Proteomics Standards Initiative

Molecular Interaction Version 2.5

Source
Name:	European Bioinformatics Institute
pubmed	14681455
psi-mi	MI:0469
postalAddress	Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom
url	http://www.ebi.ac.uk

AvailabilityList

ExperimentList
Experiment #2
Name:	hobson-2001-1
Description:	Oligomeric structures of poliovirus polymerase are important for function.
pubmed	11230138
intact	EBI-914159 (hobson-2001-1)
Host Organism:	in vitro
Interaction detection method:	Name: filter binding (Filter overlay assay) psi-mi MI:0049 pubmed 7708014
Participant identification method:	Name: predetermined: predetermined participant psi-mi MI:0396 pubmed 7940758 pubmed 14755292
author-list	Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-email	scott.hobson@cellzome.de
publication-year	2001
exp-modification	RNA binding was evaluated using a nitrocellulose filter binding assay. The amount of radiolabelled RNA bound to each membrane was quantified using a PhosphorImager
journal	EMBO J. (0261-4189)
data-processing	Residues renumbered to match full-length polyprotein for this virus.
Experiment #25
Name:	hobson-2001-2
Description:	Oligomeric structures of poliovirus polymerase are important for function.
pubmed	11230138
intact	EBI-914232 (hobson-2001-2)
Host Organism:	in vitro
Interaction detection method:	Name: rna rna pol assay: rna directed rna polymerase assay psi-mi MI:0700 pubmed 14755292
Participant identification method:	Name: predetermined: predetermined participant psi-mi MI:0396 pubmed 7940758 pubmed 14755292
author-list	Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-email	scott.hobson@cellzome.de
publication-year	2001
exp-modification	Elongation assays evaluated using radiolabelled RNA as a substrate. Elongated products were separated by PAGE and visualised using a PhosphoImager
journal	EMBO J. (0261-4189)
data-processing	Residues renumbered to match full-length polyprotein for this virus.
Experiment #41
Name:	hobson-2001-3
Description:	Oligomeric structures of poliovirus polymerase are important for function.
pubmed	11230138
intact	EBI-914360 (hobson-2001-3)
Host Organism:	in vitro
Interaction detection method:	Name: crosslink: cross-linking study psi-mi MI:0030 pubmed 14755292
Participant identification method:	Name: predetermined: predetermined participant psi-mi MI:0396 pubmed 7940758 pubmed 14755292
author-list	Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC.
contact-email	scott.hobson@cellzome.de
publication-year	2001
journal	EMBO J. (0261-4189)
exp-modification	2mM dithiothreotol added to reaction mixture, this was increased to 50mM for reducing conditions. Proteins seperated by SDS-PAGE and visualised by Coomassie staining
data-processing	Residues renumbered to match full-length polyprotein for this virus.

InteractorList
Interactor #12
Name:	ggcagcugcaugcagcugcc: 5' -3' RNA synthesized for use in PMID: 11230138
intact	EBI-914168 (ggcagcugcaugcagcugcc)
Interactor Type:	Name: rna: ribonucleic acid (RNA) psi-mi MI:0320 pubmed 14755292 so SO:0000356
Organism:	in vitro
Sequence:	GGCAGCUGCA UGCAGCUGCC
Interactor #15
Name:	ccgucgacguacgucgac-2: 3'-5' RNA strand synthesised for use in PMID: 11230138
intact	EBI-944576 (ccgucgacguacgucgac-2)
Interactor Type:	Name: rna: ribonucleic acid (RNA) psi-mi MI:0320 pubmed 14755292 so SO:0000356
Organism:	in vitro
Sequence:	CGUCGACGUA CGUCGACGGC GCGG
Interactor #23
Name:	ggcgcggcagcugcaugcag: 5'-3' RNA synthesized for use in PMID: 11230138
intact	EBI-914181 (ggcgcggcagcugcaugcag)
Interactor Type:	Name: rna: ribonucleic acid (RNA) psi-mi MI:0320 pubmed 14755292 so SO:0000356
Organism:	in vitro
Sequence:	GGCGCGGCAG CUGCAUGCAG CUGCC
Interactor #27
Name:	zinc 2plus: zinc(2+)
chebi	CHEBI:29105
intact	EBI-968340 (zinc 2plus)
Interactor Type:	Name: small molecule psi-mi MI:0328 pubmed 14755292
Interactor #4
Name:	ccgucgacguacgucgacgg: 3' - 5' RNA strand synthesised for use in PMID: 11230138
intact	EBI-944574 (ccgucgacguacgucgacgg)
Interactor Type:	Name: rna: ribonucleic acid (RNA) psi-mi MI:0320 pubmed 14755292 so SO:0000356
Organism:	in vitro
Sequence:	CCGUCGACGU ACGUCGACGG
Interactor #6
Name:	p03300-pro_000004009: Poliovirus type 1 (strain Mahoney) RNA-directed RNA polymerase
uniprotkb	P03300-PRO_0000040090
refseq	NP_740478.2
intact	EBI-914162 (p03300-pro_000004009)
Interactor Type:	Name: peptide (oligopeptide) (polypeptide) psi-mi MI:0327 pubmed 14755292
Organism:	pol1m: Poliovirus type 1 (strain Mahoney)
no-uniprot-update	An amino acid sequence which is not represented in UniProt

InteractionList
Interaction #1
Name:	polg-rna-1: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intact	EBI-914164 (polg-rna-1)
go	GO:0003725 (double-stranded RNA binding)
Experiments:	hobson-2001-1
Participant #3	ccgucgacguacgucgacgg Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: prey psi-mi MI:0498 pubmed 14755292
Participant #5	p03300-pro_000004009 Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: bait psi-mi MI:0496 pubmed 14755292 Feature #7 mutation decreasing (leu2089ala) [ 2089 .. 2089 ] Feature #8 mutation decreasing (asp2096arg) [ 2096 .. 2096 ] Feature #9 mutation decreasing (arg2202asp) [ 2202 .. 2202 ] Feature #10 mutation decreasing (arg2203asp) [ 2203 .. 2203 ] Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #11	ggcagcugcaugcagcugcc Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: prey psi-mi MI:0498 pubmed 14755292
Interaction Type:	Name: direct interaction psi-mi MI:0407 pubmed 14755292
kinetics	ED50 (wild-type)=3x10exp-6M
comment	RNA strands bind to form a blunt ended double strand, authors name 0.20 RNA
figure legend	2A, 2C
comment	Protein bound single stranded RNA's with approximately 10 fold lower affinity.
kd	0.0
Interaction #13
Name:	polg-rna-2: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intact	EBI-914187 (polg-rna-2)
go	GO:0003725 (double-stranded RNA binding)
Experiments:	hobson-2001-1
Participant #14	ccgucgacguacgucgac-2 Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: prey psi-mi MI:0498 pubmed 14755292
Participant #16	p03300-pro_000004009 Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: bait psi-mi MI:0496 pubmed 14755292 Feature #17 sufficient to bind (region) [ 1812 .. 2208 ] Feature #18 mutation decreasing (asp2096arg) [ 2096 .. 2096 ] Feature #19 mutation decreasing (arg2202asp) [ 2202 .. 2202 ] Feature #20 mutation decreasing (arg2203asp) [ 2203 .. 2203 ] Feature #21 mutation decreasing (leu2089ala) [ 2089 .. 2089 ] Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #22	ggcgcggcagcugcaugcag Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: prey psi-mi MI:0498 pubmed 14755292
Interaction Type:	Name: direct interaction psi-mi MI:0407 pubmed 14755292
kinetics	ED50 (wild-type)=6x10exp-6M
comment	RNA strands bind to form a blunt ended double strand, authors name 5.20 RNA
figure legend	2A, 2D
comment	Protein bound single stranded RNA's with approximately 10 fold lower affinity.
kd	0.0
Interaction #24
Name:	polg-rna-3: Poliovirus type 1 (strain Mahoney) binds double stranded RNA
intact	EBI-914242 (polg-rna-3)
go	GO:0003725 (double-stranded RNA binding)
go	GO:0003968 (RNA-directed RNA polymerase ac)
go	GO:0006354 (RNA elongation)
go	GO:0008270 (zinc ion binding)
Experiments:	hobson-2001-2
Participant #26	zinc 2plus Biological Role: Name: cofactor (coenzyme) psi-mi MI:0682 pubmed 14755292 Experimental Role: Name: cofactor (coenzyme) psi-mi MI:0682 pubmed 14755292
Participant #28	ccgucgacguacgucgac-2 Biological Role: Name: enzyme target (substrate) psi-mi MI:0502 pubmed 14755292 Experimental Role: Name: neutral component psi-mi MI:0497 pubmed 14755292
Participant #29	p03300-pro_000004009 Biological Role: Name: enzyme psi-mi MI:0501 pubmed 14755292 Experimental Role: Name: neutral component psi-mi MI:0497 pubmed 14755292 Feature #30 required to bind (region) [ 1747 .. 1812 ] Feature #31 mutation decreasing (ala1776cys) [ 1776 .. 1776 ] Feature #32 mutation decreasing (region) [ 1777 .. 1777 ] Feature #33 mutation decreasing (iso2188cys) [ 2188 .. 2188 ] Feature #34 mutation decreasing (gly2189leu) [ 2189 .. 2189 ] Feature #35 mutation decreasing (asp2096arg) [ 2096 .. 2096 ] Feature #36 mutation decreasing (arg2202asp) [ 2202 .. 2202 ] Feature #37 mutation decreasing (arg2203asp) [ 2203 .. 2203 ] Feature #38 mutation decreasing (leu2089ala) [ 2089 .. 2089 ] Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #39	ggcgcggcagcugcaugcag Biological Role: Name: enzyme target (substrate) psi-mi MI:0502 pubmed 14755292 Experimental Role: Name: neutral component psi-mi MI:0497 pubmed 14755292
Interaction Type:	Name: elongation: dna strand elongation (DNA replication elongation) psi-mi MI:0701 pubmed 14755292 go GO:0006271
figure legend	Figure 2F and Figure 3
comment	RNA strands bind to form a blunt ended double stranded RNA, authors name 5.20 RNA
kd	0.0
Interaction #40
Name:	polg-polg-1: Dimerization of Poliovirus type 1 (strain Mahoney)
intact	EBI-944619 (polg-polg-1)
go	GO:0042803 (protein homodimerization activ)
Experiments:	hobson-2001-3
Participant #42	p03300-pro_000004009 Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: neutral component psi-mi MI:0497 pubmed 14755292 Feature #43 mutation increasing (ala1776cys) [ 1776 .. 1776 ] Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Participant #44	p03300-pro_000004009 Biological Role: Name: unspecified role psi-mi MI:0499 pubmed 14755292 Experimental Role: Name: neutral component psi-mi MI:0497 pubmed 14755292 Feature #45 mutation increasing (iso2188cys) [ 2188 .. 2188 ] Host Organism: pol1m: Poliovirus type 1 (strain Mahoney)
Interaction Type:	Name: direct interaction psi-mi MI:0407 pubmed 14755292
figure legend	6E
comment	Under reducing conditions, only protein monomers are observed.
kd	0.0