m:mtext>distance&#160;between&#160;the&#160;-35&#160;and&#160;-10&#160;sites,&#160;nt</m:mtext>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>17</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>16</m:mn>
                                       <m:mo>,</m:mo>
                                       <m:mn>18</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>15</m:mn>
                                       <m:mo>,</m:mo>
                                       <m:mn>19</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>14</m:mn>
                                       <m:mo>,</m:mo>
                                       <m:mn>20</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                              </m:mtr>
                              <m:mtr columnalign="left">
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mi>n</m:mi>
                                       <m:mi>s</m:mi>
                                       <m:mi>c</m:mi>
                                       <m:mo>_</m:mo>
                                       <m:mi>d</m:mi>
                                       <m:mi>i</m:mi>
                                       <m:mi>s</m:mi>
                                       <m:mi>t</m:mi>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mn>1</m:mn>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>0.95</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>0.85</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                                 <m:mtd columnalign="left">
                                    <m:mrow>
                                       <m:mn>0.7</m:mn>
                                    </m:mrow>
                                 </m:mtd>
                              </m:mtr>
                           </m:mtable>
                        </m:mrow>
                        <m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xI8qiVKYPFjYdHaVhbbf9v8qqaqFr0xc9vqFj0dXdbba91qpepeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaqbaeaabiqbeaaabaGaemiBaWMaem4CamNaeGOmaiJaeiOoaOJaeeizaqMaeeyAaKMaee4CamNaeeiDaqNaeeyyaeMaeeOBa4Maee4yamMaeeyzauMaeeiiaaIaeeOyaiMaeeyzauMaeeiDaqNaee4DaCNaeeyzauMaeeyzauMaeeOBa4MaeeiiaaIaeeiDaqNaeeiAaGMaeeyzauMaeeiiaaIaeeyla0Iaee4mamJaeeynauJaeeiiaaIaeeyyaeMaeeOBa4MaeeizaqMaeeiiaaIaeeyla0IaeeymaeJaeeimaaJaeeiiaaIaee4CamNaeeyAaKMaeeiDaqNaeeyzauMaee4CamNaeeilaWIaeeiiaaIaeeOBa4MaeeiDaqhabaGaeGymaeJaeG4naCdabaGaeGymaeJaeGOnayJaeiilaWIaeGymaeJaeGioaGdabaGaeGymaeJaeGynauJaeiilaWIaeGymaeJaeGyoaKdabaGaeGymaeJaeGinaqJaeiilaWIaeGOmaiJaeGimaadabaGaemOBa4Maem4CamNaem4yamMaei4xa8LaemizaqMaemyAaKMaem4CamNaemiDaqhabaGaeGymaedabaGaeGimaaJaeiOla4IaeGyoaKJaeGynaudabaGaeGimaaJaeiOla4IaeGioaGJaeGynaudabaGaeGimaaJaeiOla4IaeG4naCdaaaaa@892E@</m:annotation>
                     </m:semantics>
                  </m:math>
               </display-formula>
            </p>
            <p>We also chose linear coefficients <it>C1 = 0.3, C2 = C3 = 0.25, D12 = 0, and D23 = 0.2</it>. These coefficients indicate the relative importance of corresponding sub-regions for evaluating the total score of a candidate sequence. They were chosen empirically, after preliminary tests with several annotated genomes, assuming a higher significance of the UP element, equal significance of the -10 and -35 boxes, and lower significance of the distance between them. In this application, the value <it>D12 = 0 </it>means that we ignore the variations of the distance between a putative UP element and -35 box because <it>a priory </it>it is not known what value is the best in the interval 0&#8211;5 nt.</p>
            <p>Formulas 2, 3 and 4 reflect the lack of exact matching for the different sub-regions. If the -10 box is highly conserved and is essential for initiation of transcription <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, then the penalty for its mismatches is higher than for those of the other parameters. For example, for 2 mismatches, the penalty is <it>(6 - 4)<sup>2</sup>/10 = 0.4 </it>for the -10 site, whereas it is <it>(9 - 7)/10 = 0.2 </it>for the -35 site, and <it>(17 - 15)/20 = 0.1 </it>for the UP element. The choice of the normalized score functions in equations 2, 3 and 4 is based on empirical observations, and on common sense, and may seem to be arbitrary. We want to stress that, in fact, the total score function <it>tot_sc </it>also has a further role: it does not significantly change the set of the best candidates identified by the algorithm. This set is defined by the three score bounds <it>Sc1 = scup </it>for UP element, <it>Sc2 = sc35 </it>for -35 site, and <it>Sc3 = sc10 </it>for -10 site. The total score affects only the ordering of these candidates amongst themselves.</p>
            <p>The general scheme of the algorithm is as follows. It has the following input: (i) the name of a genome file in GenBank format; (ii) three parameters of scores: <it>scup, sc35 </it>and <it>sc10</it>, determining the minimum acceptable similarity between candidate sequences of the UP element, the -35 box, and the -10 box, respectively, and the <it>E. coli </it>consensus patterns. For each gene in the genome input file that is not inside an operon, the algorithm runs in two steps:</p>
            <p>(i) it extracts a 300-bp DNA region, <it>s</it>, upstream of the annotated coding sequences for tRNA, rRNA or proteins (we limited the search to 300 bp, since most <it>E. coli </it>promoters fall within this length inter-gene space <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B45">45</abbr></abbrgrp>);</p>
            <p>(ii) then it uses the FIND_TRIAD procedure to identify the best strong promoter candidate within <it>s </it>that satisfies conditions (1) and (2) above. If such a candidate is found, it is added to the output list of strong promoters.</p>
            <p>We recommend to read attentively the "ReadMe" information [see Additional file <supplr sid="S1">1</supplr>] before to start proceeding the "strong_promoters.doc" software [see Additional file <supplr sid="S2">2</supplr>]. The algorithm is implemented by a program that produces the results in two forms: (i) a Text-format table which lists all strong promoter candidates in a genome, and provides additional information about the operon organization of genes located downstream (for example, see Fig. <figr fid="F1">1</figr>); (ii) a Word-format table which lists strong promoter candidate sequences. A 20-nt sequence preceding a possible initiation codon of each ORF is also included in the annotation, as this could be useful for the visual examination of the translation signals of the corresponding genes. Lastly, the user can select a convenient score for each sequence-specific motif taking into consideration the promoter features of the annotated genome if they differ from the <it>E. coli</it>-specific patterns used to create the algorithm (for example, a weakly conserved -35 or -10 box).</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>ReadMe. Contains information to use the algorithm.</p>
               </text>
               <file name="1471-2105-9-233-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>Software "strong_promoters.doc". The Text-format provides the list of putative strong promoter sequences with total and individual scores obtained for each consensus. The Word-format provides the tabulated list of putative strong promoters and their total score.</p>
               </text>
               <file name="1471-2105-9-233-S2.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Text-format presentation of strong promoter candidates</p>
               </caption>
               <text>
                  <p>
                     <b>Text-format presentation of strong promoter candidates.</b>
                  </p>
               </text>
               <graphic file="1471-2105-9-233-1"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Construction of recombinant linear DNAs</p>
            </st>
            <p>Putative promoter regions in the <it>T. maritima </it>genome, identified by the algorithm described above, were amplified by PCR using appropriate oligonucleotide primers connected to the previously-described <it>G. stearothermophilus argC </it>gene <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. This reporter gene encodes <it>N</it>-acetyl glutamylphosphate reductase, a thermostable and soluble protein that is easily detectable after exposing <it>E. coli </it>cleared lysates to 65&#176;C. In order to increase protein yield, the ribosome-binding site of <it>G. stearothermophilus argC </it>was modified to the sequence <ul>GGAGG</ul>GGGAACAT<ul>ATG</ul> (the modified Shine-Dalgarno site and the initiation codon are underlined), and the distance between the -10 promoter site and the Shine-Dalgarno site was shortened to 15 bp (Fig. <figr fid="F2">2</figr>). The DNA fragment carrying the <it>argC </it>gene was connected to <it>T. maritima </it>or control promoters by two consecutive PCR steps, as described previously <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. The quantity and quality of the amplified DNAs were determined with a 2100 Bioanalyzer (Agilent Technologies).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Diagram of the fusion DNA constructs used to express the <it>G. stearothermophilus argC</it>-reporter gene from putative strong promoters of <it>T. maritima </it>in a cell-free system</p>
               </caption>
               <text>
                  <p><b>Diagram of the fusion DNA constructs used to express the <it>G. stearothermophilus argC</it>-reporter gene from putative strong promoters of <it>T. maritima </it>in a cell-free system</b>. The <it>argC </it>gene was amplified with forward 5'-GGAGGGGGAACATATGATGAA and reverse 5'-GGACCACCGCGCTACTGCCG primers from pHAV2 [32] by conserving a 112-bp downstream region carrying transcriptional terminators of the vector DNA.</p>
               </text>
               <graphic file="1471-2105-9-233-2"/>
            </fig>
            <p>Two well-characterized strong promoters, P<it>tac </it>and P<it>argC</it>, were used as references to compare the strength of the putative promoters of <it>T. maritima</it>. The strong promoter P<it>tac </it>contains an AT-rich nucleotide sequence upstream of a -35 site <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>, which has no defined UP element; it was obtained from the vector pBTac2 (purchased from Boehringer Mannheim). P<it>argC</it>, a strong promoter of <it>G. stearothermophilus</it>, contains the UP element, as demonstrated both <it>in vivo </it>and <it>in vitro</it>, and was amplified from the plasmid pHAV2 <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Cell-free protein synthesis</p>
            </st>
            <p>PCR-generated linear DNA fragments carrying a promoter region fused to the <it>argC </it>reporter gene were used to evaluate the promoter strength in a coupled transcription-translation system, as described previously <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. The cell-free extracts were prepared from the <it>E. coli </it>strain BL21 (DE3) Star <it>recBCD </it>(our laboratory construction) as described by Pratt <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Protein synthesis was carried in the presence of pyruvate oxidase to generate ATP <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Typically, 50 ng of PCR-amplified DNA was added to a pre-mix containing all necessary compounds and 10 &#956;Ci of [&#945;<sup>35</sup>S]-L-methionine (specific activity 1000 Ci/mmol, 37 TBq/mmol, Amersham-Pharmacia Biotech), and <it>E. coli </it>S30 cell-free extracts. The reaction mixture was incubated at 37&#176;C for 90 min, and heated to 65&#176;C for 10 min. After centrifuging, the supernatant was precipitated with acetone, and then protein samples were separated by SDS-PAGE and bound to 3 MM paper. The ArgC protein synthesized <it>in vitro </it>was quantified by counting the radioactivity of the corresponding band with a PhosphorImager 445 SI (Molecular Dynamics).</p>
            <p>The bacterial genome sequences were extracted from available data banks. The logo of <it>T. maritima </it>promoter consensus sequences was generated at the WebLogo site as described in <abbrgrp><abbr bid="B52">52</abbr><abbr bid="B53">53</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>The number of strong promoters reflects the A+T content of bacterial genomes</p>
            </st>
            <p>In our algorithm, 26 of the 32 symbols used to evaluate matches in the three promoter-specific patterns, namely in the UP element and the -35 and -10 boxes, are <it>a </it>and <it>t</it>. One could expect the number of genes transcribed from potential strong promoters to depend on the A+T content of a given genome. To find out whether this is indeed the case, we compared the frequency of candidates in 300-bp regions located upstream of genes of annotated bacterial genomes and in random sequences of the same regions generated by computing. First, we calculated the (A+T)% in all 300-bp regions preceding each gene or operon in the annotated genomes (Table <tblr tid="T1">1</tblr>). The A+T content in these DNA regions was found to be slightly higher than that of the entire genomes of almost all bacteria that have been analyzed. Next, we generated 10.000 random sequences with the same A+T content for all the 300-bp regions of each genome. The algorithm was applied to detect strong promoter candidates in the 300-bp real genomic and random-generated regions of 43 bacterial genomes.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>A+T content of bacterial genomes and 300-bp regions located upstream of genes and the percentage of strong promoter candidates predicted in 300-bp real genomic and random-generated regions of the same content.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>(A+T)% of</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>% of candidates in</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>N&#176;</p>
                     </c>
                     <c ca="left">
                        <p>Genome</p>
                     </c>
                     <c ca="left">
                        <p>Bacterial genomes*</p>
                     </c>
                     <c ca="left">
                        <p>300-bp genomic regions</p>
                     </c>
                     <c ca="left">
                        <p>300-bp genomic regions</p>
                     </c>
                     <c ca="left">
                        <p>300-bp random sequences</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p><it>Deinococcus radiodurans </it>R1 (AE000513)</p>
                     </c>
                     <c ca="left">
                        <p>32.99</p>
                     </c>
                     <c ca="left">
                        <p>34.19</p>
                     </c>
                     <c ca="left">
                        <p>0.19</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p><it>Caulobacter crescentus </it>(AE005673)</p>
                     </c>
                     <c ca="left">
                        <p>32.77</p>
                     </c>
                     <c ca="left">
                        <p>34.40</p>
                     </c>
                     <c ca="left">
                        <p>0.05</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p><it>Ralstonia solanacearum </it>GMI1000 (AL646052)</p>
                     </c>
                     <c ca="left">
                        <p>34.51</p>
                     </c>
                     <c ca="left">
                        <p>34.50</p>
                     </c>
                     <c ca="left">
                        <p>0.20</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p><it>Pseudomonas aeruginosa </it>PA01 (AE004091)</p>
                     </c>
                     <c ca="left">
                        <p>33.44</p>
                     </c>
                     <c ca="left">
                        <p>35.38</p>
                     </c>
                     <c ca="left">
                        <p>0.27</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p><it>Xanthomonas campestris pv. campestris </it>(AE008922)</p>
                     </c>
                     <c ca="left">
                        <p>34.93</p>
                     </c>
                     <c ca="left">
                        <p>35.64</p>
                     </c>
                     <c ca="left">
                        <p>0.05</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycobacterium tuberculosis </it>(AL123456)</p>
                     </c>
                     <c ca="left">
                        <p>34.39</p>
                     </c>
                     <c ca="left">
                        <p>35.69</p>
                     </c>
                     <c ca="left">
                        <p>0.18</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p><it>Xanthomonas axonopodis pv. citri </it>306 (AE008923)</p>
                     </c>
                     <c ca="left">
                        <p>35.23</p>
                     </c>
                     <c ca="left">
                        <p>36.02</p>
                     </c>
                     <c ca="left">
                        <p>0.05</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p><it>Mesorhizobium loti </it>(NC002678)</p>
                     </c>
                     <c ca="left">
                        <p>37.25</p>
                     </c>
                     <c ca="left">
                        <p>39.09</p>
                     </c>
                     <c ca="left">
                        <p>0.13</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p><it>Sinorhizobium meliloti </it>1021 (AL591688)</p>
                     </c>
                     <c ca="left">
                        <p>37.27</p>
                     </c>
                     <c ca="left">
                        <p>39.66</p>
                     </c>
                     <c ca="left">
                        <p>0.24</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycobacterium leprae </it>TN (AL450380)</p>
                     </c>
                     <c ca="left">
                        <p>42.20</p>
                     </c>
                     <c ca="left">
                        <p>43.14</p>
                     </c>
                     <c ca="left">
                        <p>0.29</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p><it>Agrobacterium tumefaciens </it>C58 (AE007869)</p>
                     </c>
                     <c ca="left">
                        <p>45.64</p>
                     </c>
                     <c ca="left">
                        <p>43.20</p>
                     </c>
                     <c ca="left">
                        <p>0.74</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p><it>Brucella melitensis </it>16 M chromosome I (AE008917)</p>
                     </c>
                     <c ca="left">
                        <p>42.84</p>
                     </c>
                     <c ca="left">
                        <p>45.73</p>
                     </c>
                     <c ca="left">
                        <p>1.02</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p><it>Treponema pallidum </it>(AE000520)</p>
                     </c>
                     <c ca="left">
                        <p>47.22</p>
                     </c>
                     <c ca="left">
                        <p>47.01</p>
                     </c>
                     <c ca="left">
                        <p>0.37</p>
                     </c>
                     <c ca="left">
                        <p>0.3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlorobium tepidum </it>TLS (AE006470)</p>
                     </c>
                     <c ca="left">
                        <p>43.47</p>
                     </c>
                     <c ca="left">
                        <p>47.50</p>
                     </c>
                     <c ca="left">
                        <p>1.50</p>
                     </c>
                     <c ca="left">
                        <p>0.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p><it>Salmonella typhimurium </it>LT2 (AE006468)</p>
                     </c>
                     <c ca="left">
                        <p>47.78</p>
                     </c>
                     <c ca="left">
                        <p>51.08</p>
                     </c>
                     <c ca="left">
                        <p>3.54</p>
                     </c>
                     <c ca="left">
                        <p>0.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p><it>Neisseria meningitidis </it>serogroup B MC58 (AE002098)</p>
                     </c>
                     <c ca="left">
                        <p>48.47</p>
                     </c>
                     <c ca="left">
                        <p>52.20</p>
                     </c>
                     <c ca="left">
                        <p>5.03</p>
                     </c>
                     <c ca="left">
                        <p>0.93</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p><it>Escherichia coli </it>O157:H7 (AE005174)**</p>
                     </c>
                     <c ca="left">
                        <p>49.50</p>
                     </c>
                     <c ca="left">
                        <p>52.54</p>
                     </c>
                     <c ca="left">
                        <p>4.80</p>
                     </c>
                     <c ca="left">
                        <p>1.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p><it>Methanobacterium thermoautotrophicum </it>&#916;H (AE000666)</p>
                     </c>
                     <c ca="left">
                        <p>50.46</p>
                     </c>
                     <c ca="left">
                        <p>53.11</p>
                     </c>
                     <c ca="left">
                        <p>4.26</p>
                     </c>
                     <c ca="left">
                        <p>1.23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p><it>Synechocystis </it>PCC6803 (AB001339)</p>
                     </c>
                     <c ca="left">
                        <p>52.28</p>
                     </c>
                     <c ca="left">
                        <p>53.71</p>
                     </c>
                     <c ca="left">
                        <p>2.89</p>
                     </c>
                     <c ca="left">
                        <p>1.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p><it>Thermotoga maritima </it>(AE000512)</p>
                     </c>
                     <c ca="left">
                        <p>53.75</p>
                     </c>
                     <c ca="left">
                        <p>54.66</p>
                     </c>
                     <c ca="left">
                        <p>3.27</p>
                     </c>
                     <c ca="left">
                        <p>2.15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p><it>Vibrio cholerae </it>chromosome I (AE003852)</p>
                     </c>
                     <c ca="left">
                        <p>52.30</p>
                     </c>
                     <c ca="left">
                        <p>54.94</p>
                     </c>
                     <c ca="left">
                        <p>3.22</p>
                     </c>
                     <c ca="left">
                        <p>2.4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p><it>Yersinia pestis </it>CO92 (AL590842)</p>
                     </c>
                     <c ca="left">
                        <p>52.36</p>
                     </c>
                     <c ca="left">
                        <p>55.77</p>
                     </c>
                     <c ca="left">
                        <p>6.78</p>
                     </c>
                     <c ca="left">
                        <p>3.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p><it>Aquifex aeolicus </it>(AE000657)</p>
                     </c>
                     <c ca="left">
                        <p>57.73</p>
                     </c>
                     <c ca="left">
                        <p>57.70</p>
                     </c>
                     <c ca="left">
                        <p>4.72</p>
                     </c>
                     <c ca="left">
                        <p>4.15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p><it>Bacillus halodurans </it>C-125 (BA000004)</p>
                     </c>
                     <c ca="left">
                        <p>56.31</p>
                     </c>
                     <c ca="left">
                        <p>58.65</p>
                     </c>
                     <c ca="left">
                        <p>8.70</p>
                     </c>
                     <c ca="left">
                        <p>5.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p><it>Bacillus subtilis </it>(AL009126)</p>
                     </c>
                     <c ca="left">
                        <p>56.48</p>
                     </c>
                     <c ca="left">
                        <p>59.30</p>
                     </c>
                     <c ca="left">
                        <p>10.28</p>
                     </c>
                     <c ca="left">
                        <p>5.8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycoplasma pneumoniae </it>M129 (U00089)</p>
                     </c>
                     <c ca="left">
                        <p>59.99</p>
                     </c>
                     <c ca="left">
                        <p>61.71</p>
                     </c>
                     <c ca="left">
                        <p>5.25</p>
                     </c>
                     <c ca="left">
                        <p>9.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlamydia muridarum </it>(AE002160)</p>
                     </c>
                     <c ca="left">
                        <p>59.69</p>
                     </c>
                     <c ca="left">
                        <p>61.73</p>
                     </c>
                     <c ca="left">
                        <p>9.01</p>
                     </c>
                     <c ca="left">
                        <p>9.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p><it>Pasteurella multocida </it>PM70 (AE004439)</p>
                     </c>
                     <c ca="left">
                        <p>59.60</p>
                     </c>
                     <c ca="left">
                        <p>62.31</p>
                     </c>
                     <c ca="left">
                        <p>11.42</p>
                     </c>
                     <c ca="left">
                        <p>10.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlamydophila pneumoniae </it>J138 (BA000008)</p>
                     </c>
                     <c ca="left">
                        <p>59.42</p>
                     </c>
                     <c ca="left">
                        <p>62.80</p>
                     </c>
                     <c ca="left">
                        <p>14.77</p>
                     </c>
                     <c ca="left">
                        <p>12.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p><it>Streptococcus pneumoniae </it>(AE005672)</p>
                     </c>
                     <c ca="left">
                        <p>60.30</p>
                     </c>
                     <c ca="left">
                        <p>62.88</p>
                     </c>
                     <c ca="left">
                        <p>15.83</p>
                     </c>
                     <c ca="left">
                        <p>13.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p><it>Streptococcus pyogenes </it>SF370 serotype M1 (AE004092)</p>
                     </c>
                     <c ca="left">
                        <p>61.49</p>
                     </c>
                     <c ca="left">
                        <p>63.99</p>
                     </c>
                     <c ca="left">
                        <p>16.87</p>
                     </c>
                     <c ca="left">
                        <p>14.3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p><it>Thermoanaerobacter tengcongensis </it>MB4T (AE008691)</p>
                     </c>
                     <c ca="left">
                        <p>62.43</p>
                     </c>
                     <c ca="left">
                        <p>64.11</p>
                     </c>
                     <c ca="left">
                        <p>17.74</p>
                     </c>
                     <c ca="left">
                        <p>14.8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p><it>Listeria innocua </it>Clip11262 (AL592022)</p>
                     </c>
                     <c ca="left">
                        <p>62.56</p>
                     </c>
                     <c ca="left">
                        <p>64.30</p>
                     </c>
                     <c ca="left">
                        <p>12.07</p>
                     </c>
                     <c ca="left">
                        <p>15.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p><it>Haemophilus influenzae </it>Rd (L42023)</p>
                     </c>
                     <c ca="left">
                        <p>61.85</p>
                     </c>
                     <c ca="left">
                        <p>64.45</p>
                     </c>
                     <c ca="left">
                        <p>15.61</p>
                     </c>
                     <c ca="left">
                        <p>16.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycoplasma genitalium </it>G37 (L43967)</p>
                     </c>
                     <c ca="left">
                        <p>68.31</p>
                     </c>
                     <c ca="left">
                        <p>69.50</p>
                     </c>
                     <c ca="left">
                        <p>15.99</p>
                     </c>
                     <c ca="left">
                        <p>35.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>36</p>
                     </c>
                     <c ca="left">
                        <p><it>Staphylococcus aureus </it>N315 (BA000018)</p>
                     </c>
                     <c ca="left">
                        <p>67.16</p>
                     </c>
                     <c ca="left">
                        <p>69.71</p>
                     </c>
                     <c ca="left">
                        <p>35.25</p>
                     </c>
                     <c ca="left">
                        <p>36.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>37</p>
                     </c>
                     <c ca="left">
                        <p><it>Campylobacter jejuni </it>(AL111168)</p>
                     </c>
                     <c ca="left">
                        <p>69.45</p>
                     </c>
                     <c ca="left">
                        <p>71.36</p>
                     </c>
                     <c ca="left">
                        <p>32.07</p>
                     </c>
                     <c ca="left">
                        <p>41.8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p><it>Clostridium acetobutylicum </it>(AE001437)</p>
                     </c>
                     <c ca="left">
                        <p>69.07</p>
                     </c>
                     <c ca="left">
                        <p>71.83</p>
                     </c>
                     <c ca="left">
                        <p>45.08</p>
                     </c>
                     <c ca="left">
                        <p>44.2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>39</p>
                     </c>
                     <c ca="left">
                        <p><it>Borrelia burgdorferi</it>.(AE000783)</p>
                     </c>
                     <c ca="left">
                        <p>71.40</p>
                     </c>
                     <c ca="left">
                        <p>73.18</p>
                     </c>
                     <c ca="left">
                        <p>40.00</p>
                     </c>
                     <c ca="left">
                        <p>54.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>40</p>
                     </c>
                     <c ca="left">
                        <p><it>Rickettsia prowazekii </it>Madrid E (AJ235269)</p>
                     </c>
                     <c ca="left">
                        <p>71.00</p>
                     </c>
                     <c ca="left">
                        <p>73.26</p>
                     </c>
                     <c ca="left">
                        <p>50.06</p>
                     </c>
                     <c ca="left">
                        <p>55.2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>41</p>
                     </c>
                     <c ca="left">
                        <p><it>Clostridium perfringens </it>13 (BA000016)</p>
                     </c>
                     <c ca="left">
                        <p>71.43</p>
                     </c>
                     <c ca="left">
                        <p>74.74</p>
                     </c>
                     <c ca="left">
                        <p>53.94</p>
                     </c>
                     <c ca="left">
                        <p>58.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>42</p>
                     </c>
                     <c ca="left">
                        <p><it>Ureaplasma urealyticum </it>(AF222894)</p>
                     </c>
                     <c ca="left">
                        <p>74.50</p>
                     </c>
                     <c ca="left">
                        <p>76.05</p>
                     </c>
                     <c ca="left">
                        <p>50.85</p>
                     </c>
                     <c ca="left">
                        <p>65.35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>43</p>
                     </c>
                     <c ca="left">
                        <p><it>Buchnera aphidicola Sg </it>(AE013218)</p>
                     </c>
                     <c ca="left">
                        <p>74.67</p>
                     </c>
                     <c ca="left">
                        <p>78.36</p>
                     </c>
                     <c ca="left">
                        <p>58.05</p>
                     </c>
                     <c ca="left">
                        <p>74.5</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* A+T content of bacterial genomes was calculated from corresponding genomic DNA sequences available in gene banks.</p>
                  <p>** Similar values were found for the <it>E. coli </it>K12 genome.</p>
               </tblfn>
            </tbl>
            <p>We tested different matching stringencies and empirically found that the score parameters <it>sUP </it>= 13, <it>s35 </it>= 5.5 and <it>s10 </it>= 4.5 satisfied the criteria required for scaled comparative analysis without grossly exaggerating the number of candidate sequences identified in the various genomes. This analysis revealed that the real genomes with an A+T content of less than 50% contained many more potential strong promoters than their simulated counterparts (see Table <tblr tid="T1">1</tblr>). The percentage of candidate sequences was very low in the bacterial genomes with an A+T content of between 33% and 47%, and these sequences were completely absent in the corresponding 300-bp, random-generated sequences. When the A+T content increased from 47% to 78%, the percentage of strong promoter candidates increased dramatically, whereas the difference between the real and random sequences decreased, and virtually disappeared when the A+T content exceeded 62%. There were two exceptions where the genomes analyzed did not display this pattern at an A+T content of less than 62%. One was <it>M. pneumoniae</it>, the genome of which had an A+T content of about 60%, and in which the promoters had no -35 consensus <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>. The other example is the hyperthermophilic species <it>A. aeolicus </it>(~58% AT-rich genome). This species is very close to the Archaea, and occupies a unique position in the bacterial kingdom <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>.</p>
            <p>Our data show that the number N(A+T) of strong promoter candidates in 300-bp random-generated sequences corresponding to upstream regions of bacterial genes satisfies the "exponential low" of the form N(A+T) = exp [c<sub>1 </sub>(A+T) + c<sub>2</sub>]. The distribution of strong promoter candidates in real genomes indicates that the critical point of the A+T content is close to 62% (Fig. <figr fid="F3">3</figr>). Above this level, the number of random sequences reminiscent of strong promoter patterns increases markedly.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>The number of strong promoter candidate sequences is a function of the A+T content of bacterial genomes</p>
               </caption>
               <text>
                  <p><b>The number of strong promoter candidate sequences is a function of the A+T content of bacterial genomes</b>. For the score parameters <it>sUp </it>= 13, <it>s35 </it>= 5.5, <it>s10 </it>= 4.5 and constants c<sub>1 </sub>= 0.22 and c<sub>2 </sub>= -11.7, the picture displays a linear graph of the "exponential low" (thin line), which approximates fairly closely to the curve ln [N(A+T)], shown as a thick line. The logarithm of the percentage of strong promoter candidates in real genomes is shown by (&#9675;).</p>
               </text>
               <graphic file="1471-2105-9-233-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Strong promoter candidate sequences are located upstream of gene-coding regions</p>
            </st>
            <p>Another important aspect of the quality of detection is the location of candidate sequences with regard to coding regions in the genome analyzed. We compared the frequencies of strong promoter-like patterns identified upstream and downstream of the initiation codon in all the genomes. The frequency of candidate sequences was clearly greater in the upstream region of ORFs in most of the genomes with an A+T content of less than 62% (Table <tblr tid="T2">2</tblr>). No difference was detected in <it>T. pallidum </it>(~47% AT-rich genome), which belongs to a distinct phylum of Spirochetes that appear to use different DNA patterns for the promotion and regulation of transcription <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Number of sequences reminiscent of strong promoters in regions located upstream and downstream of the initiation codon of genes in bacterial genomes.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>N&#176;</p>
                     </c>
                     <c ca="left">
                        <p>Genome</p>
                     </c>
                     <c ca="center">
                        <p>Length, bp</p>
                     </c>
                     <c ca="center">
                        <p>Number of genes</p>
                     </c>
                     <c ca="center">
                        <p>Upstream region</p>
                     </c>
                     <c ca="center">
                        <p>Downstream region</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p><it>Deinococcus radiodurans </it>R1 (AE000513)</p>
                     </c>
                     <c ca="center">
                        <p>2648638</p>
                     </c>
                     <c ca="center">
                        <p>2681</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p><it>Caulobacter crescentus </it>(AE005673)</p>
                     </c>
                     <c ca="center">
                        <p>4016947</p>
                     </c>
                     <c ca="center">
                        <p>3787</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p><it>Ralstonia solanacearum </it>GMI1000 (AL646052)</p>
                     </c>
                     <c ca="center">
                        <p>3716413</p>
                     </c>
                     <c ca="center">
                        <p>3477</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p><it>Pseudomonas aeruginosa </it>PA01 (AE004091)</p>
                     </c>
                     <c ca="center">
                        <p>6264403</p>
                     </c>
                     <c ca="center">
                        <p>5570</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p><it>Xanthomonas campestris pv. campestris </it>(AE008922)</p>
                     </c>
                     <c ca="center">
                        <p>5076188</p>
                     </c>
                     <c ca="center">
                        <p>4197</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycobacterium tuberculosis </it>(AL123456)</p>
                     </c>
                     <c ca="center">
                        <p>4411529</p>
                     </c>
                     <c ca="center">
                        <p>3922</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p><it>Xanthomonas axonopodis pv. citri </it>306 (AE008923)</p>
                     </c>
                     <c ca="center">
                        <p>5175554</p>
                     </c>
                     <c ca="center">
                        <p>4344</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p><it>Mesorhizobium loti </it>(NC 002678)</p>
                     </c>
                     <c ca="center">
                        <p>7036074</p>
                     </c>
                     <c ca="center">
                        <p>6693</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p><it>Sinorhizobium meliloti </it>1021 (AL591688)</p>
                     </c>
                     <c ca="center">
                        <p>3654135</p>
                     </c>
                     <c ca="center">
                        <p>3375</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycobacterium leprae </it>TN (AL450380)</p>
                     </c>
                     <c ca="center">
                        <p>3268203</p>
                     </c>
                     <c ca="center">
                        <p>2770</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p><it>Agrobacterium tumefaciens </it>C58 (AE007869)</p>
                     </c>
                     <c ca="center">
                        <p>2841581</p>
                     </c>
                     <c ca="center">
                        <p>2701</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p><it>Brucella melitensis </it>16 M chromosome I (AE008917)</p>
                     </c>
                     <c ca="center">
                        <p>2117144</p>
                     </c>
                     <c ca="center">
                        <p>2059</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p><it>Treponema pallidum </it>(AE000520)</p>
                     </c>
                     <c ca="center">
                        <p>1138011</p>
                     </c>
                     <c ca="center">
                        <p>1083</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlorobium tepidum </it>TLS (AE006470)</p>
                     </c>
                     <c ca="center">
                        <p>2154946</p>
                     </c>
                     <c ca="center">
                        <p>2329</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p><it>Salmonella typhimurium </it>LT2 (AE006468)</p>
                     </c>
                     <c ca="center">
                        <p>4857432</p>
                     </c>
                     <c ca="center">
                        <p>4608</p>
                     </c>
                     <c ca="center">
                        <p>163</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p><it>Neisseria meningitidis serogroup B </it>MC58 (AE002098)</p>
                     </c>
                     <c ca="center">
                        <p>2272351</p>
                     </c>
                     <c ca="center">
                        <p>2226</p>
                     </c>
                     <c ca="center">
                        <p>112</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p><it>Escherichia coli </it>O157:H7 (AE005174)</p>
                     </c>
                     <c ca="center">
                        <p>5528445</p>
                     </c>
                     <c ca="center">
                        <p>5478</p>
                     </c>
                     <c ca="center">
                        <p>263</p>
                     </c>
                     <c ca="center">
                        <p>79</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p><it>Methanobacterium thermoautotrophicum </it>delta H (AE000666)</p>
                     </c>
                     <c ca="center">
                        <p>1751377</p>
                     </c>
                     <c ca="center">
                        <p>1900</p>
                     </c>
                     <c ca="center">
                        <p>81</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p><it>Synechocystis </it>PCC6803 (AB001339)</p>
                     </c>
                     <c ca="center">
                        <p>3573470</p>
                     </c>
                     <c ca="center">
                        <p>1074</p>
                     </c>
                     <c ca="center">
                        <p>31</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p><it>Thermotoga maritima </it>(AE000512)</p>
                     </c>
                     <c ca="center">
                        <p>1860725</p>
                     </c>
                     <c ca="center">
                        <p>1926</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p><it>Vibrio cholerae </it>chromosome I (AE003852)</p>
                     </c>
                     <c ca="center">
                        <p>2961149</p>
                     </c>
                     <c ca="center">
                        <p>2887</p>
                     </c>
                     <c ca="center">
                        <p>93</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p><it>Yersinia pestis </it>CO92 (AL590842)</p>
                     </c>
                     <c ca="center">
                        <p>4653728</p>
                     </c>
                     <c ca="center">
                        <p>4042</p>
                     </c>
                     <c ca="center">
                        <p>274</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p><it>Aquifex aeolicus </it>(AE000657)</p>
                     </c>
                     <c ca="center">
                        <p>1551335</p>
                     </c>
                     <c ca="center">
                        <p>1503</p>
                     </c>
                     <c ca="center">
                        <p>71</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p><it>Bacillus halodurans </it>C-125 (BA000004)</p>
                     </c>
                     <c ca="center">
                        <p>4202353</p>
                     </c>
                     <c ca="center">
                        <p>4125</p>
                     </c>
                     <c ca="center">
                        <p>359</p>
                     </c>
                     <c ca="center">
                        <p>87</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p><it>Bacillus subtilis </it>(AL009126)</p>
                     </c>
                     <c ca="center">
                        <p>4214814</p>
                     </c>
                     <c ca="center">
                        <p>4182</p>
                     </c>
                     <c ca="center">
                        <p>430</p>
                     </c>
                     <c ca="center">
                        <p>111</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycoplasma pneumoniae </it>M129 (U00089)</p>
                     </c>
                     <c ca="center">
                        <p>816394</p>
                     </c>
                     <c ca="center">
                        <p>705</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlamydia muridarum </it>(AE002160)</p>
                     </c>
                     <c ca="center">
                        <p>1069411</p>
                     </c>
                     <c ca="center">
                        <p>954</p>
                     </c>
                     <c ca="center">
                        <p>86</p>
                     </c>
                     <c ca="center">
                        <p>31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p><it>Pasteurella multocida </it>PM70 (AE004439)</p>
                     </c>
                     <c ca="center">
                        <p>2257487</p>
                     </c>
                     <c ca="center">
                        <p>1996</p>
                     </c>
                     <c ca="center">
                        <p>228</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p><it>Chlamydophila pneumoniae </it>J138 (BA000008)</p>
                     </c>
                     <c ca="center">
                        <p>1226565</p>
                     </c>
                     <c ca="center">
                        <p>1097</p>
                     </c>
                     <c ca="center">
                        <p>162</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p><it>Streptococcus pneumoniae </it>(AE005672)</p>
                     </c>
                     <c ca="center">
                        <p>2160837</p>
                     </c>
                     <c ca="center">
                        <p>2306</p>
                     </c>
                     <c ca="center">
                        <p>365</p>
                     </c>
                     <c ca="center">
                        <p>156</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p><it>Streptococcus pyogenes </it>SF370 serotype M1 (AE004092)</p>
                     </c>
                     <c ca="center">
                        <p>1852441</p>
                     </c>
                     <c ca="center">
                        <p>1731</p>
                     </c>
                     <c ca="center">
                        <p>292</p>
                     </c>
                     <c ca="center">
                        <p>115</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p><it>Thermoanaerobacter tengcongensis </it>MB4T (AE008691)</p>
                     </c>
                     <c ca="center">
                        <p>2689445</p>
                     </c>
                     <c ca="center">
                        <p>2632</p>
                     </c>
                     <c ca="center">
                        <p>467</p>
                     </c>
                     <c ca="center">
                        <p>248</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="left">
                        <p><it>Listeria innocua </it>Clip11262 (AL592022)</p>
                     </c>
                     <c ca="center">
                        <p>3011208</p>
                     </c>
                     <c ca="center">
                        <p>3529</p>
                     </c>
                     <c ca="center">
                        <p>426</p>
                     </c>
                     <c ca="center">
                        <p>229</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c ca="left">
                        <p><it>Haemophilus influenzae </it>Rd (L42023)</p>
                     </c>
                     <c ca="center">
                        <p>1830138</p>
                     </c>
                     <c ca="center">
                        <p>1775</p>
                     </c>
                     <c ca="center">
                        <p>277</p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p><it>Mycoplasma genitalium </it>G37 (L43967)</p>
                     </c>
                     <c ca="center">
                        <p>580074</p>
                     </c>
                     <c ca="center">
                        <p>519</p>
                     </c>
                     <c ca="center">
                        <p>83</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>36</p>
                     </c>
                     <c ca="left">
                        <p><it>Staphylococcus aureus </it>N315 (BA000018)</p>
                     </c>
                     <c ca="center">
                        <p>2814816</p>
                     </c>
                     <c ca="center">
                        <p>2638</p>
                     </c>
                     <c ca="center">
                        <p>930</p>
                     </c>
                     <c ca="center">
                        <p>418</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>37</p>
                     </c>
                     <c ca="left">
                        <p><it>Campylobacter jejuni </it>(AL111168)</p>
                     </c>
                     <c ca="center">
                        <p>1641481</p>
                     </c>
                     <c ca="center">
                        <p>1684</p>
                     </c>
                     <c ca="center">
                        <p>540</p>
                     </c>
                     <c ca="center">
                        <p>353</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p><it>Clostridium acetobutylicum </it>(AE001473)</p>
                     </c>
                     <c ca="center">
                        <p>3940880</p>
                     </c>
                     <c ca="center">
                        <p>3738</p>
                     </c>
                     <c ca="center">
                        <p>1685</p>
                     </c>
                     <c ca="center">
                        <p>916</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="left">
                        <p><it>Borrelia burgdorferi </it>(AE000783)</p>
                     </c>
                     <c ca="center">
                        <p>910724</p>
                     </c>
                     <c ca="center">
                        <p>875</p>
                     </c>
                     <c ca="center">
                        <p>350</p>
                     </c>
                     <c ca="center">
                        <p>292</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>40</p>
                     </c>
                     <c ca="left">
                        <p><it>Rickettsia prowazekii </it>Madrid E (AJ235269)</p>
                     </c>
                     <c ca="center">
                        <p>1111523</p>
                     </c>
                     <c ca="center">
                        <p>885</p>
                     </c>
                     <c ca="center">
                        <p>443</p>
                     </c>
                     <c ca="center">
                        <p>252</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>41</p>
                     </c>
                     <c ca="left">
                        <p><it>Clostridium perfringens </it>13 (BA000016)</p>
                     </c>
                     <c ca="center">
                        <p>3031430</p>
                     </c>
                     <c ca="center">
                        <p>2779</p>
                     </c>
                     <c ca="center">
                        <p>1499</p>
                     </c>
                     <c ca="center">
                        <p>772</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>42</p>
                     </c>
                     <c ca="left">
                        <p><it>Ureaplasma urealyticum </it>(AF222894)</p>
                     </c>
                     <c ca="center">
                        <p>751719</p>
                     </c>
                     <c ca="center">
                        <p>645</p>
                     </c>
                     <c ca="center">
                        <p>328</p>
                     </c>
                     <c ca="center">
                        <p>236</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="left">
                        <p><it>Buchnera aphidicola Sg </it>(AE013218)</p>
                     </c>
                     <c ca="center">
                        <p>641454</p>
                     </c>
                     <c ca="center">
                        <p>584</p>
                     </c>
                     <c ca="center">
                        <p>339</p>
                     </c>
                     <c ca="center">
                        <p>225</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>The fact that more candidate sequences were identified upstream of ORFs highlights the fact that they are not randomly distributed in bacterial genomes, which suggests that the detection of strong promoter candidates in genomes with an A+T content of less than 62% is fairly reliable.</p>
         </sec>
         <sec>
            <st>
               <p>Experimental validation of virtual prediction: analysis of putative strong promoters of <it>T. maritima</it></p>
            </st>
            <p>Taking our cue from the results of the virtual prediction, we sought to find out whether, and if so, to what extent the putative promoters are functional in a biological context. To do this we used reporter-gene technology, which relies on the fusion of an assayable sequence with a promoter being investigated, and the subsequent evaluation of promoter strength in a cell-free system (see Fig. <figr fid="F2">2</figr>). The genome of the hyperthermophilic bacterium <it>T. maritima </it><abbrgrp><abbr bid="B57">57</abbr></abbrgrp> was used to evaluate the feasibility of the algorithm experimentally.</p>
            <p>63 candidate sequences were detected in the <it>T. maritima </it>genome using the matching scores described above. We increased the penalty for mismatching of -35 and -10 boxes by raising the scores of <it>s35 </it>and <it>s10 </it>to 6 and 5, respectively. This reduced the number of candidate sequences to 34 (Table <tblr tid="T3">3</tblr>). In this shorter list, 28 <it>T. maritima </it>strong promoter candidates possessed a total score higher than the 0.8475 calculated for the reference strong promoter, P<it>tac</it>, that does not have a typical UP element <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. 15 of these candidates had a total score higher than 0.8775, as estimated for P<it>argC</it>, another reference strong promoter that has a well defined UP element <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B49">49</abbr></abbrgrp>. It is worth mentioning that 6 candidate DNA regions in <it>T. maritima </it>had a total score higher than 0.91, a value estimated for <it>E. coli </it>promoters that govern the transcription of 16S ribosomal RNA, and which were used as models for studying the stimulating effect of the UP element on gene expression <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Strong promoter candidates identified in <it>T. maritima </it>MSB8*.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Downstream located gene(s)**</p>
                     </c>
                     <c ca="left">
                        <p>Strong promoter candidate sequence***</p>
                     </c>
                     <c ca="left">
                        <p>Total score****</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0013</p>
                        <p>conserved hypothetical protein</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>ACAATTTTTATCTGATATTTTTTTCACAttcaccatagtcgatTATAAC</p>
                        <p>&lt;--- 97 bp --->aatctggaggtgacaatATG</p>
                     </c>
                     <c ca="left">
                        <p>0,8475</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0110</p>
                        <p>transcriptional regulator, XylR-related</p>
                        <p>Operon: 6 genes</p>
                     </c>
                     <c ca="left">
                        <p>ACCTTGATTTTAAATTATTTCCTGCATataattaatgtgaaCATAAT</p>
                        <p>&lt;--- 10 bp --->aaaaggaggaatcgaagTTG</p>
                     </c>
                     <c ca="left">
                        <p>0,805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0280</p>
                        <p>hypothetical protein</p>
                        <p>Operon: 6 genes</p>
                     </c>
                     <c ca="left">
                        <p>GCAATATTTGTCCAGAAATATACTTGATTtaacaaaaatggacaatgTAGAAT</p>
                        <p>&lt;--- 37 bp --->aaggaggaatatcgtttATG</p>
                     </c>
                     <c ca="left">
                        <p>0,88</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0339</p>
                        <p>hypothetical protein</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>AGAAAAATTTTTTTGGAGACTTGACAaaatatttggtaatattcTAAAAT</p>
                        <p>&lt;--- 5 bp --->gcaggaggtgacaaaatATG</p>
                     </c>
                     <c ca="left">
                        <p>0,8975</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0373</p>
                        <p>dnaK protein</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>TTTTACAAATTCTCATACGACCCCTTGACAtcccattctgtgcctcacTATAAT</p>
                        <p>&lt;--- 21 bp --->tctaaggaggtgacacaATG</p>
                     </c>
                     <c ca="left">
                        <p>0,94</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0657</p>
                        <p>rubrerythrin</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>TAATGTAACTATTCAAAATCATTACAgtttataattatgtggTAAAAT</p>
                        <p>&lt;--- 22 bp --->atagggaggtgcagggtATG</p>
                     </c>
                     <c ca="left">
                        <p>0,8125</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0682</p>
                        <p>hypothetical protein</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>GAATACTCTGTCAGAAAGATTCGTGATCAtcttttcacctcgtgtagTATAAT</p>
                        <p>&lt;--- 7 bp --->gagtattcttctacacaATG</p>
                     </c>
                     <c ca="left">
                        <p>0,915</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1016</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>TAAAAATTTCATGAAAAATTTCTTGAATtctgtgaccaaaagggTTTAAT</p>
                        <p>&lt;--- 5 bp --->gccggaggtgatgtgagATG</p>
                     </c>
                     <c ca="left">
                        <p>0,9175</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1167</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>GAAAAGTTACAGAAAAAGTACCCTTGTTAtctgaaggtgaaaaatggTAAAAT</p>
                        <p>&lt;--- 61 bp --->tacagggagggcgggagATG</p>
                     </c>
                     <c ca="left">
                        <p>0,865</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t27</p>
                        <p>tRNA-Asn</p>
                     </c>
                     <c ca="left">
                        <p>TCATTCATTTTACCATCGAGTCCACTTGAAAttcaggaaggtatgtagTACAAT</p>
                        <p>&lt;--- 0 bp --->tatccgtggaggttcc</p>
                     </c>
                     <c ca="left">
                        <p>0,8675</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1205</p>
                        <p>conserved hypothetical protein</p>
                        <p>Operon: 13 genes</p>
                     </c>
                     <c ca="left">
                        <p>GTTTTTTATCTCTACTAATTAGGTTGACAttattgattcagaagagTAAAAT</p>
                        <p>&lt;--- 40 bp --->ccgaggaggtgtgatgaGTG</p>
                     </c>
                     <c ca="left">
                        <p>0,88</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1318</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>AGAAACAATTTTGGAATTTGATCCATGGACAttattacctttaatgGATAAT</p>
                        <p>&lt;--- 0 bp --->tttaacggaggATG</p>
                     </c>
                     <c ca="left">
                        <p>0,8325</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t34</p>
                        <p>tRNA-Leu</p>
                     </c>
                     <c ca="left">
                        <p>AGAAAAATTTCCGATGAGGGTACTTGAAAagggtgaaaacctgtgcTATTAT</p>
                        <p>&lt;--- 0 bp --->atatgtcggagttgcc</p>
                     </c>
                     <c ca="left">
                        <p>0,855</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1429</p>
                        <p>glycerol uptake facilitator protein</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>GCATTGTGATTTTTGTAACTATATTGACAtaaaacaaaaggtttgtTATAAT</p>
                        <p>&lt;--- 107 bp --->caaggaggattgggaaaATG</p>
                     </c>
                     <c ca="left">
                        <p>0,9175</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t39</p>
                        <p>tRNA-Ala</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>AAAAATAAAAAGTCCTTCTGGGGATTGACCatatttcgtactcatgcTATAAT</p>
                        <p>&lt;--- 50 bp --->taatataaagacgaggtggg</p>
                     </c>
                     <c ca="left">
                        <p>0,8725</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1667</p>
                        <p>xylose isomerase</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>AAGTATATCCTAAAAAAATATTTGAAAtgataccccaagattttaTATAAT</p>
                        <p>&lt;--- 16 bp --->tttagggaggtgtttacATG</p>
                     </c>
                     <c ca="left">
                        <p>0,905</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1780</p>
                        <p>argininosuccinate synthase</p>
                        <p>Operon: 6 genes</p>
                     </c>
                     <c ca="left">
                        <p>GAAAATAACAGTGAAAAAACACTTCATAtaaatcatttcaaataatccTATAAT</p>
                        <p>&lt;--- 15 bp --->aaagaggagggttcatcATG</p>
                     </c>
                     <c ca="left">
                        <p>0,875</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0150 (complem.)</p>
                        <p>ribosomal protein L32</p>
                        <p>Operon: 5 genes</p>
                     </c>
                     <c ca="left">
                        <p>AAAAATGTAAAAGAAGAGAAACTTGAATctttgaaaaacatcaTATACT</p>
                        <p>&lt;--- 210 bp --->acgaggaggtataaaagATG</p>
                     </c>
                     <c ca="left">
                        <p>0,855</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0477 (complem.)</p>
                        <p>outer membrane protein alpha</p>
                     </c>
                     <c ca="left">
                        <p>ACAAAAAAACTTTAGAAAACTCTTGAATttcctttggacgggatggTATAAT</p>
                        <p>&lt;--- 28 bp --->gaagggaggtttgtcccATG</p>
                     </c>
                     <c ca="left">
                        <p>0,9425</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0625 (complem.)</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>ATATTCGTTCTGAATGAAGGTTTTACATttcatccaaattattttggtTATAGT</p>
                        <p>&lt;--- 152 bp --->attggaggcaaatagaaATG</p>
                     </c>
                     <c ca="left">
                        <p>0,805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0656 (complem.)</p>
                        <p>conserved hypothetical protein</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>AACTTAAGTAACACAAAATTAACCTTGACAacgaaaggggggtgggTATAAT</p>
                        <p>&lt;--- 42 bp --->aaggggttgggaactttGTG</p>
                     </c>
                     <c ca="left">
                        <p>0,8925</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0755 (complem.)</p>
                        <p>conserved hypothetical protein</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>AGAAATTCTTTGAAAACTATCTAGAATtcaaacgtcgcttttccagTATACT</p>
                        <p>&lt;--- 101 bp --->aatggaggtgtctctgtATG</p>
                     </c>
                     <c ca="left">
                        <p>0,85</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0971 (complem.)</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>AAATATAAATCTGAATTTACTAAATTCACAtttagcaaatcatcattTATAAT</p>
                        <p>&lt;--- 10 bp --->aggaatctcaagggggaATG</p>
                     </c>
                     <c ca="left">
                        <p>0,895</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1015 (complem.)</p>
                        <p>glutamate dehydrogenase</p>
                     </c>
                     <c ca="left">
                        <p>ATAATTTTTGCAATTTTATCTCTATACAtctcacatcacctccggctaTATATT</p>
                        <p>&lt;--- 104 bp --->ttcgaggggggaaatgtATG</p>
                     </c>
                     <c ca="left">
                        <p>0,855</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1067 (complem.)</p>
                        <p>oligopeptide ABC transporter, periplasmic</p>
                     </c>
                     <c ca="left">
                        <p>GGATTATTTTATACTGAAAGCCCTTGACCttgttgtatgtttgttgaTATTAT</p>
                        <p>&lt;--- 45 bp --->ataacgcagggggtggtATG</p>
                     </c>
                     <c ca="left">
                        <p>0,92</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1271 (complem.)</p>
                        <p>type IV pilin-related protein</p>
                     </c>
                     <c ca="left">
                        <p>GGGTGATATTTCAACATTAAAATCTTGACAttctaccatgtcaaggtgTATAAT</p>
                        <p>&lt;--- 35 bp --->cccgggaggtggattttATG</p>
                     </c>
                     <c ca="left">
                        <p>0,9525</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1286 (complem.)</p>
                        <p>5-methyltetrahydropteroyltriglutamate...</p>
                     </c>
                     <c ca="left">
                        <p>GTTTATGCAAATTTTCCTTCTGTTAACCAtgttacacacaacatgtggTATCAT</p>
                        <p>&lt;--- 19 bp --->aatggaggtgaaaagggTTG</p>
                     </c>
                     <c ca="left">
                        <p>0,8625</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t31 (complem.)</p>
                        <p>tRNA-Leu</p>
                     </c>
                     <c ca="left">
                        <p>AAGTTTTGATTTTTGTAAGGTTGAAAtaatctttctgacgatgtggTATAAT</p>
                        <p>&lt;--- 0 bp --->aaaaaaaggagcc</p>
                     </c>
                     <c ca="left">
                        <p>0,86</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1412 (complem.)</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>ATATGGAAGTTCAAAAAACATCTTGCTTtcagagtgtgtttgtggTATAAA</p>
                        <p>&lt;--- 24 bp --->aataattccttagaggtATG</p>
                     </c>
                     <c ca="left">
                        <p>0,865</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1419 (complem.)</p>
                        <p>myo-inositol-1-phosphate synthase-...</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>AGAAAACTATTGGTAAAGCACTTGAAAtatatgactgtaaaaacgtgaTATAAT</p>
                        <p>&lt;--- 61 bp --->ctaaggaggtgaaacatATG</p>
                     </c>
                     <c ca="left">
                        <p>0,87</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1439 (complem.)</p>
                        <p>hypothetical protein</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>TAGTATTCTACCCTAAACTCTTTCAttctggattcgataatTGTAAT</p>
                        <p>&lt;--- 222 bp --->tgagagtgaaaaaggccATG</p>
                     </c>
                     <c ca="left">
                        <p>0,835</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t45 (complem.)</p>
                        <p>tRNA-Ser</p>
                     </c>
                     <c ca="left">
                        <p>AAAAGAAGGAAGAAAAATGAAAACTTGAACaaggaaacgattgagtgTATAAT</p>
                        <p>&lt;--- 1 bp --->tttttctggtgtggagagga</p>
                     </c>
                     <c ca="left">
                        <p>0,865</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1786 (complem.)</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>GTATTATTCATTCTAAAAACTTGAAActgaccaaataaagtatTAGAAT</p>
                        <p>&lt;--- 44 bp --->cacaagggggtgttttcATG</p>
                     </c>
                     <c ca="left">
                        <p>0,855</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1850 (complem.)</p>
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>AAACGATTCTTCTAAAATGTGTTCTTGATTtgtatcactgttatgtTATAAA</p>
                        <p>&lt;--- 43 bp --->aaaaaggaggtgaaactATG</p>
                     </c>
                     <c ca="left">
                        <p>0,855</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_t11</p>
                        <p>tRNA-Thr</p>
                        <p>Operon: 2 genes</p>
                     </c>
                     <c ca="left">
                        <p>GAAAAGGGTTATCAGGAAATATCTTGAATagaaaaggttcgtgtgtTAAAAT</p>
                        <p>&lt;--- 0 bp --->aaccacagaggcgagca</p>
                     </c>
                     <c ca="left">
                        <p>0,8825</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_1272</p>
                        <p>glutamyl tRNA-Gln amidotransferase...</p>
                        <p>Operon: 3 genes</p>
                     </c>
                     <c ca="left">
                        <p>TTTCACATTTTGCATTATACACCTTGACAtggtagaatgtcaagatTTTAAT</p>
                        <p>&lt;--- 99 bp --->ataatccacgagaggagGTG</p>
                     </c>
                     <c ca="left">
                        <p>0,8975</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TM_0032 (complem.)</p>
                        <p>transcriptional regulator, XylR-related</p>
                        <p>Operon: 1 genes</p>
                     </c>
                     <c ca="left">
                        <p>AATATTAGAATTTGAACTATA