European Bioinformatics Institute Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom http://www.ebi.ac.uk hobson-2001-1 Oligomeric structures of poliovirus polymerase are important for function. in vitro filter binding filter binding Filter overlay assay predetermined predetermined participant Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC. scott.hobson@cellzome.de 2001 RNA binding was evaluated using a nitrocellulose filter binding assay. The amount of radiolabelled RNA bound to each membrane was quantified using a PhosphorImager EMBO J. (0261-4189) Residues renumbered to match full-length polyprotein for this virus. hobson-2001-2 Oligomeric structures of poliovirus polymerase are important for function. in vitro rna rna pol assay rna directed rna polymerase assay predetermined predetermined participant Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC. scott.hobson@cellzome.de 2001 Elongation assays evaluated using radiolabelled RNA as a substrate. Elongated products were separated by PAGE and visualised using a PhosphoImager EMBO J. (0261-4189) Residues renumbered to match full-length polyprotein for this virus. hobson-2001-3 Oligomeric structures of poliovirus polymerase are important for function. in vitro crosslink cross-linking study predetermined predetermined participant Hobson SD., Rosenblum ES., Richards OC., Richmond K., Kirkegaard K., Schultz SC. scott.hobson@cellzome.de 2001 EMBO J. (0261-4189) 2mM dithiothreotol added to reaction mixture, this was increased to 50mM for reducing conditions. Proteins seperated by SDS-PAGE and visualised by Coomassie staining Residues renumbered to match full-length polyprotein for this virus. ggcagcugcaugcagcugcc 5' -3' RNA synthesized for use in PMID: 11230138 rna ribonucleic acid RNA in vitro GGCAGCUGCAUGCAGCUGCC ccgucgacguacgucgac-2 3'-5' RNA strand synthesised for use in PMID: 11230138 rna ribonucleic acid RNA in vitro CGUCGACGUACGUCGACGGCGCGG ggcgcggcagcugcaugcag 5'-3' RNA synthesized for use in PMID: 11230138 rna ribonucleic acid RNA in vitro GGCGCGGCAGCUGCAUGCAGCUGCC zinc 2plus zinc(2+) small molecule small molecule ccgucgacguacgucgacgg 3' - 5' RNA strand synthesised for use in PMID: 11230138 rna ribonucleic acid RNA in vitro CCGUCGACGUACGUCGACGG p03300-pro_000004009 Poliovirus type 1 (strain Mahoney) RNA-directed RNA polymerase peptide peptide oligopeptide polypeptide pol1m Poliovirus type 1 (strain Mahoney) An amino acid sequence which is not represented in UniProt polg-rna-1 Poliovirus type 1 (strain Mahoney) binds double stranded RNA 2 4 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait leu2089ala mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain asp2096arg mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2202asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2203asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain pol1m Poliovirus type 1 (strain Mahoney) 12 unspecified role unspecified role prey prey direct interaction direct interaction ED50 (wild-type)=3x10exp-6M RNA strands bind to form a blunt ended double strand, authors name 0.20 RNA 2A, 2C Protein bound single stranded RNA's with approximately 10 fold lower affinity. 0.0 polg-rna-2 Poliovirus type 1 (strain Mahoney) binds double stranded RNA 2 15 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding site certain certain asp2096arg mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2202asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2203asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain leu2089ala mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain pol1m Poliovirus type 1 (strain Mahoney) 23 unspecified role unspecified role prey prey direct interaction direct interaction ED50 (wild-type)=6x10exp-6M RNA strands bind to form a blunt ended double strand, authors name 5.20 RNA 2A, 2D Protein bound single stranded RNA's with approximately 10 fold lower affinity. 0.0 polg-rna-3 Poliovirus type 1 (strain Mahoney) binds double stranded RNA 25 27 cofactor cofactor coenzyme cofactor cofactor coenzyme 15 enzyme target enzyme target substrate neutral component neutral component 6 enzyme enzyme neutral component neutral component region required to bind necessary binding site deletion analysis deletion analysis certain certain ala1776cys mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain region mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain iso2188cys mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain gly2189leu mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain asp2096arg mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2202asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain arg2203asp mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain leu2089ala mutation decreasing mutation decreasing interaction hotspot mutation analysis mutation analysis certain certain pol1m Poliovirus type 1 (strain Mahoney) 23 enzyme target enzyme target substrate neutral component neutral component elongation dna strand elongation DNA replication elongation Figure 2F and Figure 3 RNA strands bind to form a blunt ended double stranded RNA, authors name 5.20 RNA 0.0 polg-polg-1 Dimerization of Poliovirus type 1 (strain Mahoney) 41 6 unspecified role unspecified role neutral component neutral component ala1776cys mutation increasing mutation increasing interaction mutation analysis mutation analysis certain certain pol1m Poliovirus type 1 (strain Mahoney) 6 unspecified role unspecified role neutral component neutral component iso2188cys mutation increasing mutation increasing interaction mutation analysis mutation analysis certain certain pol1m Poliovirus type 1 (strain Mahoney) direct interaction direct interaction 6E Under reducing conditions, only protein monomers are observed. 0.0