Source
Name:European Bioinformatics Institute
pubmed14681455
psi-miMI:0469
postalAddressWellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom
urlhttp://www.ebi.ac.uk

AvailabilityList

ExperimentList
Experiment #2
Name:hobson-2001-1
Description:Oligomeric structures of poliovirus polymerase are important for function.
pubmed11230138
intactEBI-914159 (hobson-2001-1)
Host Organism: in vitro
Interaction detection method:
Name:filter binding (Filter overlay assay)
psi-miMI:0049
pubmed7708014
Participant identification method:
Name:predetermined: predetermined participant
psi-miMI:0396
pubmed7940758
pubmed14755292
author-listHobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-emailscott.hobson@cellzome.de
publication-year2001
exp-modificationRNA binding was evaluated using a nitrocellulose filter binding assay. The amount of radiolabelled RNA bound to each membrane was quantified using a PhosphorImager
journalEMBO J. (0261-4189)
data-processingResidues renumbered to match full-length polyprotein for this virus.
Experiment #25
Name:hobson-2001-2
Description:Oligomeric structures of poliovirus polymerase are important for function.
pubmed11230138
intactEBI-914232 (hobson-2001-2)
Host Organism: in vitro
Interaction detection method:
Name:rna rna pol assay: rna directed rna polymerase assay
psi-miMI:0700
pubmed14755292
Participant identification method:
Name:predetermined: predetermined participant
psi-miMI:0396
pubmed7940758
pubmed14755292
author-listHobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-emailscott.hobson@cellzome.de
publication-year2001
exp-modificationElongation assays evaluated using radiolabelled RNA as a substrate. Elongated products were separated by PAGE and visualised using a PhosphoImager
journalEMBO J. (0261-4189)
data-processingResidues renumbered to match full-length polyprotein for this virus.
Experiment #41
Name:hobson-2001-3
Description:Oligomeric structures of poliovirus polymerase are important for function.
pubmed11230138
intactEBI-914360 (hobson-2001-3)
Host Organism: in vitro
Interaction detection method:
Name:crosslink: cross-linking study
psi-miMI:0030
pubmed14755292
Participant identification method:
Name:predetermined: predetermined participant
psi-miMI:0396
pubmed7940758
pubmed14755292
author-listHobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-emailscott.hobson@cellzome.de
publication-year2001
journalEMBO J. (0261-4189)
exp-modification2mM dithiothreotol added to reaction mixture, this was increased to 50mM for reducing conditions. Proteins seperated by SDS-PAGE and visualised by Coomassie staining
data-processingResidues renumbered to match full-length polyprotein for this virus.

InteractorList
Interactor #12
Name:ggcagcugcaugcagcugcc: 5' -3' RNA synthesized for use in PMID: 11230138
intactEBI-914168 (ggcagcugcaugcagcugcc)
Interactor Type:
Name:rna: ribonucleic acid (RNA)
psi-miMI:0320
pubmed14755292
soSO:0000356
Organism: in vitro
Sequence:GGCAGCUGCA UGCAGCUGCC
Interactor #15
Name:ccgucgacguacgucgac-2: 3'-5' RNA strand synthesised for use in PMID: 11230138
intactEBI-944576 (ccgucgacguacgucgac-2)
Interactor Type:
Name:rna: ribonucleic acid (RNA)
psi-miMI:0320
pubmed14755292
soSO:0000356
Organism: in vitro
Sequence:CGUCGACGUA CGUCGACGGC GCGG
Interactor #23
Name:ggcgcggcagcugcaugcag: 5'-3' RNA synthesized for use in PMID: 11230138
intactEBI-914181 (ggcgcggcagcugcaugcag)
Interactor Type:
Name:rna: ribonucleic acid (RNA)
psi-miMI:0320
pubmed14755292
soSO:0000356
Organism: in vitro
Sequence:GGCGCGGCAG CUGCAUGCAG CUGCC
Interactor #27
Name:zinc 2plus: zinc(2+)
chebiCHEBI:29105
intactEBI-968340 (zinc 2plus)
Interactor Type:
Name:small molecule
psi-miMI:0328
pubmed14755292
Interactor #4
Name:ccgucgacguacgucgacgg: 3' - 5' RNA strand synthesised for use in PMID: 11230138
intactEBI-944574 (ccgucgacguacgucgacgg)
Interactor Type:
Name:rna: ribonucleic acid (RNA)
psi-miMI:0320
pubmed14755292
soSO:0000356
Organism: in vitro
Sequence:CCGUCGACGU ACGUCGACGG
Interactor #6
Name:p03300-pro_000004009: Poliovirus type 1 (strain Mahoney) RNA-directed RNA polymerase
uniprotkbP03300-PRO_0000040090
refseqNP_740478.2
intactEBI-914162 (p03300-pro_000004009)
Interactor Type:
Name:peptide (oligopeptide) (polypeptide)
psi-miMI:0327
pubmed14755292
Organism: pol1m: Poliovirus type 1 (strain Mahoney)
no-uniprot-updateAn amino acid sequence which is not represented in UniProt

InteractionList
Interaction #1
Name:polg-rna-1: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intactEBI-914164 (polg-rna-1)
goGO:0003725 (double-stranded RNA binding)
Experiments: hobson-2001-1
Participant #3
ccgucgacguacgucgacgg
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:prey
psi-miMI:0498
pubmed14755292
Participant #5
p03300-pro_000004009
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:bait
psi-miMI:0496
pubmed14755292
Feature #7mutation decreasing (leu2089ala) [ 2089 .. 2089 ]
Feature #8mutation decreasing (asp2096arg) [ 2096 .. 2096 ]
Feature #9mutation decreasing (arg2202asp) [ 2202 .. 2202 ]
Feature #10mutation decreasing (arg2203asp) [ 2203 .. 2203 ]
Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #11
ggcagcugcaugcagcugcc
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:prey
psi-miMI:0498
pubmed14755292
Interaction Type:
Name:direct interaction
psi-miMI:0407
pubmed14755292
kineticsED50 (wild-type)=3x10exp-6M
commentRNA strands bind to form a blunt ended double strand, authors name 0.20 RNA
figure legend2A, 2C
commentProtein bound single stranded RNA's with approximately 10 fold lower affinity.
kd0.0
Interaction #13
Name:polg-rna-2: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intactEBI-914187 (polg-rna-2)
goGO:0003725 (double-stranded RNA binding)
Experiments: hobson-2001-1
Participant #14
ccgucgacguacgucgac-2
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:prey
psi-miMI:0498
pubmed14755292
Participant #16
p03300-pro_000004009
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:bait
psi-miMI:0496
pubmed14755292
Feature #17sufficient to bind (region) [ 1812 .. 2208 ]
Feature #18mutation decreasing (asp2096arg) [ 2096 .. 2096 ]
Feature #19mutation decreasing (arg2202asp) [ 2202 .. 2202 ]
Feature #20mutation decreasing (arg2203asp) [ 2203 .. 2203 ]
Feature #21mutation decreasing (leu2089ala) [ 2089 .. 2089 ]
Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #22
ggcgcggcagcugcaugcag
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:prey
psi-miMI:0498
pubmed14755292
Interaction Type:
Name:direct interaction
psi-miMI:0407
pubmed14755292
kineticsED50 (wild-type)=6x10exp-6M
commentRNA strands bind to form a blunt ended double strand, authors name 5.20 RNA
figure legend2A, 2D
commentProtein bound single stranded RNA's with approximately 10 fold lower affinity.
kd0.0
Interaction #24
Name:polg-rna-3: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intactEBI-914242 (polg-rna-3)
goGO:0003725 (double-stranded RNA binding)
goGO:0003968 (RNA-directed RNA polymerase ac)
goGO:0006354 (RNA elongation)
goGO:0008270 (zinc ion binding)
Experiments: hobson-2001-2
Participant #26
zinc 2plus
Biological Role:
Name:cofactor (coenzyme)
psi-miMI:0682
pubmed14755292
Experimental Role:
Name:cofactor (coenzyme)
psi-miMI:0682
pubmed14755292
Participant #28
ccgucgacguacgucgac-2
Biological Role:
Name:enzyme target (substrate)
psi-miMI:0502
pubmed14755292
Experimental Role:
Name:neutral component
psi-miMI:0497
pubmed14755292
Participant #29
p03300-pro_000004009
Biological Role:
Name:enzyme
psi-miMI:0501
pubmed14755292
Experimental Role:
Name:neutral component
psi-miMI:0497
pubmed14755292
Feature #30required to bind (region) [ 1747 .. 1812 ]
Feature #31mutation decreasing (ala1776cys) [ 1776 .. 1776 ]
Feature #32mutation decreasing (region) [ 1777 .. 1777 ]
Feature #33mutation decreasing (iso2188cys) [ 2188 .. 2188 ]
Feature #34mutation decreasing (gly2189leu) [ 2189 .. 2189 ]
Feature #35mutation decreasing (asp2096arg) [ 2096 .. 2096 ]
Feature #36mutation decreasing (arg2202asp) [ 2202 .. 2202 ]
Feature #37mutation decreasing (arg2203asp) [ 2203 .. 2203 ]
Feature #38mutation decreasing (leu2089ala) [ 2089 .. 2089 ]
Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #39
ggcgcggcagcugcaugcag
Biological Role:
Name:enzyme target (substrate)
psi-miMI:0502
pubmed14755292
Experimental Role:
Name:neutral component
psi-miMI:0497
pubmed14755292
Interaction Type:
Name:elongation: dna strand elongation (DNA replication elongation)
psi-miMI:0701
pubmed14755292
goGO:0006271
figure legendFigure 2F and Figure 3
commentRNA strands bind to form a blunt ended double stranded RNA, authors name 5.20 RNA
kd0.0
Interaction #40
Name:polg-polg-1: Dimerization of Poliovirus type 1 (strain Mahoney)
intactEBI-944619 (polg-polg-1)
goGO:0042803 (protein homodimerization activ)
Experiments: hobson-2001-3
Participant #42
p03300-pro_000004009
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:neutral component
psi-miMI:0497
pubmed14755292
Feature #43mutation increasing (ala1776cys) [ 1776 .. 1776 ]
Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #44
p03300-pro_000004009
Biological Role:
Name:unspecified role
psi-miMI:0499
pubmed14755292
Experimental Role:
Name:neutral component
psi-miMI:0497
pubmed14755292
Feature #45mutation increasing (iso2188cys) [ 2188 .. 2188 ]
Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Interaction Type:
Name:direct interaction
psi-miMI:0407
pubmed14755292
figure legend6E
commentUnder reducing conditions, only protein monomers are observed.
kd0.0