Additional File 2

Acronyms used: ESTP, expressed sequence tag polymorphism; SSR, simple sequence repeat; RFLP, restriction fragment length polymorphism; CE, denaturing capillary electrophoresis; DGGE, denaturing gel gradient electrophoresis; SSCP, single strand conformation polymorphism. Expected SSR, Noncontiguous SSRs are separated by a comma; n/a, not available or unknown. Map positions are based on round-3 mapping from JoinMap. Loci with round-2 jumps greater than 5 are noted in the Chi-square column.

ID P. taeda linkage group cM position No. JoinMap linked pairs Chi-square contribution to LG GenBank Acc of STS UniSTS ID or dbPROBE ID F primer sequence R primer sequence marker type allele detection method expected SSR expected marker or probe length, bp observed amplimer length in P. taeda, bp marker citation PubMed ID aliases note1 note2 note3 note4
estPaINR_PAXY13_a 2 53.1 15 1.135 gb|BV729064 UniSTS:515992 CCAGAAGCCCTACTATGACA CCGCTCCAAAACTCCTT ESTP DGGE n/a 269 n/a Brown et al. (2003) 12930758 estPaINR_PAXY13 Primer sequences obtained from http://www.pierroton.inra.fr/genetics/pinus/primers.html.      
estPmaLU_SB12_a 6 10.8 6 0.694 gb|BV729051 UniSTS:515993 TTATTGAGGATGTCCGTGTTC AGAGGTAGACCATCTAGTCAC ESTP DGGE n/a 497 n/a Perry and Bousquet (1998) 9611216 estPmaLU_SB12        
estPmaLU_SB32_a 2 70.2 11 2.203 gb|BV729050 UniSTS:515994 TGCTGTCTACACTGCTCAATG CAGAAGCCTGAGGATGTTACC ESTP DGGE n/a 529 n/a Perry and Bousquet (1998) 9611216 estPmaLU_SB32a; estPmarLU_SB32a_a        
estPmaLU_SB41_a 1 80.9 16 0.298 gb|BV729052 UniSTS:515995 GCTGAGGGGAAGGATTGATAC GCTTCGACAGGCATATTACAG ESTP DGGE n/a 404 n/a Perry and Bousquet (1998) 9611216 estPmarLU_SB41_a; estPmaLU_SB41        
estPmaLU_SB49_a 3 101 13 0.941 gb|BV729054 UniSTS:515996 AGGTCCTCCAAAAGTTCTGTG GCCTCATGTTCCCAAAGTCTC ESTP DGGE n/a 323 n/a Perry and Bousquet (1998) 9611216 estPmaLU_SB49        
estPmaLU_SB58_a 1 99.8 16 0.455 gb|BV729053 UniSTS:515997 CCGACAATCAAATACACTGAG TACCAGACCAGACCTTCAATG ESTP DGGE n/a 392 n/a Perry and Bousquet (1998) 9611216 estPmaLU_SB58Pt_a; estPmaLU_SB58        
estPpINR_AS01C10-1_a 2 129.3 6 1.233 gb|BV729012 UniSTS:515998 GGCCCCCATCCTAAAATGAA GAAGGGCCTCCAAAAGCACT ESTP DGGE n/a 298 n/a Brown et al. (2003) 12930758 estPpINR_AS01C10 Primer sequences obtained from http://www.pierroton.inra.fr/genetics/pinus/primers.html.      
estPpINR_RN01G04_a 11 2.8 9 0.507 gb|BV729013 UniSTS:515999 GCGTCGCCGGTATCAAAATC CACCCCATTGCACTGTGAGC ESTP DGGE n/a 175 n/a Krutovsky et al. (2004) 15454556 estPpaINRA_RN01G04_a; estPpINR_RN01G04        
estPtIFG_107_a 1 97.9 5 0.666 gb|BV729025 UniSTS:516000 GCAGGACCTTCTGGACAATC AGGTGGAGAAAGCCAAGCTC ESTP DGGE n/a 423 450 Temesgen et al. (2001) n/a estPtIFG_0107        
estPtIFG_149_a 7 0.0 4 0.374 gb|BV729058 UniSTS:516001 CCAATCCAACCGATACTTGG CAAAGGTGATTGCGTCACC ESTP DGGE n/a 523 550 Temesgen et al. (2001) n/a estPtIFG_0149 STS is split between Pinus taeda clones 0149e (gb|H75240) and 0149s (gb|H75141). Both primers match homolgous Pinus taeda EST gb|DR743536, clone RTCU1_16_B12_A029.    
estPtIFG_464_a 2 49.3 14 1.134 gb|BV729015 UniSTS:516002 TGTCACTGCCCAGAGCTATTC ATCACAGCCGCTCCAAAAC ESTP DGGE n/a 355 730 Temesgen et al. (2001) n/a estPtIFG_0464 R primer does not match Pinus taeda clone 0464e (gb|H75150). Both primers match the homolgous Pinus taeda EST gb|DR695311, clone PWAEN53.    
estPtIFG_500_a 9 77.4 14 1.048 gb|BV729016 UniSTS:516003 GGCGAGTTGGCTTTCATTC CAGCGAAGGTACCAGATTTGC ESTP DGGE n/a 498 500 Temesgen et al. (2001) n/a estPtIFG_0500 STS is split between Pinus taeda clones 0500e (gb|H75151) and 0500s(gb|H75152). Both primers match the homolgous Pinus taeda EST gb|DR101719, clone STRR1_75_G03_A033.    
estPtIFG_624_a 9 53.2 9 0.545 n/a n/a CACAATTGCCAGATGGGTC CTTCTCTAGCAACGATCCGG ESTP DGGE n/a n/a 940 Temesgen et al. (2001) n/a estPtIFG_0624 Primers do not match either Pinus taeda clones 0624M (gb|H75105) or 0624T (gb|H75096). Both primers match Plant Gene Index contig TC96720 which includes those clone sequences.    
estPtIFG_674_a 12 47.4 5 1.572 gb|BV729063 UniSTS:516004 AGCAGAAGGAAGACAGAGTGG CTCCGCATCTCCCCAATTAT ESTP DGGE n/a 272 270 Temesgen et al. (2001) n/a estPtIFG_0674 The GenBank sequence of the clone is not available. Both primers match the homologous Pinus taeda EST gb|CO160324, clone FLD1_20_F03_A029. R primer used with 5' gcaggcggcgcggggcgcgggccgggcggcgggggcgg clamp for DGGE analysis.  
estPtIFG_739_a 6 75.4 15 0.167 gb|BV729059 UniSTS:516005 GTCAATGCCTAACAAGCCCTG CCAATACCCGAGCCTTTGTA ESTP DGGE n/a 346 350 Temesgen et al. (2001) n/a estPtIFG_0739 The GenBank sequence of the clone is not available. Both primers match the homologous Pinus taeda EST gb|DR743097, clone RTCU1_13_C02_A029.    
estPtIFG_893_a 5 49.8 16 0.455 gb|BV729017 UniSTS:516006 CAGCTCAAATTCCATCGTC GGACTGAAGGGATCTAGCTGG ESTP DGGE n/a 464 620 Temesgen et al. (2001) n/a estPtIFG_0893, estPtIFG_893 The GenBank sequence of the clone is not available. Both primers match Pinus taeda EST gb|CO361162, clone NDL2_3_D09_A029.    
estPtIFG_1454_a 5 84 16 0.335 gb|BV729027 UniSTS:516007 ACATCAATCAAGTTGGCCTTG ACGACCATCTCCAACCACTC ESTP DGGE n/a 338 350 Temesgen et al. (2001) n/a estPtIFG_1454        
estPtIFG_1576_a 1 50.1 18 0.573 gb|BV729024 UniSTS:516008 TGGTATGTGGAGGGAAGGC TACAGCGTTTGCTCCTCCTG ESTP DGGE n/a 477 480 Temesgen et al. (2001) n/a estPtIFG_1576 Sequence of Pinus taeda clone 1576s is not available. Both primers match Pinus taeda EST gb|DR681980, clone PWAA474.    
estPtIFG_1643_a 10 61.2 12 2.675 gb|BV729048 UniSTS:516009 AATGGAGGATGCCGTTACAG AACCACTCTCGAATCCCCAC ESTP DGGE n/a 481 650 Temesgen et al. (2001) n/a estPtIFG_1643 STS is split between Pinus taeda clones 1643e (gb|H75191) and 1643s (gb|H75192). Both primers match Plant Gene Index pine contig TC113228 which includes those clone sequences.    
estPtIFG_1750_a 11 86.2 5 0.239 gb|BV729060 UniSTS:516010 TAGCAAGCACTCTGACTGTGG CCGCGTCAAGAACGTAAACA ESTP DGGE n/a 299 300 Temesgen et al. (2001) n/a estPtIFG_1750 STS is split between Pinus taeda clones 1750s (gb|H75022) and 0739e (gb|H75195). Both sequences match the homolgous Pinus taeda EST gb|DR102530, clone STRR1_81_F12_A033.    
estPtIFG_1934_a 3 120.0 15 0.478 gb|BV729018 UniSTS:516011 TTCTGTTTGTGCGCCTACTG GACGAAGTTGGTGGCATAG ESTP DGGE n/a 841 850 Temesgen et al. (2001) n/a estPtIFG_1934 STS is split between Pinus taeda clones 1934M (gb|H75112) and 1934T (gb|H75103). Both ESTs are homolgous with Pinus taeda EST gb|DR095068, clone STRR1_18_C09_A033.    
estPtIFG_1950_a 6 59.2 20 1.109 gb|BV729026 UniSTS:516012 AAACCAGCAGCCACATGAG TATTAAGAAGGCGGCGGTAC ESTP DGGE n/a 340 450 Temesgen et al. (2001) n/a estPtIFG_1950        
estPtIFG_1955_a 5 88.8 14 0.301 n/a n/a AGCCAATGCACCAAGAAGG ATCCAACAACAGAACCCCTC ESTP DGGE n/a n/a 290 Temesgen et al. (2001) n/a estPtIFG_1955 R primer does not match Pinus taeda clone 1955e (gb|H75038) or any other P. taeda EST.      
estPtIFG_1956_a 9 7.1 5 0.092 gb|BV729019 UniSTS:516013 GAAGCTAGCGAAGGCTTTGG GGGTGTGACCATATAACACCG ESTP DGGE n/a 346 500 Temesgen et al. (2001) n/a estPtIFG_1956   F and R primers may be reversed from what is in the NCBI UniSTS record.    
estPtIFG_2166_a 4 59.9 6 0.157 gb|BV729020 UniSTS:516014 CTGCTGTTGAGCTTGTGTACG TGCCCGTCGTAAAGATGACAG ESTP DGGE n/a 419 400 Temesgen et al. (2001) n/a estPtIFG_2166 STS is split between Pinus taeda clones 2166s (gb|H75060) and 2166e (gb|H75059). Both ESTs are homolgous with Pinus taeda EST gb|DT624335, clone PIMAD52.    
estPtIFG_2290_a 9 66 15 0.789 gb|BV729021 UniSTS:516015 AGCTTGCAGCATCAACCG GAACCAAACAGCTTCAGGACC ESTP DGGE n/a 425 840 Temesgen et al. (2001) n/a estXUOU_LHCA2; PsUMU_p1NEab21; estPtIFG_2290 R primer does not match Pinus taeda clone 2290e (gb|H75067). Both primers match the homolgous Pinus taeda EST gb|DR101524, clone STRR1_73_H05_A033. PsUMU_p1NEab21 and estXUOU_LHCA2 are from gb|X58516; Kumolainen et al. 2003  
estPtIFG_2358_a 6 0.0 6 0.458 gb|BV729049 UniSTS:516016 GTTAACCCTCGAGGAGACATG GCTTCCACAGTCCACAATCTG ESTP DGGE n/a 327 330 Temesgen et al. (2001) n/a estPtIFG_2358 Primers do not match Pinus taeda clone 2358e (gb|H75088), or any other pine EST. Both primers match Plant Gene Index contig TC59982 which includes that clone sequence.    
estPtIFG_2615_a 11 37.5 9 1.575 gb|BV729062 UniSTS:516017 TCGGTTAGGTAACGACTGGAC CGAAGGGCAAGAATAAAGAGTG ESTP DGGE n/a 317 400 Temesgen et al. (2001) n/a estPtIFG_2615        
estPtIFG_2781_a 8 100.8 16 0.464 gb|BV729022 UniSTS:516018 GATGATGCCCTGAAGAGCC ATGGAACCAAAGGAGATGCC ESTP DGGE n/a 448 450 Temesgen et al. (2001) n/a estPtIFG_2781 R primer does not match Pinus taeda clone 2781e (gb|H75231).      
estPtIFG_2889_a 3 20.14 7 3.71 gb|BV729023 UniSTS:516019 ACGCCAGCTCTGACTACCAG GTTTCTTCTCGTGGTGCTCG ESTP DGGE n/a 453 750 Temesgen et al. (2001) n/a estPtIFG_2889 STS is split between Pinus taeda clones 2889e (gb|H75234) and 2889s (gb|H75235). Both ESTs are homolgous with Pinus taeda EST gb|DR744329, clone RTCU1_21_F07_A029.    
estPtIFG_4CL_a 7 60.4 9 0.92 gb|BV728981 UniSTS:516020 CCCCGTCAAATCTGGCTCCT GGGCGCTTACTCTGCACCAC ESTP DGGE n/a 658 n/a Brown et al. (2003) 12930758 estPtIFG_4CL Primer sequences obtained from http://www.pierroton.inra.fr/genetics/pinus/primers.html.      
estPtIFG_8415_a 9 110.4 13 2.341 gb|BV728982 UniSTS:516021 ACCTTGTTGTGGATGGCG GCAACCTCCCATACCAAGAC ESTP DGGE n/a 245 n/a Brown et al. (2003) 12930758 estPtIFG_8415     F primer used with 5' cgcgcgg clamp for DGGE analysis.  
estPtIFG_8429_a 4 84.7 12 0.293 gb|BV728998 UniSTS:516022 GAGGCATTTATGAGGGAACG GTTGAAAGCGACTCCAAAGG ESTP DGGE n/a 251 n/a Brown et al. (2001) 11606554 estPtIFG_8429     R primer used with 5' cgcgcgg clamp for DGGE analysis.  
estPtIFG_8471_a 5 33.8 10 3.268 gb|BV729009 UniSTS:516023 AGTCAGAGGCCATGTTTTGG TGAACCACTACATTCCCCTCC ESTP DGGE n/a 194 n/a Brown et al. (2001) 11606554 estPtIFG_8471     F primer used with 5' ggcccggcgg clamp and R primer used with 5' ggc clamp for DGGE analysis.  
estPtIFG_8473_a 6 92.9 7 4.25, jump>5 gb|BV729010 UniSTS:516024 CTCTGGAGAACGACTGCAAG TACAGTAGCCTCTCTGGCCC ESTP DGGE n/a 193 n/a Brown et al. (2001) 11606554 estPtIFG_8473     F primer used with 5' ccggccggg clamp for DGGE analysis.  
estPtIFG_8500_a 3 96.8 19 1.277 gb|BV729004 UniSTS:516025 GCAGATCGGACGATTAAAGG TCTGTACAAAACCGGATGGG ESTP DGGE n/a 223 n/a Brown et al. (2001) 11606554 estPtIFG_8500     F primer used with 5' ggcccggcgg clamp and R primer used with 5' gcc clamp for DGGE analysis.  
estPtIFG_8531_a 6 17.6 6 0.789 gb|BV729000 UniSTS:516026 TTCAGCTGGAAACACCTCAC CTCGTGATAGCACAGCAAATACTC ESTP DGGE n/a 239 n/a Brown et al. (2001) 11606554 estPtIFG_8531     F primer used with 5' cccggccgcg clamp for DGGE analysis.  
estPtIFG_8542_a 12 42.9 12 0.816 gb|BV729006 UniSTS:516027 TTGGCATATGGAGGCATG GATGCCCAAAGCATGACATC ESTP DGGE n/a 222 n/a Brown et al. (2001) 11606554 estPtIFG_8542     F primer used with 5' ggcccggcgg clamp and R primer used with 5' gc clamp for DGGE analysis.  
estPtIFG_8564_a 6 83.6 11 4.2, jump>5 gb|BV729044 UniSTS:516028 CACCAGGGCAAAAAGTTGG GCAGTTATAGGTTTCCTGGCC ESTP DGGE n/a 232 230 Temesgen et al. (2001) n/a estPtIFG_8564        
estPtIFG_8565_a 12 71.8 5 2.292 gb|BV729047 UniSTS:516029 ATTTGTGGCTGCGGAAAG CACCAAGTACACCACAACACC ESTP DGGE n/a 201 220 Temesgen et al. (2001) n/a estPtIFG_8565        
estPtIFG_8569_a 2 20.1 14 0.213 gb|BV729061 UniSTS:516030 TCGTCTCCCTCATCACCTTC CCTCTGCAACACTGGTCGA ESTP DGGE n/a 209 210 Temesgen et al. (2001) n/a estPtIFG_8569 F primer does not match Pinus taeda clone 8569M (gb|AA739585). Both primers match the homologous Pinus taeda EST gb|DR745022, clone RTCU1_26_B08_A029.    
estPtIFG_8580_a 10 17 13 0.214 gb|BV729011 UniSTS:516031 ACTGGATTCCGGAGGATCAC TGGAAACCGTCTACAGTCGC ESTP DGGE n/a 180 n/a Brown et al. (2001) 11606554 estPtIFG_8580        
estPtIFG_8612_a 3 52.53 24 0.595 gb|BV729007 UniSTS:516032 GAAGGGCACTATGAAGCTGC AACTAGGAATCCCAAATTCCC ESTP DGGE n/a 218 n/a Brown et al. (2001) 11606554 estPtIFG_8612     R primer used with 5' gcggccgg clamp for DGGE analysis.  
estPtIFG_8647_a 6 23.8 8 2.298 gb|BV729008 UniSTS:516033 TTGGTCCGCTGATTGGAG ACTTACGGTGGAGACCTTACAC ESTP DGGE n/a 208 n/a Brown et al. (2001) 11606554 estPtIFG_8647     F primer used with 5' ggccggg clamp for DGGE analysis.  
estPtIFG_8702_a 6 87.6 18 1.338 gb|BV729033 UniSTS:516034 GTTGCAGAAAAGGGTGGC AGTCGCACTTGCTCCAGTTC ESTP DGGE n/a 291 350 Temesgen et al. (2001) n/a estPtIFG_8702        
estPtIFG_8725_a 9 125.4 6 0.353 gb|BV728997 UniSTS:516035 AGCGCTGAATGATGTCTTGG CCAAACTTACACCATGCTCG ESTP DGGE n/a 259 n/a Brown et al. (2001) 11606554 estPtIFG_8725     R primer used with 5' gccgggcccggc clamp for DGGE analysis.  
estPtIFG_8732_a 8 57.2 17 1.689 gb|BV729003 UniSTS:516036 TGAAGTTCTGAGTTTGGCGG ATGCACAGGATGAACCCTTC ESTP DGGE n/a 228 n/a Brown et al. (2001) 11606554 estPtIFG_8732     F primer used with 5' ggcccggcggccgg clamp and R primer used with 5' gcc clamp for DGGE analysis.  
estPtIFG_8738_a 4 106.4 6 1.247 gb|BV728999 UniSTS:516037 TCACAGACCTGAACACTGCG CCAAAACCGACTATCTTGGG ESTP DGGE n/a 242 n/a Brown et al. (2001) 11606554 estPtIFG_8738     F primer used with 5' g clamp and R primer used with 5' ggcccggcgg clamp for DGGE analysis.  
estPtIFG_8781_a 3 11.9 11 0.583 gb|BV729005 UniSTS:516038 GGTTTGCTCACATGTTCGTG TCCTTCATAAATGCATTCTCGTC ESTP DGGE n/a 223 n/a Brown et al. (2001) 11606554 estPtIFG_8781     F primer used with 5' ccggccggg clamp for DGGE analysis.  
estPtIFG_8837_a 5 48.5 13 0.757 gb|BV729002 UniSTS:516039 TCGGTTACTTGGGACCTACTG TCCCATGCAATATCATTTGTG ESTP DGGE n/a 230 n/a Brown et al. (2001) 11606554 estPtIFG_8837     F primer used with 5' ccggccggg clamp for DGGE analysis.  
estPtIFG_8886_a 7 129.1 4 0.525 gb|BV729029 UniSTS:516040 TTCCGGAAGGTGTGGTGG AGTCACTCCCTGTCACCGAC ESTP DGGE n/a 315 310 Temesgen et al. (2001) n/a estPtIFG_8886        
estPtIFG_8887_a 4 100.8 8 0.358 gb|BV729028 UniSTS:516041 TGGGGTTGGTGAGATACTGC CATATATTGGGAAAACGTTCGC ESTP DGGE n/a 317 500 Temesgen et al. (2001) n/a estPtIFG_8887        
estPtIFG_8898_a 4 123 10 2.213 gb|BV729045 UniSTS:516042 GGGATGGCAACAACAAAAAG ATGGGGGTGCAGCATAAAC ESTP DGGE n/a 216 1400 Temesgen et al. (2001) n/a estPtIFG_8898        
estPtIFG_8939_a 2 74.1 15 2.375 gb|BV729030 UniSTS:516043 ACGTGGACGAGCAGTCAAAG AACCACGAGCTTGGCATG ESTP DGGE n/a 314 300 Temesgen et al. (2001) n/a estPtIFG_8939        
estPtIFG_8972_a 6 25.7 16 1.97, jump>5 gb|BV729031 UniSTS:516044 TTGGTCCCCTTGTTGGAG GCCTCCATTCGACTCACTTG ESTP DGGE n/a 307 310 Temesgen et al. (2001) n/a estPtIFG_8972        
estPtIFG_9008_a 5 82.2 15 0.8 gb|BV729035 UniSTS:516045 GGTAAACTGGGATGGATTGC TCTCGGATAGGGCAATATGC ESTP DGGE n/a 288 290 Temesgen et al. (2001) n/a estPtIFG_9008     F primer used with 5' ggcgccc clamp for DGGE analysis.  
estPtIFG_9022_a 2 29.4 18 0.293 gb|BV729046 UniSTS:516046 CGGTGTGTTTCATGTGCTG GGATTTGCATTTTGCATGCC ESTP DGGE n/a 209 210 Temesgen et al. (2001) n/a estPtIFG_9022        
estPtIFG_9036_a 8 72.1 17 0.463 gb|BV729038 UniSTS:516047 CAGGACGAATGAGATACCTGC GTCATCCGATACAACCTCAATC ESTP DGGE n/a 280 350 Temesgen et al. (2001) n/a estPtIFG_9036        
estPtIFG_9044_a 6 77.9 6 0.547 gb|BV729041 UniSTS:516048 AACTGGAGGAAAAGCACGAC CATCGCATCAGTCATACTCACC ESTP DGGE n/a 266 280 Temesgen et al. (2001) n/a estPtIFG_9044     F primer used with 5' cgcggccc clamp for DGGE analysis.  
estPtIFG_9053_a 1 25.8 18 4.58, jump>5 gb|BV729036 UniSTS:516049 TGCATGATGACGGCTCTATG CCACCGAAATATATGCCTGTC ESTP DGGE n/a 283 280 Temesgen et al. (2001) n/a estPtIFG_9053     F primer used with 5' ggcgg clamp for DGGE analysis.  
estPtIFG_9076_a 11 16.7 9 0.908 gb|BV729042 UniSTS:516050 AGAATTTACTGGCCGCTCG CTCTATTGCAAAAATGTGCCAC ESTP DGGE n/a 253 250 Temesgen et al. (2001) n/a estPtIFG_9076        
estPtIFG_9092_a 5 51.5 15 0.731 gb|BV729040 UniSTS:516051 TCACTGACCTTAACGTCCC AGCTAAAGTTGGCTGGCATC ESTP DGGE n/a 267 400 Temesgen et al. (2001) n/a estPtIFG_9092     F primer used with 5' ggccggg clamp for DGGE analysis.  
estPtIFG_9102_a 1 73.5 16 0.982 gb|BV729043 UniSTS:516052 CCCAGAGATCTTCCGCTATG AGAAAGGAGCATTTCCCGAC ESTP DGGE n/a 238 240 Temesgen et al. (2001) n/a estPtIFG_9102     R primer used with 5' ggccgcggc clamp for DGGE analysis.  
estPtIFG_9113_a 8 117.8 12 0.749 gb|BV729032 UniSTS:516053 AGGAAAAGGTTCTCCAAGCG ACAGCTTAGGCATTACAGCCC ESTP DGGE n/a 303 300 Temesgen et al. (2001) n/a estPtIFG_9113     R primer used with 5' gccggccg clamp for DGGE analysis.  
estPtIFG_9151_a 7 60.8 16 0.701 gb|BV729034 UniSTS:516054 TAGTGAGCCCTGGAGCGTAC GCAGAATCTCAGCAGCAATG ESTP DGGE n/a 291 290 Temesgen et al. (2001) n/a estPtIFG_9151        
estPtIFG_9156_a 9 16.3 11 0.462 gb|BV729037 UniSTS:516055 TAAGCTTCGTGCAACAGGAG GACAATCCCTCTAAACCTCGC ESTP DGGE n/a 281 400 Temesgen et al. (2001) n/a estPtIFG_9156     F primer used with 5' ggcccgcgcccg clamp for DGGE analysis.  
estPtIFG_9157_a 4 25.9 6 0.543 gb|BV729039 UniSTS:516056 TTCCAGTTTCCCTGAGCATC AATACGCTGCTTAATCGTGTC ESTP DGGE n/a 273 275 Temesgen et al. (2001) n/a estPtIFG_9157     R primer used with 5' ccgcgggccgcggcc clamp for DGGE analysis.  
estPtIFG_9164_a 9 17.9 8 0.653 gb|BV728996 UniSTS:516057 TACTGCGAATGCAACTCCAG CAGCAAAGAGGCTTCAAAGG ESTP DGGE n/a 219 n/a Brown et al. (2001) 11606554 estPtIFG_9164 R primer does not match Pinus taeda clone 9164M (gb|AA739966). Both primers match the homolgous Pinus taeda EST gb|DR168058, clone RTPHOS1_22_H07_A029. F primer used with 5' gcggcc clamp for DGGE analysis.  
estPtIFG_9198_a 1 66.8 16 0.615 gb|BV729001 UniSTS:516058 CGGCGGTGGCATAAGTTAC TCCAAGTCTTCTCAATCCGG ESTP DGGE n/a 236 n/a Brown et al. (2001) 11606554 estPtIFG_9198     R primer used with 5' gcggccggg clamp for DGGE analysis.  
estPtIFG_C4H-1_a 3 47.2 25 0.646 n/a n/a n/a n/a ESTP DGGE n/a n/a n/a Chagne et al. (2003) n/a estPtIFG_4CH-1_a; estPtIFG_C4H-1        
estPtIFG_C4H-2_a 10 26.4 13 0.452 n/a n/a n/a n/a ESTP DGGE n/a n/a n/a Chagne et al. (2003) n/a estPtIFG_4CH-2_a; estPtIFG_C4H-2        
estPtIFG_COMT-2_a 11 89.3 11 1.202 gb|BV729056 UniSTS:516059 AACTAATAATTCGCTTTGTGAAACATACAT TACCGACTCTGCTTGGCCTT ESTP DGGE n/a 223 n/a Brown et al. (2003) 12930758 PtNCS_5c9a; estPtIFG_COMT-2     F primer used with 5' gcgggcggcgggcgg clamp and R primer used with 5' cggcggcggcgg clamp for DGGE analysis.  
estPtIFG_lp3-3_a 2 68.7 15 0.753 n/a n/a GGAAGATGAAAACGACAACC AGACGTAACCCCCTTCTCC ESTP FP-TDI n/a n/a n/a Gonzalez-Martinez et al. (2006) 16387885 estPtIFG_F3R3; estPtIFG_lp3-3        
estPtIFG_SAHH_a 11 0.9 9 0.325 gb|BV728983 UniSTS:516060 TGGGTGCCAAGCTAACAAAGC TGCCGACAAAGAGAGGCGA ESTP pyrosequencing n/a 322 n/a Brown et al. (2003) 12930758 estPtIFG_SAHH        
estPtIFG_SB32b_a 12 85 10 0.87 n/a n/a n/a n/a ESTP DGGE n/a n/a n/a Krutovsky et al. (2004) 15454556 estPmarLU_SB32b_a; estPtIFG_SB32b        
estPtNCS_22B8_a 3 46.37 22 1.57 gb|BV728984 UniSTS:516062 CCACACAACCACCAGATTGC CAGGTCACACACTTTCTCCACC ESTP DGGE n/a 228 n/a Krutovsky et al. (2004) 15454556 PtDOE_22B8; estPtNCS_22B8     F primer used with 5' gccgccgccc clamp and R primer used with 5' gc clamp for DGGE analysis.  
estPtNCS_22C5_a 3 83.59 20 0.956 gb|BV728985 UniSTS:516063 ATCCTAAGTGGCATGGGTTTATTC CAATCACCAAAATGAACATATACGC ESTP DGGE n/a 245 n/a Brown et al. (2003) 12930758 PtDOE_22C5; estPtNCS_22C5 Primers do not match Pinus taeda clone 22C5 (gb|AI812900). Both primers the match the homologous Pinus taeda EST gb|AA556727, clone 2NA11H. F primer used with 5' ggcgggcggcgggc clamp and R primer used with 5' cggcggg clamp for DGGE analysis.  
estPtNCS_22C8_a 5 86.1 29 0.534 gb|BV728986 UniSTS:516064 TGCACAGGACGAAGACGC GCGCTTGATAGAACACAACCAG ESTP DGGE n/a 286 n/a Brown et al. (2003) 12930758 estPtIFG_22C8; estPtIFG_22C8(perox); estPtNCS_22C8 Primers do not match Pinus taeda clone 22C8 (gb|AI812903). Both primers match the homologous Pinus taeda EST gb|DR016450, clone STRS1_10_E09_A034. F primer used with 5' ggcgggcggcgg clamp and R primer used with 5' gcgg clamp for DGGE analysis.  
estPtNCS_23C5_a 6 9.9 5 0.715 gb|BV728987 UniSTS:516065 CCCAACAGAATCAAGGACTGC TAGAAATAAGGGAGCCTCACGC ESTP DGGE n/a 265 n/a Krutovsky et al. (2004) 15454556 PAL-2; estPtIFG_23C5; estPtNCS_23C5 Primers do not match Pinus taeda clone 23C5 (gb|AI813128). Both primers match the homologous Pinus taeda EST gb|CF473870, clone RTWW2_19_D07_A021. F primer used with 5' gccgccgccg clamp for DGGE analysis.  
estPtNCS_2N7G_a 4 107.7 13 0.908 gb|BV728988 UniSTS:516066 TGAGGGAGACGAGGATGAGG GCATTCAAGTGCGAGAGTCG ESTP DGGE n/a 260 n/a Brown et al. (2003) 12930758 estPtIFG_2N7G(tub); estPtNCS_2N7G     F primer used with 5' gcgggcggcggg clamp for DGGE analysis.  
estPtNCS_6C12A_a 4 74.7 7 0.338 gb|BV728989 UniSTS:516067 GACGGACTCCAAATAGATTGCC GATCGAATAACAAATGTAGGTGGCTA ESTP DGGE n/a 305 n/a Brown et al. (2003) 12930758 estPtNCS_6C12A     F primer used with 5' ggcggcggc clamp and R primer used with 5' gcg clamp for DGGE analysis.  
estPtNCS_6C5A_a 4 64.7 11 0.169 n/a n/a TCTACCCAGATGTCCAATACACTACTG TTCCAAAACACTCACAGACAAAGAG ESTP DGGE n/a n/a n/a Chagne et al. (2003) n/a estPtIFG_6C5A; estPtNCS_6C5A     F primer used with 5' ggcgggcgggcg clamp for DGGE analysis.  
estPtNCS_6N3C_a 11 16.3 9 0.607 gb|BV729057 UniSTS:516068 GGCCAGATAGCCAAGACCAATA CATAATAATCACGGTGGTTAATCCTG ESTP DGGE n/a 232 n/a Brown et al. (2003) 12930758 estPtIFG_6N3C(cesA); estPtNCS_6N3C     F primer used with 5' ggcggggc clamp for DGGE analysis.  
estPtNCS_6N3E_a 1 105 10 0.194 gb|BV728990 UniSTS:516069 CTTATGATGTTCCACCTGGCATT ACTGAAGTGATGTTGTTACAGCAAAGT ESTP DGGE n/a 342 n/a Brown et al. (2003) 12930758 estPtNCS_6N3E     F primer used with 5' ggcggcgg clamp and R primer used with 5' gcgg clamp for DGGE analysis.  
estPtNCS_CCoAOMT_a 6 93.5 14 0.727 gb|BV728992 UniSTS:516071 TTTGCAGGCGTGTCTATTGA CGAAATGGCGAAGAAAACAT ESTP DGGE n/a 195 n/a Brown et al. (2003) 12930758 estPtNCS_CCoAOMT     F primer used with 5' gggcggcggcggg clamp for DGGE analysis.  
NZPR0102c 12 73 19 1.89 n/a n/a ATTCACTCACATCGGCAACTC GCTCCAAGGTGATTGAAATCTC SSR CE (GA)21 n/a 94 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0116 6 75.5 13 0.73 n/a n/a ATACCTAGTTATCATTTAAATAAATGC CTCTCAGTAAGTCGAAGAGAGTATC SSR CE (GC)5, (CA)13, (TA)6 n/a 125 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0143 2 71.7 11 1.56 n/a n/a GAAAGCATTAGCCATCTACATTCA TCATTGTGCATGCATTTATAATCTC SSR CE (CA)18 n/a 102 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0206 5 53.8 24 5.93 gb|BV728907 UniSTS:516211 TTGATGGGCTTGGTCCATAT ATGCAAGGTAAGGTGGTTGG SSR CE (CA)19, (TTA)5 252 239 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0269 4 20.9 8 0.09 gb|BV728908 UniSTS:516212 TTCATCACATATCAACATCTTCCA TTAAAAGCCACGTCTCCCAG SSR CE (CA)12, (CA)9 250 278 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0274 12 92.1 9 1.15 gb|BV728909 UniSTS:516213 CGACATCAAAGTGACGATGG TGGGATTGTATGCATGTCTCA SSR CE (GT)23 321 304 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0290 6 57.1 28 2.11 gb|BV728910 UniSTS:516214 TGGGTTTTATTTCCACCTGC AACCCAAAAATGATGCCTTG SSR CE (AC)36 251 210 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0300 5 56.4 30 n/a gb|BV728911 UniSTS:516215 CACTACACACTGCACACATGC TTGGTGTTTGTTTTGTGGGA SSR CE (AC)6, (AC)7, (CA)5, (CA)10(CACACG)8 333 304 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0351 7 63.1 18 0.51 gb|BV728912 UniSTS:516216 GGGCGAACAACCAACTCTAG TTCCAAGATGCATGAACACA SSR CE (TG)6(GT)16 280 272 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
NZPR0413 4 90.2 19 3.78 gb|BV728913 UniSTS:516217 TGAACCTCGATGGAATAGCC CCCGCCTTGCATCAATTA SSR CE (TG)23, (GT)6 253 209 Chagne et al. (2004) 15448894 NZPR413     F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0440 5 56.4 30 1.42 gb|BV728914 UniSTS:516218 GGGGAGGCTATCTCATCTGC GGATTGCAGTGGCATTGTTA SSR CE (TG)15 175 160 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0458 10 80.0 15 24.543 gb|BV728929 UniSTS:516219 TGGATCATGATTGTCTCTATGC TCCTCATAGCCAGGAACCTC SSR CE (TG)10 253 254 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0473 3 73.97 28 3.18 gb|BV728915 UniSTS:516220 TGTATCCATGTTCAAGGGCA ACCTCAGTCCAACCAGCATC SSR CE (CA)12(AT)5 161 167 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0563 8 9.4 21 2.34, jump>5 gb|BV728916 UniSTS:516221 GCATTTCTTGTTGCTATTTTCAA GCACAAGTCCCATTTCCATT SSR CE (CA)26, (CA)7 293 265 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0599 11 51.1 10 0.42 gb|BV728917 UniSTS:516222 TTAATGGAAGGGGGTGGAGT GAGAGGAGGAATGGGGAAAT SSR CE (TG)6, (AG)18 328 337 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0826 3 81.6 42 1.45 gb|BV728918 UniSTS:516223 TCAATATTACCTCGCATATTGAAA AGGGCATACTCTAAGCCCAA SSR CE (CT)12, (AC)10 306 314 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0917 7 14.5 6 0.17 gb|BV728919 UniSTS:516224 CCAATGTTGATCTCTCGCAA AATACACCCACATCGAGGGA SSR CE (AC)12 209 225 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0933 8 78.5 31 16.9, jump>5 gb|BV728920 UniSTS:516225 GGATGCACCCTGAGCTAAAT GAGGCATCAACCACAAACCT SSR CE (AC)9 126 127 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR0943 1 73.4 23 1.09 gb|BV728921 UniSTS:516226 ATTCACCGTCAATCCAAAGC AAGAGGAGCTCCCATTCCAT SSR CE (AC)10(TA)8 231 230 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR0947 4 88.7 16 2.44 gb|BV728922 UniSTS:516227 GCAATGCCTATCCCTCTTGA TGTCCTTGCTTAAATTCCTGC SSR CE (AC)14(TA)5 224 222 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
NZPR1004 9 46.7 22 0.55 gb|BV728923 UniSTS:516228 GCTTCATGATTTCACGAGCA AAAGGGACTCTCTCCTTATCACT SSR CE (TG)21, (GT)5 219 169 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR1078 2 107.7 17 0.61 gb|BV728924 UniSTS:516229 TGGTGATCAAGCCTTTTTCC GTTGATGAGTGATGGCATGG SSR CE (GT)10 342 336 Chagne et al. (2004) 15448894       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
NZPR1680 1 54 19 0.96 gb|BV728925 UniSTS:516230 CACACTCACGCACTCACACA ATTGGATTGACCCCCTCTTC SSR CE (CA)14 215 207 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR1682 4 72.5 13 3.03 gb|BV728926 UniSTS:516231 CATTGCCACATCACCAACTC AAGGATCCCTCGCCACTATT SSR CE (AT)6(TG)21, (TGTA)5 243 243 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR1699 1 45.8 13 0.91 gb|BV728927 UniSTS:516232 ATGAAGAGAAACCAAAGGTCA AGCCGATTGAGTGTTTGAGAA SSR CE (TG)13(GA)10 286 326 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
NZPR1702_b 7 15.5 7 0.33 gb|BV728928 UniSTS:516233 TATGATTGGACCATTGGGGT CCAAACCCTCCTCCACATATC SSR CE (AC)15(CA)13, (AT)5 187 145 Chagne et al. (2004) 15448894 NZPR1702     F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PbRAMS 3 0.0 9 0.193 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPbFR_RAMS(D)        
PpSIFG_3116 not mapped not mapped not mapped not mapped gb|BV728700 UniSTS:516234 CAAGTTCGGTTCCTGGTCAT GTCATATTTCTGGTCCGCGT SSR CE (CGG)5 127 120 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PpSIFG_3129 7 9.3 4 0.35 gb|BV728650 UniSTS:516235 AGAAAAACAGCGGCAGAAAA GCAATCCTCGGCATGTTAAT SSR CE (TTC)4(TCC)5 313 310 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PpSIFG_3145 3 78.9 42 0.836 gb|BV728651 UniSTS:516236 TGTATATTCGCCCTGGTGGT ATCAAATCCAGAATCAGGCG SSR CE (GAG)5(CAG)5(GCA)6 372 379 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PpSIFG_3147 6 59.4 16 2.35 gb|BV728652 UniSTS:516237 CACGTGGTTTCCTCCAGTTT CAATGCGTTCTGCATATTGG SSR CE (AT)9 151 158 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PpSIFG_3168 not mapped not mapped not mapped not mapped gb|BV728701 UniSTS:516238 ACGGGAGCTGAGCTTAAACA CAATGCAGCAGAGTGCAAGT SSR CE (TCC)6(AGC)4 193 173 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PrCHS1 4 105 8 1.357 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPrFR_CHS1(A)        
PrE79 9 33.2 12 1.021 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPrFR_E79(S)        
PrMADS3 5 56.1 12 1.075 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPrFR_MADS3(D)        
PstASU_APX 4 106.7 13 0.653 gb|BV729014 UniSTS:516075 GGCTGCTGGAACCCATCA GACGTCCATGCACCTTCAAA ESTP SSCP n/a 304 n/a Komulainen et al. (2003) 12827250 estPstASU_APX; estPstUOU_14; estXUOU_APX        
PsUME_Ps3_A 1 28.6 20 1.417 n/a Pr009397073 n/a n/a RFLP Southern blot n/a 821 n/a Sewell et al. (1999) 9872970 PtUME_Ps3_A        
PsUME_S43_63 7 81.7 18 0.495 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970 PtUME_S43_63        
PsUPS2_PST13 10 not positioned 3 not positioned n/a n/a TCCGTTTGACAGGATTGACT CCCCAGGTCATCCTCTAACT ESTP SSCP n/a 950 n/a Komulainen et al. (2003) 12827250 SODchl; sod-chl; CGLSCO_SODchl_a        
PsyGPD 5 56.8 16 2.103 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPsyFR_GPD(D)        
PtAGP 4 102.9 14 0.476 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPtFR_AGP(A)        
PthCAB 1 19 7 0.413 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPthFR_CAB(D)        
PitaIFG_1A7_6 10 112.4 4 0.032 n/a n/a n/a n/a RFLP Southern blot n/a 510 n/a Eckert et al. (2009) n/a PtIFG_1A7_6        
PitaIFG_2020_1 10 96.8 5 1.322 n/a n/a n/a n/a RFLP Southern blot n/a 176 n/a Eckert et al. (2009) n/a PtIFG_2020_1        
PitaIFG_2361_1 10 102.3 4 0.110 n/a n/a n/a n/a RFLP Southern blot n/a 202 n/a Eckert et al. (2009) n/a PtIFG_2361_1        
PtIFG_1165_a 2 112.5 5 0.198 n/a Pr009397074 n/a n/a RFLP Southern blot n/a 219 n/a Devey et al. (1994) n/a          
PtIFG_138_A 5 100.2 6 0.232 n/a Pr009397075 n/a n/a RFLP Southern blot n/a 268 n/a Sewell et al. (1999) 9872970          
PtIFG_138_B 3 94.7 33 1.61 n/a Pr009397076 n/a n/a RFLP Southern blot n/a 133 n/a Sewell et al. (1999) 9872970          
PtIFG_1454_A 5 81.3 16 0.382 n/a Pr009397077 n/a n/a RFLP Southern blot n/a 545 n/a Devey et al. (1994) n/a          
PtIFG_1457_A 1 69.3 16 0.69 n/a Pr009397078 n/a n/a RFLP Southern blot n/a 338 n/a Devey et al. (1994) n/a          
PtIFG_149_2 8 131.6 7 0.561 n/a Pr009397079 n/a n/a RFLP Southern blot n/a 235 n/a Sewell et al. (1999) 9872970          
PtIFG_149_A 7 128.5 4 0.247 n/a Pr009397080 n/a n/a RFLP Southern blot n/a 207 n/a Sewell et al. (1999) 9872970 PtIFG_149        
PtIFG_1588_A 11 8.7 9 0.687 n/a Pr009397081 n/a n/a RFLP Southern blot n/a 303 n/a Devey et al. (1994) n/a          
PtIFG_1593_21 9 48.4 19 0.438 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Chagne et al. (2003) n/a          
PtIFG_1599 8 76 15 2.1 n/a Pr009397082 n/a n/a RFLP Southern blot n/a 206 n/a Devey et al. (1994) n/a          
PtIFG_1623_A 2 77.5 21 0.804 n/a Pr009397083 n/a n/a RFLP Southern blot n/a 248 n/a Devey et al. (1994) n/a          
PtIFG_1626_c 1 0.1 2 0.001 n/a Pr009397084 n/a n/a RFLP Southern blot n/a 220 n/a Devey et al. (1994) n/a          
PtIFG_1633_c 9 74.5 10 1.343 n/a Pr009397085 n/a n/a RFLP Southern blot n/a 263 n/a Devey et al. (1994) n/a          
PtIFG_1635_A 10 48.2 21 1.01 n/a Pr009397086 n/a n/a RFLP Southern blot n/a 259 n/a Sewell et al. (1999) 9872970          
PtIFG_1636_2 4 111.2 10 1.018 n/a Pr009397087 n/a n/a RFLP Southern blot n/a 257 n/a Sewell et al. (1999) 9872970          
PtIFG_1636_3 3 68.47 26 7.64, jump>5 n/a Pr009397088 n/a n/a RFLP Southern blot n/a 257 n/a Sewell et al. (1999) 9872970          
PtIFG_1636_54 3 55.4 27 0.804 n/a Pr009397089 n/a n/a RFLP Southern blot n/a 257 n/a Chagne et al. (2003) n/a          
PtIFG_1672_A 7 72.6 19 1.105 n/a Pr009397090 n/a n/a RFLP Southern blot n/a 233 n/a Sewell et al. (1999) 9872970          
PtIFG_1869_2 10 6.3 14 0.27 n/a Pr009397091 n/a n/a RFLP Southern blot n/a 278 n/a Sewell et al. (1999) 9872970          
PtIFG_1889_1 10 14.4 16 0.339 n/a Pr009397092 n/a n/a RFLP Southern blot n/a 229 n/a Sewell et al. (1999) 9872970          
PtIFG_1902_1 6 82.5 11 3.313 n/a Pr009397093 n/a n/a RFLP Southern blot n/a 211 n/a Sewell et al. (1999) 9872970          
PtIFG_1916_1 11 48.4 14 0.595 n/a Pr009397094 n/a n/a RFLP Southern blot n/a 275 n/a Sewell et al. (1999) 9872970          
PtIFG_1916_2 7 60 12 0.441 n/a Pr009397095 n/a n/a RFLP Southern blot n/a 275 n/a Sewell et al. (1999) 9872970          
PtIFG_1916_4 8 62.8 11 1.907 n/a Pr009397096 n/a n/a RFLP Southern blot n/a 275 n/a Sewell et al. (1999) 9872970          
PtIFG_1917_A 8 68.4 29 0.83 n/a Pr009397097 n/a n/a RFLP Southern blot n/a 418 n/a Devey et al. (1994) n/a          
PtIFG_1918_3 3 54.03 19 3.20 n/a Pr009397098 n/a n/a RFLP Southern blot n/a 249 n/a Sewell et al. (1999) 9872970          
PtIFG_1918_A 6 42.5 16 0.334 n/a Pr009397099 n/a n/a RFLP Southern blot n/a 249 n/a Devey et al. (1994) n/a          
PtIFG_1918_b 10 not positioned 12 not positioned n/a Pr009397100 n/a n/a RFLP Southern blot n/a 249 n/a Devey et al. (1994) n/a          
PtIFG_1918_f 10 37.3 12 0.839 n/a Pr009397101 n/a n/a RFLP Southern blot n/a 249 n/a Devey et al. (1994) n/a          
PtIFG_1918_h 2 75.2 14 3.69, jump>5 n/a Pr009397102 n/a n/a RFLP Southern blot n/a 281 n/a Devey et al. (1994) n/a          
PtIFG_1A2_C 4 75.5 10 0.288 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_1A7_A 2 32.8 21 0.463 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_1D11_A 2 93.6 13 1.041 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_1D9_2 3 3.69 6 0.482 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2006_C 3 120.4 24 0.822 n/a Pr009397103 n/a n/a RFLP Southern blot n/a 159 n/a Sewell et al. (1999) 9872970          
PtIFG_2009_A 6 108.9 19 0.667 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2022_A 5 54.2 16 1.17 n/a Pr009397104 n/a n/a RFLP Southern blot n/a 974 n/a Devey et al. (1994) n/a          
PtIFG_2068_A 3 112.1 18 0.780 n/a Pr009397105 n/a n/a RFLP Southern blot n/a 382 n/a Devey et al. (1994) n/a          
PtIFG_2086_13 1 0.0 10 0.449 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Brown et al. (2001) 11606554          
PtIFG_2086_2 11 18.1 12 1.166 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Brown et al. (2001) 11606554          
PtIFG_2090_1 6 76.9 15 0.612 n/a Pr009397106 n/a n/a RFLP Southern blot n/a 206 n/a Sewell et al. (1999) 9872970          
PtIFG_2090_2 3 49.9 26 0.723 n/a Pr009397107 n/a n/a RFLP Southern blot n/a 206 n/a Sewell et al. (1999) 9872970          
PtIFG_2090_4 5 26.1 19 0.734 n/a Pr009397108 n/a n/a RFLP Southern blot n/a 206 n/a Sewell et al. (1999) 9872970          
PtIFG_2113_1 4 26.7 11 0.875 n/a Pr009397109 n/a n/a RFLP Southern blot n/a 133 n/a Sewell et al. (1999) 9872970          
PtIFG_2145_1 3 115.1 6 0.453 n/a Pr009397110 n/a n/a RFLP Southern blot n/a 156 n/a Sewell et al. (1999) 9872970          
PtIFG_2145_28 10 31.3 18 0.277 n/a Pr009397111 n/a n/a RFLP Southern blot n/a 156 n/a Sewell et al. (1999) 9872970          
PtIFG_2145_3 4 0.0 6 1.021 n/a Pr009397112 n/a n/a RFLP Southern blot n/a 156 n/a Sewell et al. (1999) 9872970          
PtIFG_2145_76 3 9.13 15 0.418 n/a Pr009397113 n/a n/a RFLP Southern blot n/a 156 n/a Chagne et al. (2003) n/a          
PtIFG_2146_2 1 75.9 26 1.692 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2150_A 2 12.5 12 0.35 n/a Pr009397114 n/a n/a RFLP Southern blot n/a 171 n/a Devey et al. (1994) n/a          
PtIFG_2197_1 11 95.7 8 0.68 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2220_A 5 90 33 1.575 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_2220_B 4 124.3 9 1.435 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_2253_A 1 47.9 33 2.838 n/a Pr009397115 n/a n/a RFLP Southern blot n/a 187 n/a Sewell et al. (1999) 9872970          
PtIFG_2291_A 6 29.4 13 0.415 n/a Pr009397116 n/a n/a RFLP Southern blot n/a 274 n/a Sewell et al. (1999) 9872970          
PtIFG_2295_2 5 110.4 8 1.387 n/a Pr009397117 n/a n/a RFLP Southern blot n/a 226 n/a Sewell et al. (1999) 9872970          
PtIFG_2323_A 9 27.9 16 0.252 n/a Pr009397118 n/a n/a RFLP Southern blot n/a 246 n/a Sewell et al. (1999) 9872970          
PtIFG_2361_2 7 80.7 12 0.801 n/a Pr009397119 n/a n/a RFLP Southern blot n/a 202 n/a Sewell et al. (1999) 9872970          
PtIFG_2393_1 1 102.4 16 0.719 n/a Pr009397120 n/a n/a RFLP Southern blot n/a 108 n/a Sewell et al. (1999) 9872970          
PtIFG_2413_b 7 100.6 8 0.918 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2441_1 1 95.2 16 0.428 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2479_1 9 15 11 0.246 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2530_A 4 43.5 8 0.941 n/a Pr009397121 n/a n/a RFLP Southern blot n/a 205 n/a Devey et al. (1994) n/a          
PtIFG_2538_5 8 131.2 6 0.456 n/a Pr009397122 n/a n/a RFLP Southern blot n/a 260 n/a Sewell et al. (1999) 9872970          
PtIFG_2538_B 2 21.7 25 0.26 n/a Pr009397123 n/a n/a RFLP Southern blot n/a 195 n/a Devey et al. (1994) n/a          
PtIFG_2564_A 2 33.2 20 0.7 n/a Pr009397124 n/a n/a RFLP Southern blot n/a 226 n/a Devey et al. (1994) n/a          
PtIFG_2564_B 4 52.2 19 1.157 n/a Pr009397125 n/a n/a RFLP Southern blot n/a 211 n/a Devey et al. (1994) n/a          
PtIFG_2568_A 8 94.4 33 2.612 n/a Pr009397126 n/a n/a RFLP Southern blot n/a 208 n/a Devey et al. (1994) n/a          
PtIFG_2574_2 5 107.3 9 0.649 n/a Pr009397127 n/a n/a RFLP Southern blot n/a 184 n/a Sewell et al. (1999) 9872970          
PtIFG_2574_c 5 99.1 11 0.218 n/a Pr009397128 n/a n/a RFLP Southern blot n/a 239 n/a Devey et al. (1994) n/a          
PtIFG_2588_1 3 86.46 28 1.50 n/a Pr009397129 n/a n/a RFLP Southern blot n/a 254 n/a Sewell et al. (1999) 9872970          
PtIFG_2615_1 11 7.1 17 0.642 n/a Pr009397130 n/a n/a RFLP Southern blot n/a 147 n/a Sewell et al. (1999) 9872970          
PtIFG_2697_A 1 11.6 17 0.336 n/a Pr009397131 n/a n/a RFLP Southern blot n/a 215 n/a Devey et al. (1994) n/a          
PtIFG_2718_1 3 30.9 12 4.87 n/a Pr009397132 n/a n/a RFLP Southern blot n/a 199 n/a Devey et al. (1994) n/a          
PtIFG_2718_2 4 77.8 10 3.111 n/a Pr009397133 n/a n/a RFLP Southern blot n/a 199 n/a Sewell et al. (1999) 9872970          
PtIFG_2718_3 3 74.5 23 1.38 n/a Pr009397134 n/a n/a RFLP Southern blot n/a 199 n/a Sewell et al. (1999) 9872970          
PtIFG_2723_1 12 60.5 12 1.152 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2723_Aa 6 65.5 5 0.261 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_2738_B 8 121 13 1.027 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_2745_1 3 63.6 22 0.930 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2782_2 5 79 18 1.822 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2782_31 1 58.4 28 2.266 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Chagne et al. (2003) n/a          
PtIFG_2802_3 6 16.3 7 0.139 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2885_1 2 10.5 13 0.276 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2897_d 3 108.8 19 0.377 n/a Pr009397136 n/a n/a RFLP Southern blot n/a 314 n/a Sewell et al. (1999) 9872970          
PtIFG_2899_A 9 116.3 12 0.28 n/a Pr009397137 n/a n/a RFLP Southern blot n/a 273 n/a Sewell et al. (1999) 9872970          
PtIFG_2931_A 1 103.4 18 1.756 n/a Pr009397138 n/a n/a RFLP Southern blot n/a 239 n/a Sewell et al. (1999) 9872970          
PtIFG_2933_12 5 44.7 26 1.127 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Chagne et al. (2003) n/a          
PtIFG_2957_A 8 21.3 16 1.453 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2963_1 11 53.1 12 0.841 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2963_3 5 0.0 9 0.967 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2969_1 11 32.8 13 0.607 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2986_A 2 92.3 21 1.012 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970 PtIFG_29B6_A        
PtIFG_2986_B 11 10 12 1.267 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_2988_21 3 34.1 31 1.39 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Chagne et al. (2003) n/a          
PtIFG_3006_1 2 71 11 1.558 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_3008_1 8 50 22 0.54 n/a Pr009397139 n/a n/a RFLP Southern blot n/a 296 n/a Sewell et al. (1999) 9872970          
PtIFG_3012_2 12 86.7 11 1.064 n/a Pr009397140 n/a n/a RFLP Southern blot n/a 256 n/a Sewell et al. (1999) 9872970          
PtIFG_3012_3 2 2.7 12 0.709 n/a Pr009397141 n/a n/a RFLP Southern blot n/a 248 n/a Sewell et al. (1999) 9872970 PtIFG_3012_43        
PtIFG_3021_1 10 not positioned 5 not positioned n/a Pr009397142 n/a n/a RFLP Southern blot n/a 219 n/a Sewell et al. (1999) 9872970          
PtIFG_3026_A 5 106.4 7 0.368 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_459_1 9 70.6 16 0.401 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_4D4_A 6 91.3 6 5.036 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_503_A 10 26.2 13 0.985 n/a Pr009397143 n/a n/a RFLP Southern blot n/a 238 n/a Sewell et al. (1999) 9872970          
PtIFG_606_1 6 98.8 11 0.611 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_616 8 116.4 17 1.327 n/a Pr009397144 n/a n/a RFLP Southern blot n/a 515 n/a Devey et al. (1994) n/a          
PtIFG_653_2 12 89 10 2.452 n/a Pr009397145 n/a n/a RFLP Southern blot n/a 226 n/a Sewell et al. (1999) 9872970          
PtIFG_653_3 11 80.7 11 0.266 n/a Pr009397146 n/a n/a RFLP Southern blot n/a 226 n/a Sewell et al. (1999) 9872970          
PtIFG_653_d 1 1.7 3 0.156 n/a Pr009397147 n/a n/a RFLP Southern blot n/a 226 n/a Devey et al. (1994) n/a          
PtIFG_658_A 1 79.9 30 0.837 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Devey et al. (1994) n/a          
PtIFG_66_1 2 77.9 10 1.239 n/a Pr009397148 n/a n/a RFLP Southern blot n/a 227 n/a Sewell et al. (1999) 9872970          
PtIFG_669 9 40.4 20 0.252 n/a Pr009397149 n/a n/a RFLP Southern blot n/a 185 n/a Devey et al. (1994) n/a PtIFG_669_b; PtIFG_669_c        
PtIFG_719_3 11 68.1 11 0.337 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_719_A 8 52.7 24 0.71 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_846 8 13.5 8 1.026 n/a Pr009397150 n/a n/a RFLP Southern blot n/a 562 n/a Devey et al. (1994) n/a PtIFG_846_a        
PtIFG_851_1 1 122.1 9 1.205 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtIFG_975_3 3 108.6 20 1.17 n/a Pr009397151 n/a n/a RFLP Southern blot n/a 483 n/a Sewell et al. (1999) 9872970          
PtIFG_975_4 4 5.8 5 1.066 n/a Pr009397152 n/a n/a RFLP Southern blot n/a 483 n/a Sewell et al. (1999) 9872970          
estPtIFG_dhn-1 8 26.4 13 0.566 n/a n/a ATCTGCACTCGCTCTTTGAT TAAGCAAATCCCTGAAGGAG ESTP DGGE n/a n/a n/a Gonzalez-Martinez et al. (2006) 16387885 estPtIFG_F4R5(dhn)        
PtIPST_pLP2 3 2.51 9 0.272 n/a n/a n/a n/a ESTP SSCP n/a n/a n/a Komulainen et al. (2003) 12827250 estPtIPST_LP2; estPtIPST__pLP2; estPtIPST_pLP2_a        
PtLP15 6 85.3 18 0.87 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPtX_LP15(A)        
PtLP3-1 2 67.4 11 4.32, jump>5 n/a n/a n/a n/a ESTP heteroduplexes n/a n/a n/a Cato et al. (2001) n/a estPtX_LP3-1(S); estPtIFG_LP3-1        
PtMTU_lpPAL 6 44.4 9 1.064 gb|BV729055 UniSTS:516061 TAGCCAAGAAAACCCTGAG ACTGATAGCGTCGTAAACCA ESTP DGGE n/a 496 n/a Brown et al. (2003) 12930758 estPtINR_PAL-1; estPtINR_1_a; PALI-F3+R3-NlaIII Primer sequences obtained from http://www.pierroton.inra.fr/genetics/pinus/primers.html.      
PtNCS_1CA4G 8 27.1 19 0.389 n/a n/a TAAATGAGGTGCTCTTACAA GCAAACTTCTAGCCACTTA ESTP SSCP n/a n/a n/a Komulainen et al. (2003) 12827250 estXUOU_thymsynt        
PtNCS_3H6z5_A 4 103.7 25 4.14 n/a n/a n/a n/a RFLP Southern blot n/a n/a n/a Sewell et al. (1999) 9872970          
PtNCS_HLH1 8 0.7 8 1.314 gb|BV728993 UniSTS:516072 ACAGTTTTGGCACCTCTCA ATTCTTTTGCACGCTTTCTT ESTP SSCP n/a 851 n/a Komulainen et al. (2003) 12827250 estPtNCS_HLH1        
PtNCS_p9myb1_21 7 64.7 8 0.278 n/a Pr009397153 n/a n/a RFLP Southern blot n/a 461 n/a Sewell et al. (1999) 9872970          
PtNCS_PtaAGP6 5 9.8 12 1.663 gb|BV728991 UniSTS:516070 TCAGGGTCAACAATGGCGTTC GGGCTTTTCAGTGCGGACG ESTP DGGE n/a 560 n/a Brown et al. (2003) 12930758 estPtNCS_AGP6-3p; AGP6-F1; PtNCS_PtaAGP6_1        
PtNCS_ptCadA 9 108.96 14 0.539 gb|BV728994 UniSTS:516073 ACGTGACGGTTATCAGTTC AAGACTTGCCATTGGATTA ESTP SSCP n/a 686 n/a Komulainen et al. (2003) 12827250 estPtNCS_ptCadA; PtNCS_CAD-08_A        
PtRIP_0022 7 104.4 7 0.19 gb|BV683041 UniSTS:513453 CTCAGTTTCATAATCTTTGTCGC TTTTAGAAAAGAAGGAAATCTTCA SSR CE (ACC)6(TCA)4 250 248 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0032 7 74.3 13 0.55 gb|BV683044 UniSTS:513456 TAGCAGGTTACAACCTGGGG AGCCCAATTGATGGGAAATT SSR CE (TAT)7 188 184 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0064 1 95.6 24 0.52 gb|BV683046 UniSTS:513458 GCAGCGTAATCAGATGGTCA CGGAAGGCGAGTTGAAGATA SSR CE (A)6, (A)5(AAAC)5(A)5 258 265 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0065 2 6.4 19 0.47 gb|BV683047 UniSTS:513459 CCAACAGCACTTACCCAAAA AGCCTCATGAAAGCCCAGTA SSR CE (AAAC)5(A)7 142 131 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtRIP_0066 7 62.1 10 0.92 gb|BV683048 UniSTS:513460 GTTGATAGAGTTTCATGTGGTGC TGGATGAAGAATTTTGTAGTCAA SSR CE (AAAT)8 114 94 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0067 5 41.4 33 1.3 gb|BV683049 UniSTS:513461 AGCCCTCCAAGACCAAGATT CCATTTGCAAATACCCCAAC SSR CE (AAAT)4 227 223 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0079 12 43.5 15 2.65, jump>5 gb|BV683053 UniSTS:513465 TGATTTGATCCCTCTAGGCG AATCTTGAAAAGAAATTCAATATGAGA SSR CE (ATT)12 153 131 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0103 7 106.2 10 0.26 gb|BV683057 UniSTS:513469 CCCCTTGGTGGAACAACATA TTGGAAAATGGCGGAATTTA SSR CE (TG)26, (AG)6 210 181 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele, and 1bp allele.
PtRIP_0106 11 90.1 7 0.19 gb|BV683059 UniSTS:513471 ATCAGATTGGTGGATCGGAG TGACTGATAAGGGTTTCGCC SSR CE (AT)7, (TA)8(TG)11, (GT)9 180 168 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0117 12 10 10 0.96 gb|BV683060 UniSTS:513472 GCTTCATGATTTCTCGATCG TCTGCGTGGATAAAGGAATTT SSR CE (AC)12 208 229 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0126 3 59.6 37 1.01 gb|BV683062 UniSTS:513474 TCATACCGAGAGAGGTCTTTG GAGCTTAATTTGTGCCTGCC SSR CE (TG)12, (TG)5 174 165 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0134 3 19.6 34 1.42 gb|BV683065 UniSTS:513477 GTTTACATTTTCCTGGGGCA GATTTACAAAAATCCCTGCCA SSR CE (AC)15 145 139 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0135 10 46.6 20 0.277 gb|BV683066 UniSTS:513478 CACGCATGAGCTGAGTCATAA TGTGTTTCCCACTATGCTAAGC SSR CE (TG)41 218 202 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0158 1 105.9 21 1.48 gb|BV683068 UniSTS:513480 GTGTGCCACGGATGTATGAG TTGCTGAAAGGGCCAGTAGT SSR CE (AT)7(TG)13 211 212 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0165 10 63.4 16 1.295 gb|BV683070 UniSTS:513482 TGGAAGCCACAATTTGTTGA TGCAATAAAACCATGCAACAA SSR CE (TC)27(AC)11 220 202 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0171 10 35.7 23 16.1 gb|BV683072 UniSTS:513484 TGATCCTAAGCCTTAGAAACCC TTTTGTCACCCATGCATATGA SSR CE (TG)15 207 197 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0179 3 30.4 21 12.5, jump>5 gb|BV683073 UniSTS:513485 TGTAGGAGCACAAGCCATTG AACACAGTTGGACCGTTTGA SSR CE (ATT)8 170 166 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtRIP_0211 1 17.7 18 0.5 gb|BV683076 UniSTS:513488 GAGGGGGTCTCATACACCAA TGCATAGAGGATGTATTTCTTGGA SSR CE (ATA)13 159 142 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0255 10 117.9 4 5.477 gb|BV683147 UniSTS:513489 TCCTCCTGAGTGGTCCCATA TATGGATATGAGGCCTGTTGG SSR CE (AAT)8, (AAAAT)5 123 132 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0263 11 30.8 11 1.31 gb|BV683148 UniSTS:513490 TTGGATTGGACCTGAATCAA TTGGCAGTCTTCGAGGTCTT SSR CE (AAAT)6 183 154 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0287 11 0.5 15 1.33 gb|BV683077 UniSTS:513492 GGAATGTATTCCCGGTTCCT CTCCCGGATATTGAGGAGGT SSR CE (TTTA)5 224 218 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0305 10 25.0 20 0.406 gb|BV683080 UniSTS:513495 TCAATCACCAATTATTTGGCT GGAGTGGATGAAACTATGCCA SSR CE (TTC)6, (CTC)6 230 226 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtRIP_0367 1 61.7 27 1.6 gb|BV683081 UniSTS:513496 CCAATGCATAATGCAACCAC TAGCCATGGTGCTCAGTCTG SSR CE (TG)9, (TG)10 209 190 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0376 4 2.7 6 0.08 gb|BV683083 UniSTS:513498 AGGAATTGGTGATTCATGTGG ATAAAAGAATCGGCCCTGGT SSR CE (AC)14 189 180 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0388 9 68.7 22 1.1 gb|BV683084 UniSTS:513499 CACAACACTCAAACATGCTCAA AAGAGGATGTGAGGTCCCAA SSR CE (AC)12 203 193 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0496 5 16 22 1.61 gb|BV683151 UniSTS:513501 GTAAGAGTGCCTCGGGTCTG GGTGGTAGGTAGATCGGCAA SSR CE (TG)12 203 202 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0508 2 78.3 21 0.8 gb|BV683085 UniSTS:513502 GGCACAGGTTGGACATCTCT GTGGTGGAAGGGAGATTTCA SSR CE (CA)11 90 81 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0540 1 51.6 10 0.65 gb|BV683152 UniSTS:513504 TGTTGTCATTAGTGGTAGGATCA AAGCGATGTCACTTGTTGAGAA SSR CE (CA)10 200 204 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0560 11 67.7 18 0.53 gb|BV683088 UniSTS:513507 CATTGGAACTTCACCGAAGG GTGCTATTGGGTCCAGCAAT SSR CE (AC)18, (AT)6 108 86 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0567 6 6.8 14 2.6, jump>5 gb|BV683089 UniSTS:513508 GTTGGTGAGGAGACTTGGGA AAGAACAATTCCAATATGGATGA SSR CE (AC)16, (TG)6 152 140 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0609 6 36.7 12 1.95 gb|BV683090 UniSTS:513510 CAAAATGCAGAGGGGCTTAA CCAGTCCATCGAATCACGTA SSR CE (AC)12 154 143 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele, and 1bp allele.
PtRIP_0619 6 33.2 16 0.94 gb|BV683091 UniSTS:513511 CAGCTCTCTTAATAGCCTCGG GCACATAGCAACGCTGAAGA SSR CE (TG)14 191 199 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0621 10 63.42 16 n/a gb|BV683092 UniSTS:513512 GCAAAGGGAAGCAAAGTCAT TTCGTCCTCTTTTGAACGAGT SSR CE (TG)15(AG)13 154 197 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0627 5 89.6 22 3.05 gb|BV683093 UniSTS:513513 GACAAACAACCCTTGCGTTT GACCCATCAAGCCAACATG SSR CE (CA)13 168 169 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0630 5 19.3 19 0.27 gb|BV683095 UniSTS:513515 CGCAAGCTATGATACAACGC TGTTGGCTGAGTGTGAAAGC SSR CE (AC)12 157 151 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0647 10 43.8 17 0.310 gb|BV683097 UniSTS:513517 TGGCCATCGAACTTGTGTTA CACGACCACCAGTCACCTTA SSR CE (TG)14 214 215 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0649 3 31.8 31 9.6, jump>5 gb|BV683098 UniSTS:513518 TAGTCGAATCGGGCCTGTAC TTGCTCCTCTGTGTCCTTCA SSR CE (GT)15 218 205 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0658 8 102.4 8 4.63, jump>5 gb|BV683099 UniSTS:513519 TGCATGCATTACAAATGTCA CGCTTTTAAATCAACCAAACG SSR CE (TG)13 219 216 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0675 8 12.6 20 22.2, jump>5 gb|BV683100 UniSTS:513520 ACAGATGTCAAGGCCAAAGG CTGCATTCAAATTACCCGCT SSR CE (AT)6(TG)12 172 165 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0683 8 64.5 19 0.95 gb|BV683101 UniSTS:513521 TGAAACCAATCCTTCTGCAA CTGATTCCTCTGGCTTCTCG SSR CE (TG)13 187 184 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0689 8 19.1 21 2.34, jump>5 gb|BV683103 UniSTS:513523 GAAACTTTCCCCTACGAGCC TTCCCCAAAAGTTCACAGGT SSR CE (TG)11 158 148 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0700 8 124.3 15 0.42 gb|BV683106 UniSTS:513526 TTGCAATTGCGATTAACTGC ATAATGGCATAGCCGAATCG SSR CE (AC)15 180 183 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0789 8 45.1 28 0.26 gb|BV683108 UniSTS:513528 CATCCCAAGCATCCTCAAGT TCAAAAATGTGGTTTAATGGAAAA SSR CE (CA)18 170 183 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0790 1 26.8 17 0.64 gb|BV683109 UniSTS:513529 TTGTGAATTGTGTCCATGGG ATCGGTGAGGCTTAAACACG SSR CE (CA)26(AT)4 182 163 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0791 4 33.9 8 0.22 gb|BV683110 UniSTS:513530 ATGGAAGGATCCACAACCAA GGGCTTGTTGCTGGTCTATG SSR CE (AT)4(TG)15 168 161 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0814 5 94.6 21 1.84 gb|BV683112 UniSTS:513533 AAAAAGAATGAGGCGCACAC CCCGTTTATGGCATTGATTC SSR CE (AC)12, (AT)9 100 83 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0841 8 74 27 1.42 gb|BV683113 UniSTS:513535 GTGCTTCCCTTGCTTCAGAC GCAAATGCAAACTTTGGGTA SSR CE (CA)17 202 196 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0846 8 74.1 22 2.82 gb|BV683114 UniSTS:513536 CATTCATGGTTCCAATGTGG TGATAAGCGTGGATCTCGTG SSR CE (AT)8(TG)15 109 94 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0852 8 59.3 26 1.42 gb|BV683115 UniSTS:513537 GTTATCCCCCATGTTGTTGC GGGTAGAAGCACTATGCTTTCATT SSR CE (TG)18 213 202 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0860 12 16 11 0.97 gb|BV683116 UniSTS:513538 TTGAGCAGACATCATCAACACT CCAGGTTATGCCTCAAAGAG SSR CE (TG)13 217 214 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0905 12 33.2 12 0.75 gb|BV683117 UniSTS:513539 CACGGATCTCTGGAAACCAT CGCTGGTTTCCCTCAGAATA SSR CE (AC)16 194 209 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0932 5 8.3 5 5.71, jump>5 gb|BV683119 UniSTS:513541 GCAAGACCGACTGGATTAGC GAGGTCATGATATGTGGTGGG SSR CE (TG)6, (TG)7(GT)8 130 122 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0941 2 63.5 22 1.05 gb|BV683120 UniSTS:513542 CTGCGTAGCAAATCACTGGA TGATCTGATGTGGGATCAACA SSR CE (AT)6(TG)10 151 153 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0958 2 133.8 9 1 gb|BV683122 UniSTS:513544 TGGAGTCTCGAACACTGTGG AATCATCCCAATGGCAACAT SSR CE (AC)15 111 98 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtRIP_0960 6 97.2 22 0.85 gb|BV683123 UniSTS:513545 GCATCCATCTTCAGCATCCT TTCATACGACACCTTTGAAATG SSR CE (AC)18, (AT)4 188 180 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0968 2 67.5 30 1.27 gb|BV683124 UniSTS:513547 TCTACGACAAAACCACGTAGTG CATGTGGCTTTGTGGCATAT SSR CE (TG)22 201 196 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0984 1 72.3 26 2.26 gb|BV683125 UniSTS:513548 TGTGACCTGAAAATTCCCCT GGCTTGCAACCAGTTCCATA SSR CE (TG)18 220 216 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_0990 6 57.9 29 2.13 gb|BV683126 UniSTS:513549 GACCTAAAGAGGTTCACGCG TCAAATCTTGGGTTAGTATGCAGA SSR CE (CA)25 220 207 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1023 12 4 9 0.64 gb|BV683128 UniSTS:513551 GAACCCGATGGATTTTCAAA CAAACTGTAAGCTCAGGAGGA SSR CE (AC)18 175 153 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1027 1 62.1 19 1.48 gb|BV683129 UniSTS:513552 CAGTGTTGATTGTGTGCCAG TCTGCCACAATTTGGAAACA SSR CE (TG)7, (TG)12 220 218 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1035 10 28.8 18 0.452 gb|BV683130 UniSTS:513553 AGCATAATGAGCCCTTCTCG AGAATATGTGTCCCTCCCCC SSR CE (GT)11 174 170 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1036 12 51.9 24 2.18 gb|BV683131 UniSTS:513554 TGGTTGTGCGAGATCACAAT TTGAGGGAATTGAAATTGGG SSR CE (GT)29 211 184 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1037 10 72.0 4 6.062 gb|BV683132 UniSTS:513555 TGCTCAATATAGACCACTTGCA AGCCATAATTCAACAAAAGGAA SSR CE (GC)5(CA)12 152 145 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1040 2 46 22 0.3 gb|BV683133 UniSTS:513556 TCAAGGAATTCATTGGAGCC TTTGGCCATATCAAACCCAT SSR CE (TG)11 192 191 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1072 1 107.1 16 0.96 gb|BV683135 UniSTS:513558 TTTCATGACCTTGGAGTGGA ATTGATCCCATTGTTGCTCC SSR CE (CA)15 209 213 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_1077 4 5 10 0.14 gb|BV683137 UniSTS:513560 AACATTCTAGCATGCCCCAC TTGTGGTGGATGTCTCTCCTC SSR CE (TG)15(AT)6 220 219 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_9138 12 0.0 5 0.46 gb|BV683142 UniSTS:513565 TGAAACCAATTTTTCCCCTTT CCAAGAAAGACAAGGAGCCA SSR CE (TGA)5 229 226 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtRIP_9315 2 32.4 28 0.71 gb|BV683144 UniSTS:513567 GGCTTAGGCATAGAGGGACC AACAAGTTGGAAGCCACCAT SSR CE (TG)13 219 207 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0100 not mapped not mapped not mapped not mapped gb|BV728771 UniSTS:516239 CGTATTTTGCAGTATTCATACCA TCAAGAATCGGTGGGCTATC SSR CE (AT)19 187 173 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0126 12 44.3 5 0.8 gb|BV728738 UniSTS:516240 AGAAAAATGTATGGGCGTGC TTTTTGGAGGAATGATTGGC SSR CE (AT)8 207 205 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0133 not mapped not mapped not mapped not mapped gb|BV728783 UniSTS:516241 TTATGAAGGCTTGGATTGGC GCAAAGCCTTTCAGTCCTCT SSR CE (TA)9 367 494 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0141 not mapped not mapped not mapped not mapped gb|BV728774 UniSTS:516242 TTCTCAGGAGATTCTCAGCG GGGTTTGATTTCTGGCTTCA SSR CE (AT)18 113 116 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0145 1 65.2 23 4.41 gb|BV728739 UniSTS:516243 GGGTCTATATCCCCACGGTT GCCTTGAGAAACAGCCAGAC SSR CE (TA)10 267 267 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_0166 9 0.0 3 0.39 gb|BV728653 UniSTS:516244 ATCCGACCCATGTTCAATTC AGTTCCTGCACGAGTAACCG SSR CE (AT)11 222 223 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0167 3 117.6 23 1.29 gb|BV728654 UniSTS:516245 TAGAGAACACAGGCCAGGCT GCCCATAGCGACCTAACAAG SSR CE (AT)10 195 302 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0168 5 4 13 0.52 gb|BV728740 UniSTS:516246 GGTTTGAACCCAGGTCGATA CATCGAAATGAGGGGAAGTG SSR CE (TA)8 350 348 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0174 12 81 18 0.53 gb|BV728655 UniSTS:516247 GCCACCTCTGTTTTCTCAGC ATGAGAACACGCCACCATTA SSR CE (TA)11 318 318 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0186 5 30 6 7.13 gb|BV728741 UniSTS:516248 ACCCACATGGGATGATGTTT ATGGAAAAGACAGGGCATTG SSR CE (TA)9 221 217 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0193 11 0.0 6 5.95, jump>5 gb|BV728742 UniSTS:516249 CCCATGCATCAATTCAAGTT TGTGCGTGGATATGGAAAAA SSR CE (AT)8 238 230 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0198 not mapped not mapped not mapped not mapped gb|BV728724 UniSTS:516250 ACCTACTTGTGAGGGGCCTT CCTGCTCCTCAAGTCCAGTT SSR CE (TA)8 277 276 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0203 7 121.9 10 0.38 gb|BV728743 UniSTS:516251 GATGGCTACTGTTCGGTGGT GGAGTACAGTGAGCAACTGAAGG SSR CE (TA)8 118 110 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0206 1 98.1 26 3.95, jump>5 gb|BV728656 UniSTS:516252 GCATACGAGAGAGGAGTGCC GCTACCAAGCTCAAAGCAAA SSR CE (AT)13 392 381 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_4381.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0209 10 30.1 10 1.00 gb|BV728744 UniSTS:516253 CTGCATCTTCTCCAATGCAA CCCATAATCCACAGACCGAT SSR CE (AT)10 215 208 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0219 8 11 9 0.88 gb|BV728745 UniSTS:516254 AGGCTGCTTGCATGAGAAAT GGAAGCAGAGGCATCTCAAG SSR CE (TA)9 129 121 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0237 12 22.4 15 1.38 gb|BV728657 UniSTS:516255 GATCCCGAATCTGCGTAGAA TCGGATCCACATTCACAAAA SSR CE (AT)13 385 383 Echt et al. (this paper) n/a   F primer tested as GATCCCGAATTTGCGTAGAA.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0245 8 70.9 21 12.58 gb|BV728746 UniSTS:516256 TTTCAAGGGTGTGAGCACTG GAGGAGGAAGAAGGTTTGGG SSR CE (GCC)7 195 183 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0249 not mapped not mapped not mapped not mapped gb|BV728720 UniSTS:516257 GGCCTGCAACAAAATGAAAT CCCTCTGAAAGCAGAATTGC SSR CE (CAG)5 303 297 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0265 4 53.9 12 7.02, jump>5 gb|BV728747 UniSTS:516258 CTGCTCATCATGCTTTTGGA GAAGCCCTCAAGTGTTCTGC SSR CE (CAG)5 405 395 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1035. F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0306 not mapped not mapped not mapped not mapped gb|BV728728 UniSTS:516259 ATCGGTGTTCCAGGATTGAG GTATTCCCTGGGGTGATCCT SSR CE (GCA)6 433 269 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0307 not mapped not mapped not mapped not mapped gb|BV728772 UniSTS:516260 AGTAGCTTCGAGGACCGACA TCATAAGAAGGGATTTGGATTGA SSR CE (ATG)5 305 301 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0338 not mapped not mapped not mapped not mapped gb|BV728719 UniSTS:516261 TGCTTTCGCTGACCAATAGA AGCATTACAGGCATTGGAGG SSR CE (TGA)5 269 267 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0349 10 11.3 9 0.974 gb|BV728658 UniSTS:516262 AATTGCAGAGAGGGTGATGG CAGCCCCATTAAGGACAGAA SSR CE (TAA)7 416 414 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0371 10 not positioned 8 not positioned gb|BV728748 UniSTS:516264 TGAGCAACTCCAGATCTCAAA GGTCTCTTGGTGCAGGGTTA SSR CE (AGC)5 411 408 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0408 9 58.1 17 0.85 gb|BV728749 UniSTS:516265 ACATCCCTCAATCATGCAAA TGAGGCCAAGCTCGATAACT SSR CE (TAA)5 323 316 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0418 not mapped not mapped not mapped not mapped gb|BV728722 UniSTS:516266 TTACGATACCCGACTCTGGC ACCCCACTTATATCCCCAGC SSR CE (AGG)5 246 243 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0424 12 8.5 13 0.61 gb|BV728750 UniSTS:516267 CAGATTTGGGGGAACGTAGA ACGGACGCTTCGAGATCTTA SSR CE (CTG)7 374 368 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0436 not mapped not mapped not mapped not mapped gb|BV728768 UniSTS:516268 TGACCCTCCTGTTGTTGTGA TTGGAGTTAGGCTCCGCTAA SSR CE (TGT)6 418 415 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0437 3 36.09 7 7.64 gb|BV728751 UniSTS:516269 TCTATGATGGAAGGCCCAAC GTTCTGCTTGCCCTCTCAAC SSR CE (CTG)6 180 176 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_0541. F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_0440 8 99.9 24 0.55 gb|BV728659 UniSTS:516270 CTGATCGAATCTTCCCCAAA AGTTCCAGTTGGGTTTGCAC SSR CE (GCG)6 314 309 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0443 not mapped not mapped not mapped not mapped gb|BV728729 UniSTS:516271 GATCCCTGTGCCAAAAATCT AAAATATGTCTACCGGGGGC SSR CE (TAA)6 104 97 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0463 1 5.3 3 0.19 gb|BV728660 UniSTS:516272 GCGAGCAAATTACTTCGTCC CCCTGCACAAGTAGTCACGA SSR CE (TGC)5 449 445 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1041.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0477 not mapped not mapped not mapped not mapped gb|BV728770 UniSTS:516273 GCCACAAAAGAAGATCCAGC CATTCCCCCTCTCAATCTCA SSR CE (AAT)5 173 168 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0490 not mapped not mapped not mapped not mapped gb|BV728784 UniSTS:516274 CCAATTGAGGCAAAGGTCAT CGAGAGGTGAGCGAGGTAAC SSR CE (ATA)5 367 365 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0493 2 5.3 19 1.11 gb|BV728661 UniSTS:516275 GAGAACATCTGCCTTGAGCC CTGGCATGATGGGTTTCTCT SSR CE (CTG)6 298 289 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0551 10 6.044 14 0.424 gb|BV728752 UniSTS:516277 ATCATGTGTGCACTTGCCAT TGCTGTTTGTGAGCACCTTT SSR CE (AAAAAT)4 460 444 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0561 12 93.8 11 1.13 gb|BV728753 UniSTS:516278 GCCAACTGCAATAACAGCAA CCGGCAAGAGCATCATTATT SSR CE (GCAGAA)4 434 434 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0563 not mapped not mapped not mapped not mapped gb|BV728782 UniSTS:516279 TACACAGAAGCCCCATAGCC CGAGAGCCCTTATTACGCAG SSR CE (TGGCC)4 354 254 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0564 11 52.3 18 0.97 gb|BV728754 UniSTS:516280 CATCTTCTTCCTCTCTGCGG ATTATTGTTGCCCGTGGTTG SSR CE (ATTT)4 467 464 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0566 1 25.1 9 2.09 gb|BV728755 UniSTS:516281 ACTTAGTGGGAAAGGGGGAA TTCCTCAGCCAAAAGCTCTC SSR CE (GGGAAG)4 107 109 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0573 not mapped not mapped not mapped not mapped gb|BV728775 UniSTS:516282 GCATGAGTTTCTGATGAGGGA TGGTGATTGGTTATGCTTGC SSR CE (AATT)4 486 482 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0587 8 115.1 10 0.85 gb|BV728756 UniSTS:516283 TACGGTCACACTTCACCCAA TCCTCCTAGTGCAAATGGCT SSR CE (CTTCAT)4 286 282 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0592 11 44 19 1.25 gb|BV728662 UniSTS:516284 TCGGACGAATGCGAAATTAT CCTGGTGTTGCCTGAAAACT SSR CE (CACACC)4 401 395 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0594 3 61.6 24 7.74 gb|BV728663 UniSTS:516285 ATGAGGAGGAACGTTTGGTG TGGCAATGGCATTACGAATA SSR CE (CCTTGA)4 381 375 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0596 12 28 11 1.16 gb|BV728664 UniSTS:516286 GACTGAACTCTCCCTGTGGC GATGGGTTTGAGATCGTGCT SSR CE (AATA)4 344 335 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_0625 3 65.4 17 2.66 gb|BV728665 UniSTS:516287 TAGCAGTGCACCGAAGTCAC TTCTCCCAGTGGAGTTTTGG SSR CE (TGCA)4 391 385 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0629 9 30.7 13 0.44 gb|BV728666 UniSTS:516288 CATGGGCGAGATCAAGAGAT GAAAGGAAAGGAAACCTCCG SSR CE (AACGGA)5 143 131 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0635 6 57.7 22 0.72 gb|BV728757 UniSTS:516289 AAATGTGAAGGGTTTGCCAC CAATCCATGTTGTGCTCCAG SSR CE (GATA)4 416 418 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1274. F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0636 not mapped not mapped not mapped not mapped gb|BV728769 UniSTS:516290 CAGCGGCAGTACATGAAAAA AGGTTGCGAAAGAAAAGCAA SSR CE (GACTG)4 289 285 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1271. F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0639 not mapped not mapped not mapped not mapped gb|BV728708 UniSTS:516291 ACGGCAAAATATCCAAGTCG TGAGAGTTGAGGTAGGGGAA SSR CE (AATA)4 491 485 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0640 3 63.7 34 1.88 gb|BV728667 UniSTS:516292 GCGACATCGATTTTGGTTTT TGTCAATCAATACTGGGAATAAA SSR CE (ATCTGT)4 362 345 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0652 8 26.5 15 0.22 gb|BV728668 UniSTS:516293 TTCTCAGAATTTGCTGGGCT TGCTATCATCGGAATCTCCC SSR CE (GCA)4(AGCAAG)4 152 142 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0653 not mapped not mapped not mapped not mapped gb|BV728727 UniSTS:516294 AATGCTTCCATCCATTCAGC TTCTGGGTACATGCCTCTCC SSR CE (TC)4(AAAC)4 389 379 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0662 not mapped not mapped not mapped not mapped gb|BV728711 UniSTS:516295 CATCCACCCCTTCTCTTCAA TTTGAATGAATGCTCTCCCA SSR CE (AGTCGC)4 474 465 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0668 not mapped not mapped not mapped not mapped gb|BV728779 UniSTS:516296 TAATCGCCTATGTTCAGGGG TGTCATCCGGAGTTAGCACA SSR CE (GAG)4(TAAA)4 364 384 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0715 5 56.4 30 n/a gb|BV728781 UniSTS:516297 TTCTTTTGAGGGATTGGACG GGAAATGGCATCATTGCTTT SSR CE (AT)21, (CTT)5(AGC)5 234 225 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_0737 10 not positioned 3 not positioned gb|BV728669 UniSTS:516298 GCAAGGGGAATTGCTTATGA GGGATCGCATCAGCTGTAAT SSR CE (CAG)6 (CAGCAT)6 429 424 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0740 3 61.4 34 1.79 gb|BV728670 UniSTS:516299 CCAAGAAACGTGCAAGGAAT TGGTACTGGAGATTCTGGGC SSR CE (AT)18(TA)13 354 331 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_0745 10 0.0 11 1.196 gb|BV728671 UniSTS:516300 AAGAAGGGCGGACTAGGAGC GTGAACCCACAATTCCCAAC SSR CE (AGGTTG)4(GGCTGA)5 480 479 Echt et al. (this paper) n/a   F primer tested as AAGAAAGGCGGACTAGGAGC.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1005 7 89.4 13 0.61 gb|BV728672 UniSTS:516302 GACCTGCCTTTAATTATATTCATCG TACAATTGTGTGAGCGTCTCG SSR CE (TTTCC)4 142 132 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1008 not mapped not mapped not mapped not mapped gb|BV728723 UniSTS:516303 CCCTCAAAAACACGTAGACGA TCTTGCATTCCACATTTCACA SSR CE (GAC)7 199 195 Echt et al. (this paper) n/a   Duplicates UniSTS marker SsrPt_ctg7024, PtSIFG_1069, PtSIFG_1008.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1018 11 85 10 0.7 gb|BV728673 UniSTS:516304 CTCGTTGTGGCTGGTATTTGT CTCTTCTGCACGATATCTCCG SSR CE (CGG)6 317 311 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1051, SsrPt_BF778306, RPtest8   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1030 not mapped not mapped not mapped not mapped gb|BV728702 UniSTS:516305 TGAATTTCACAAATACACTAAAGGTT CACCGGTTGTGCTAATGAGAT SSR CE (ATTT)3 184 179 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1032 not mapped not mapped not mapped not mapped gb|BV728714 UniSTS:516306 TTTTGTTTGGGTTCGTCTGTT TGAGACCATAAGAGCAGCGAT SSR CE (CAG)3 285 282 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1052 2 81.9 13 1.86 gb|BV728674 UniSTS:516310 GGTCGAATCAAATTGGGAAAA GGAAAAATCTATGCCTACGCC SSR CE (TC)6 122 116 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1055 5 82.6 25 0.5 gb|BV728675 UniSTS:516311 CGGAGAAAACAGCCAGTATCA TTTGAGCATTGTTTTGCTCCT SSR CE (AGA)5 109 102 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_1060 not mapped not mapped not mapped not mapped gb|BV728696 UniSTS:516312 GAAAATCCGGACGAAAACAGT GTGTCATCTGGCTTCTGCTTC SSR CE (AT)8 182 176 Echt et al. (this paper) n/a   R primer tested as TGTGTCATCTGGCTTCTGCTTC.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1062 9 59.5 13 1.09 gb|BV728676 UniSTS:516313 ATTGAAAAATACAGCGGCTCA GCGAGCCACAGTTGATTATGT SSR CE (TA)9 209 205 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1065 12 81.4 12 0.51 gb|BV728677 UniSTS:516314 AAACTTACAGTCTCGTCGCCA CACTCTTCTGGTTGTGCATGA SSR CE (AT)6 103 98 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1066 not mapped not mapped not mapped not mapped gb|BV728706 UniSTS:516315 GACAGATGCCCATACAACAGG TCTCTTCGCGCAAATTATACTC SSR CE (AGC)5(CAA)3(CAG)4(CAA)3 132 122 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1102 not mapped not mapped not mapped not mapped gb|BV728715 UniSTS:516317 ACGGAGATATATTGCAGGCG AAAGAATAACCTGAAACAAACCC SSR CE (TA)16 119 140 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1110 not mapped not mapped not mapped not mapped gb|BV728703 UniSTS:516318 GGACAGTCCTTACTGCCCAA CCCATGGTTTTCCATTGTTC SSR CE (AT)26 182 152 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1113 11 13.1 8 0.48 gb|BV728678 UniSTS:516319 TAATAATTCAAGCCACCCCG GGGTTGCAGCCTCTGAAATA SSR CE (AT)10 121 111 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_1002.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_1123 8 3.1 12 9.56 gb|BV728758 UniSTS:516321 TGGTTCAACGGAAACCCTTA GTTTTCTCAGCCTTGCGTTC SSR CE (AT)8 118 108 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1166 3 19.9 8 1.49 gb|BV728759 UniSTS:516322 CCTGTTCGGACTGCTGAGAA CCTCTGAGCCTTCAAAGAGG SSR CE (AGG)5 320 318 Echt et al. (this paper) n/a   F primer tested as CATGTTCGGACTGCTGAGAA; R primer tested as CCTGTGAGCCTTCAAAGAGG. F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_1184 not mapped not mapped not mapped not mapped gb|BV728698 UniSTS:516324 AAGCCCTTGCACTTTGTGAG CCTCTTTTCTTTCAATCTTTGCC SSR CE (AAG)7 147 140 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1185 not mapped not mapped not mapped not mapped gb|BV728716 UniSTS:516325 GATTATCCACGGCGAAAAGA GGGAATTCGACCTGTGAAGA SSR CE (AGC)7 379 377 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1190 9 76 14 0.93 gb|BV728679 UniSTS:516327 CAGGTGGCTTGGATTTCATT TCATTCAAGCGTCCTGCTTA SSR CE (TCC)7 290 284 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1207 2 10.7 12 0.38 gb|BV728789 UniSTS:516328 TTGAAAGACCTGAGGGAACG ACAGTGCTTCAACGTGCATC SSR CE (TTA)6 221 214 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1212 5 22.1 2 0.21 n/a n/a CCGGAAACATCTCTTTGGAA TGCCACTTTAATTCCATTCCTC SSR CE (TTA)6 314 315 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1217 not mapped not mapped not mapped not mapped gb|BV728713 UniSTS:516329 TAAATTCAGTTGGGCCCTTG GATCAATCATGGCTGCAGAA SSR CE (GAA)5 187 183 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1241 not mapped not mapped not mapped not mapped gb|BV728726 UniSTS:516330 CCTCGCTGCCAATTTGTTAT AAAGTTGCATCTCCGAATTG SSR CE (CGGTGG)5 169 155 Echt et al. (this paper) n/a   R primer tested as AAAGTTGCATCTCCGAATTG.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1252 2 1 7 0.72 gb|BV728680 UniSTS:516331 AAGCCCCTTCCTCGTACATT CCAAGTGAACACCATCATCG SSR CE (GCTGAT)4 370 357 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_1260 8 62.9 9 1.09 gb|BV728792 UniSTS:516332 TTCAGTGATTTTACTCCTTCGTTG GATTATTGCAAGGAGGGGATG SSR CE (TTCCT)4 108 102 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1262 8 122 10 0.37 gb|BV728681 UniSTS:516333 AGGCGAAAAGATTTGAAGCA TCCTTAAGCCGATCAACGAC SSR CE (AAGAA)4 403 490 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_1295 not mapped not mapped not mapped not mapped gb|BV728699 UniSTS:516335 TTCGGCTCTATCTCAGGGAA GATTGTGATTGAGGTTGGGG SSR CE (CAA)5 267 259 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1318 5 103.5 8 0.51 gb|BV728682 UniSTS:516336 GGACTGGCAAAACTGTTCGT AAGACGAAGATGAGCCCAGA SSR CE (AT)6(TCT)5 242 238 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_1325 2 11.4 19 0.72 gb|BV728683 UniSTS:516337 GCGTGGAGGTTACACCAAAC TTTTCCGCTGGATTTACCAC SSR CE (GAT)10(TGA)5 302 298 Echt et al. (this paper) n/a   Duplicates UniSTS marker PtSIFG_0358, SsrPt_ctg4698, PtTX3118   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_2229 1 114.6 11 0.68 gb|BV728684 UniSTS:516338 TCAATCAGTTTTCCTTCCGC GGTCTCCAAATACGGGGAGT SSR CE (CAG)5 439 435 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_2461 not mapped not mapped not mapped not mapped gb|BV728721 UniSTS:516339 AAACTGCGTGAGGTGCTCTT CTTCTCGATGATGTGCCTGA SSR CE (GCAG)4 433 435 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_2510 not mapped not mapped not mapped not mapped gb|BV728710 UniSTS:516340 CCACGGAACTGGTCTCAGAT GGCATCTCCTGGATTGTCAT SSR CE (ACGGCA)4 459 452 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4102 not mapped not mapped not mapped not mapped gb|BV728704 UniSTS:516341 CTTTGTTGACCCCTGCATTT TTGGCTTAGCTAAAAGGGTGA SSR CE (TA)6 200 195 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4110 not mapped not mapped not mapped not mapped gb|BV728705 UniSTS:516342 TGATTGAGGTCTCGACTCCC GGATGTGGCTGTTCCAGATT SSR CE (TG)6 412 408 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4133 not mapped not mapped not mapped not mapped gb|BV728776 UniSTS:516343 GATGATGGGGGATCAGAAGA GTACTGACGTGACCCTGCAA SSR CE (TA)7 287 285 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4160 not mapped not mapped not mapped not mapped gb|BV728773 UniSTS:516344 AAAGGGATGCTTTTAAGGCT CATCGGCAGTTGTTCAGCTA SSR CE (TA)7 464 454 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4177 not mapped not mapped not mapped not mapped gb|BV728717 UniSTS:516345 CCAACGCATTTGTGATTTTG TTCCTAAAGTGTGTGTGAAACAA SSR CE (AC)6 151 145 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4192 not mapped not mapped not mapped not mapped gb|BV728725 UniSTS:516346 CCATTCGTGTATGCCAACAG TAGCCTTGGGAAAGGGAAGT SSR CE (AT)7 446 442 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4202 not mapped not mapped not mapped not mapped gb|BV728780 UniSTS:516347 AAGCAACTGCCAATTTGACC TGGCTGAAATATGCTACCCC SSR CE (AG)6 328 325 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4207 not mapped not mapped not mapped not mapped gb|BV728718 UniSTS:516348 ACGGCCGTAGTTTTTCCTCT AGTACCACAAGCAGCATCCC SSR CE (AT)6 294 536 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4213 8 66.9 19 0.94 gb|BV728760 UniSTS:516349 AACGCAAACGCAACCTATCT GGCACTCACCTGCATTCTTT SSR CE (TA)6 201 199 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4218 1 54.4 18 1.3 gb|BV728761 UniSTS:516350 AAAGGCAGCAGTCGGTAGAA AAACCAAGTTTGCCTGATCG SSR CE (TA)6 201 200 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_4222 8 7.1 13 2.63 gb|BV728762 UniSTS:516351 CACCCTTTTCACGCAAGAAT GCCTACGCATTATCCTTCCA SSR CE (AT)6 317 319 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4232 not mapped not mapped not mapped not mapped gb|BV728785 UniSTS:516352 GAAAAAGAAGAGAAGAATCAACGC CTTCAAATGCCCTTCGACAT SSR CE (AT)7, (AT)8 267 265 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4233 7 60.7 13 1.02 gb|BV728685 UniSTS:516353 AGGGAAACCGCGGATTATAG CCGGAATGAAGATTGCAGTT SSR CE (TA)7 102 96 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4239 not mapped not mapped not mapped not mapped gb|BV728777 UniSTS:516354 AGAGCGAAACCAGCAATACA GAATGCTGCAGAGGAAGGAG SSR CE (TA)6 214 209 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4245 3 26.2 19 0.345 gb|BV728686 UniSTS:516355 TTCAAGGGGCAAGATTCAAC TTTGCTCTCCAATTCCAACC SSR CE (TA)7 418 414 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4249 5 37.5 11 0.93 gb|BV728687 UniSTS:516356 TCCTTGGTTTGTGCTTTTCC ATATGCCCGTTGGCAGTAAC SSR CE (AT)6 359 356 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4282 11 47 12 0.25 gb|BV728763 UniSTS:516357 AACAAAATTTATGGCGACCG TTCTTGAGGTCGGTTGTTCC SSR CE (AT)6 321 327 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4304 12 25.8 12 1.7 gb|BV728793 UniSTS:516358 CATGCATGTGTGGAGGAGTT CTCATGTGCTTTGATCCCCT SSR CE (CT)6 394 393 Echt et al. (this paper) n/a   R primer matches nothing in pine NCBI dbEST.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4315 6 86.3 15 0.65 gb|BV728688 UniSTS:516359 GGCCTAGATCTTGTGGAAAGAA TCCTTGTCACGCTGAGATTG SSR CE (TA)8(TA)6 194 188 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4378 3 34.2 30 1.11 gb|BV728764 UniSTS:516360 TGGTGGTGGGGGATACTAAA TATTACCGGCACACAACGAA SSR CE (TA)6 263 262 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4380 not mapped not mapped not mapped not mapped gb|BV728709 UniSTS:516361 CCTATCCCACAAAGACGGAA AACTCAAAAACCTGGGGCTT SSR CE (AT)6 420 418 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4391 not mapped not mapped not mapped not mapped gb|BV728707 UniSTS:516363 CAGACTGGCAGCAAAATGAA GTAGGGCGTTGACAATCCAT SSR CE (GA)6 175 171 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4393 not mapped not mapped not mapped not mapped gb|BV728778 UniSTS:516364 ATCGTTGCCTGCATGTTTTT TCTTGCTGAATATCCCGGTC SSR CE (AT)6 402 401 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4394 10 42.6 21 0.515 gb|BV728765 UniSTS:516365 GCTTGCCAAGTCACTGTTGA CTGCAGCCCTTTCTCAAAAC SSR CE (AT)7 252 424 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4407 not mapped not mapped not mapped not mapped gb|BV728712 UniSTS:516366 AAATACCCCTCCACCCATTT TCATTGGCCTACTTTCCCAC SSR CE (TC)6 181 176 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4415 11 8.8 10 0.57 gb|BV728689 UniSTS:516367 GCGCAAAGTGTCTGTGTGTT AGGCATTACAGAAACACGGG SSR CE (AT)6 340 339 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtSIFG_4438 3 43.1 21 2.01 gb|BV728690 UniSTS:516368 ACATAAGCACCGGTGAGGTC CCTTGCTCTTATGCCTCCAA SSR CE (TA)7 302 301 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtSIFG_4446 8 126.4 6 0.61 gb|BV728691 UniSTS:516369 TCATGGCTTTGGACATGAAA ATGGGGCTCAAGTGTACTGC SSR CE (TC)6 131 115 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4447 12 2.7 12 0.53 gb|BV728692 UniSTS:516370 TTCTCGTTGGCTTCCTGAAT AAATCCAGAATGAACCACATTT SSR CE (AT)6 149 147 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4454 2 7.7 18 0.42 gb|BV728693 UniSTS:516371 CTTGCTATGCCAACCAGACA CCCACACCAGCTCCATTTTA SSR CE (AT)6 294 297 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4458 4 113 8 2.39 gb|BV728766 UniSTS:516372 GGATTTGATTCGATCCCCTT GGTGCCCTTCAAATCAAAGA SSR CE (AT)7 207 202 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4472 9 88.6 12 1.46 gb|BV728694 UniSTS:516373 CCAAGAGAGTTGCCTTACGC GGTCGTCCGCTAACAGAGAG SSR CE (TA)6 253 252 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4493 11 31.5 11 2.18 gb|BV728767 UniSTS:516374 TTTGAACCTTTTTGGCTTGG AACCCTCATTTGCTGCACTC SSR CE (AT)6 487 489 Echt et al. (this paper) n/a     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtSIFG_4502 5 17.9 6 26.7, jump>5 gb|BV728695 UniSTS:516375 AGCGTAATCAACTGGGAACG GTTCATTCATGCTCAGCGAA SSR CE (AT)7 326 323 Echt et al. (this paper) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX2037 2 73.9 20 1.91 gb|BV728860 UniSTS:508444 GCCTTTAGATGAATGAACCCA TAAGCGGGATATTATAGAGTTT SSR CE (GTAG)8(GT)14 177 178 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2080 12 89.1 5 1.75 gb|BV728818 UniSTS:508445 AAAGATGGTCGGTTGTAAAGTT TTGTCAGGCGGATAAGGTT SSR CE (CAT)7 161 156 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX2091 8 64.1 25 2.48 gb|BV728845 UniSTS:508446 ACCAAATCTCCCCACAT AATCATACCCGTTTCAGT SSR CE (GTTT)3TT(GTT)5, (GTT)7 267 267 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2093 5 35.5 15 1.3 gb|BV728819 UniSTS:508447 AATTTGACGGGTTTTAC GTGGCACATGGATTTCT SSR CE (CAA)9 343 343 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2094 2 125.5 7 0.61 gb|BV728820 UniSTS:508448 CAACTGTGCCTGTGCTGTGT ATGGGTGGGTTGGTTATCTGA SSR CE (TTTG)9(T)11 324 260 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2123 9 105.6 12 0.81 gb|BV728861 UniSTS:508449 GAAGAACCCACAAACACAAG GGGCAAGAATTCAATGATAA SSR CE (AGC)8 198 194 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2146 3 82.4 39 7.42 gb|BV728863 UniSTS:508451 CCTGGGGATTTGGATTGGGTATTTG ATATTTTCCTTGCCCCTTCCAGACA SSR CE (TGC)5, (TGC)7, (TGC)7 180 180 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2164 3 18.3 27 1.47 gb|BV728862 UniSTS:508452 TCAAATATTAAGAAGGTAACAATAC GAAAATGAAAATCTTAAAAAAATTC SSR CE (TCG)5, (CCG)4, (TCG)4, (TCG)5, (TCG)5(TCA)10 252 252 Elsik et al. (2000) 10902720     F and R primers may be reversed from what is in the NCBI UniSTS record. F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX2189 2 0.0 12 0.42 gb|BV728821 UniSTS:508453 ATGAGCCTTTATTTATTGTTTTTG ATAGGATTTAAGTAGTTTTTCATT SSR CE (A)15(AACC)6 289 289 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3_lp3-1 5 34.9 16 1.063 gb|BV728995 UniSTS:516074 GGAGGAGAAACAGCACCAC CGGAAATCACACGAAAAGAA ESTP SSCP n/a 716 n/a Komulainen et al. (2003) 12827250 estPtTX3_lp3-1        
PtTX3001 11 38.6 14 0.56 gb|BV728822 UniSTS:508454 ATAAAGGCAGAGGATGAACA CCCAATTGTTATTTCTGATT SSR CE (CAA)4, (CAA)3, (CAA)4 313 300 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3011 7 19.6 12 0.43 gb|BV728852 UniSTS:508455 AATTTGGGTGTATTTTTCTTAGA AAAAGTTGAAGGAGTTGGTGATC SSR CE (GAT)15 186 185 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3013 12 40.4 5 4.83 gb|BV728853 UniSTS:508456 GCTTCTCCATTAACTAATTCTA TCAAAATTGTTCGTAAAACCTC SSR CE (GTT)10 134 128 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3019 7 35.7 16 0.49 gb|BV728864 UniSTS:508457 AAGAATATCAAGCACTCC CAAAGGCATAAAGAAACT SSR CE (CAA)10 208 215 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3020 3 99.4 24 0.63 gb|BV728854 UniSTS:508458 GTCGGGGAAGTGAAAGTA CTAGGTGCAAGAAAAGAGTAT SSR CE (A)16(CAA)9 211 211 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3025 2 7.9 12 0.56 gb|BV728855 UniSTS:508459 CACGCTGTATAATAACAATCTA TTCTATATTCGCTTTTAGTTTC SSR CE (CAA)10 266 260 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3027 4 81.4 6 8.56 gb|BV728823 UniSTS:508460 TCCATTTGAGAACTTTTT AGGAGCCACAACATAATA SSR CE (CAT)10 280 280 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3029 5 44 23 0.34 gb|BV728824 UniSTS:508461 CTTGTTGCTGCTTCTGC AACAAAATAATATAAATGCTCTGC SSR CE (GCT)8 255 259 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3032 8 45.5 17 0.69 gb|BV728856 UniSTS:508462 CTGCCACACTACCAACC AACATTAAGATCTCATTTCAA SSR CE (ACT)6, (GTC)6, (GTC)8, (TCA)36 335 330 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3034 8 102.7 24 2.09, jump>5 gb|BV728857 UniSTS:508463 TCAAAATGCAAAAGACG ATTAGGACTGGGGATGAT SSR CE (GA)13 207 201 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3037 9 123.7 9 0.63 gb|BV728858 UniSTS:508464 CGTTTGGAGCACTACTT AAGTCACTTAATGCAATATGTA SSR CE (CAA)15 144 110 Elsik et al. (2000) 10902720       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3045 6 101.9 7 0.2 gb|BV728846 UniSTS:508465 CATCGCATATCGCAATCAGG AAGGCAAGAGGGAAATGTAATAGA SSR CE (CA)12 256 255 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX3047 10 43.8 21 0.860 gb|BV728825 UniSTS:508466 TTGGAATACTTGCACGATGAC ATTTAGATAGGAGATGGTTGTTTA SSR CE (AC)21 354 347 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3049 5 70.5 28 1.98 gb|BV728826 UniSTS:508467 GAAGTGATAATGGCATAGCAAAAT CAGACCCGTGAAAGTAATAAACAT SSR CE (TG)16 311 300 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX3052 11 7.6 9 0.21 gb|BV728827 UniSTS:508468 CCTCACTAGGAGGCTACGGAAGAG AAAGACTCCTTGATGTTGTGAACA SSR CE (ATC)8 242 240 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3055 6 5.4 5 1.1 gb|BV728828 UniSTS:508469 AGCAGACTTGAAGGGAAAAA ATCATCTATATTACCAGGGAGTT SSR CE (GAT)5, (GAT)8, (GAT)6 402 402 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3058 1 98.2 22 1.63 gb|BV728829 UniSTS:508470 ACTCTACTACTTGTTCTACCTCA ATTATATTTCGGCATTGT SSR CE (CAA)8, (CAA)4, (CAA)3, (CAA)8, (CAA)5 423 250 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3063 11 35.2 26 0.45 gb|BV728830 UniSTS:508471 CAATCAGAATCAGCGGCAAACAAA TTCAACAACATTCATCACACTA SSR CE (CAA)15 268 259 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3081 9 108.13 18 0.28 gb|BV728831 UniSTS:508472 GCCGAGGAAGCAAGCAACCAA CCTCGGCAGCCAAATCCTTCA SSR CE (GTT)13 234 237 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3097 5 102.6 6 0.23 gb|BV728832 UniSTS:508474 TTTTTAGAAGATGATTGGATA TCATATAGTAGCATCAAAACAAAT SSR CE (GTT)7 134 172 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3105 3 117.0 24 0.558 gb|BV728847 UniSTS:508475 TGTCGGTGGAGTTGGCAGTAGACT AGGGCCCAGCGTTTCCTG SSR CE (GTT)9 201 180 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3107 5 34.6 15 1.63 gb|BV728833 UniSTS:508476 AAACAAGCCCACATCGTCAATC TCCCCTGGATCTGAGGA SSR CE (CAT)14 179 182 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3110 4 63.3 20 2.46, jump>5 gb|BV728834 UniSTS:508477 CTCCTAGGACTTTCTTTGTTG TGGGGTGGAGGAGGAATCATA SSR CE (GTT)8, (CTT)8 286 287 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX3114 8 0.0 13 0.97 gb|BV728835 UniSTS:508478 CATATAAATTTGTGAGGTA CATTATGTCCATTTAGTCC SSR CE (GTT)11(T)17 189 180 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3116 3 23.3 36 2.1, jump>5 gb|BV728848 UniSTS:508479 CCTCCCAAAGCCTAAAGAAT CATACAAGGCCTTATCTTACAGAA SSR CE (TTG)7 141 126 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a 1bp allele.
PtTX3117 11 92.2 14 0.35 gb|BV728836 UniSTS:508480 GTGATTGATGAGGAGGCTTACT TAGGGACTGGCACCGATGAA SSR CE (CAT)9 208 196 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX3120 3 88.5 40 0.785 gb|BV728837 UniSTS:508482 CCCACAAACAAGGAGGTC TAGCAGTCGAGTTAGAAGATTAGA SSR CE (CAA)25 282 236 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4001 4 55.5 23 1.22, jump>5 gb|BV728865 UniSTS:508484 CTATTTGAGTTAAGAAGGGAGTC CTGTGGGTAGCATCATC SSR CE (GT)15 220 220 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4003 5 11.3 16 6.77, jump>5 gb|BV728866 UniSTS:508485 GCGATAAGCATACCTACACT TTACTAAAATGGGGATGAAA SSR CE (GT)13 156 150 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX4030 1 55.1 27 1.24 gb|BV728838 UniSTS:508487 TTGGGAGGATGACTCCATTATAT ACTATGGTTGGTCAAGTTAA SSR CE (GT)21(GA)13 150 150 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4033 2 84.9 26 2.21 gb|BV728878 UniSTS:508488 ACCCATTTCCTTTTTCAAC GGTGGCGAGGCATTATTC SSR CE (CA)15 146 156 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4036 2 35.2 20 0.63 gb|BV728879 UniSTS:508489 TGATGGGAAGGAAAAGAATAAAC AATGCCCCCACAACTAAAAC SSR CE (CA)31 458 470 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4056 7 66.3 6 0.55 gb|BV728867 UniSTS:508490 TTAAGGCCAGTTCCAATACAAAAT GAGCCCAACAACTAAAACAATGAG SSR CE (GA)17 432 412 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4058 5 54.9 35 0.96 gb|BV728868 UniSTS:508491 AAGTGTTGGGAGAAAAATGTAAT CTCCTTCTGTCCCTATCCTCT SSR CE (GA)20 141 140 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4062 6 78.8 23 2.06 gb|BV728877 UniSTS:508492 TCTAGGCAATCTTTTTACCAAC TATCATAGCCTCATCCAATACA SSR CE (GT)13 260 161 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4079 9 64 18 0.77 gb|BV728839 UniSTS:508493 CACATTTCCCTCCAACTAAAC GGGCATAATAGCTGGTTCTAA SSR CE (CA)23 242 224 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail. Locus segregates a null allele.
PtTX4090 7 15.5 13 0.36 gb|BV728869 UniSTS:508494 ACTTTCAAGATTCACTAATG AGTCCAGCACTCCAAGAAA SSR CE (CTT)6, (CTT)8 188 190 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4092 10 62.7 19 0.675 gb|BV728870 UniSTS:508495 GGATGATACTTTCCATGAGTTAGG TCTAGTCCAGATCTTGGTCCAC SSR CE (GAA)21 158 155 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4093 8 77.9 17 7.51 gb|BV728871 UniSTS:508496 TTGCTTTGCTAATGTTGACCTG CTAGAGTATGCCTTGAGC SSR CE (CTT)16 322 305 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4112 7 64.5 14 1.49 gb|BV728872 UniSTS:508497 CCCTCTGTTAGCCGATGTA AATGTTAGCCCTAGATGTTTGATG SSR CE (AT)6(GT)16 446 465 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4137 6 55.6 24 1 gb|BV728873 UniSTS:508499 CATTGTATTAGTCCTAGCCTCTGT GGTGCACCCAACAATGTG SSR CE (GAA)21 188 178 Zhou et al. (2002) 11908673       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4147 5 9.7 13 5.58 gb|BV728840 UniSTS:508500 CTCCGGACAAGAGCACAGGACTC AGCTGGGTTTGGGACCATTCAC SSR CE (CAA)5 193 190 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4181 1 70 24 1.29 gb|BV728850 UniSTS:508502 CTCTCCCCTTTATTTACACATTG AAAGATTGGTCGGTTGGTTAT SSR CE (CAA)6 388 375 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4214 5 80 33 1.53 gb|BV728841 UniSTS:508503 AACATTTCCCAAGCCTCAA ACATGGACATCAAGAAGAAGTG SSR CE (CA)20 164 170 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4215 11 54 12 0.25 gb|BV728842 UniSTS:508504 CTAATCCTTCTCCTCCTCTTG CCTATCTCTGGGGTTTGT SSR CE (CA)25 111 295 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtTX4228 3 113.9 16 0.554 gb|BV728843 UniSTS:508505 ATATCATGTTTAGGTTGGTGTG AGTTAGGCTTTTTGTCC SSR CE (CA)14 158 156 Auckland et al. (2002) n/a       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
PtWS1_PCBER-PT1 8 2.4 12 21.099, jump>5 n/a n/a GAGTTCGGGAATGATGTTGA CGACGGTGGTGTATTTCACA ESTP SSCP n/a n/a n/a Komulainen et al. (2003) 12827250 PCBR_pF1R1        
RPtest11 not mapped not mapped not mapped not mapped gb|BV728796 UniSTS:516377 AGGATGCCTATGATATGCGC AACCATAACAAAAGCGGTCG SSR CE (ATC)7 213 216 Chagne et al. (2004) 15448894       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
RPtest5 not mapped not mapped not mapped not mapped gb|BV728798 UniSTS:516379 ACAACAATAATAACGGGGGC ACGCTTTAGATCCTCCTGCA SSR CE (AAC)6 197 199 Chagne et al. (2004) 15448894       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
SsrPt_ctg1376 8 112.2 20 12.6, jump>5 gb|BV728806 UniSTS:516387 CGATATTATGGATTTTGCTTGTGA AAATGCATGCCAAACTTAAATAC SSR CE (AT)20 145 128 Chagne et al. (2004) 15448894       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
SsrPt_ctg7141 3 80.3 40 0.964 gb|BV728811 UniSTS:516393 GAATGACGCATTATCAGGGG TCACCTTTCTCACCTCTGCC SSR CE (CCG)8 375 475 Chagne et al. (2004) 15448894   Duplicates UniSTS marker SsrPt_ctg4487b and SsrPt_ctg4487a.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
SsrPt_ctg7444 9 84.9 20 1.64 gb|BV728812 UniSTS:516395 TCTTCACCATCGGTTTCTCC TGGATCTGTCACCTCCTCATC SSR CE (AT)10 280 275 Chagne et al. (2004) 15448894   Duplicates UniSTS marker PtSIFG_1120, estPtIFG_AGP-3.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
SsrPt_ctg9249 5 20.1 25 5.35, jump>5 gb|BV728813 UniSTS:516396 CTGCTCCCTCAGCTCTTCC AGACGTCACTGCCATTACCC SSR CE (AAG)7 156 150 Chagne et al. (2004) 15448894   Duplicates UniSTS marker PtSIFG_1186.   F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  
SsrPt_ctg946 10 78.9 15 1.749 gb|BV728814 UniSTS:516397 TATCAGGTATAGGCCTCCGC AAATAGGAGCCCTTCTGGGA SSR CE (AGG)9 281 274 Chagne et al. (2004) 15448894       F primer was evaluated with a 5' dye-CACGACGTTGTAAAACGAC tail. R primer was evaluated with a 5' GTTTCTT tail.  

Compiled by C. Echt et al., January 2011, USDA Forest Service.