General Frequently Asked Questions

NOTE - FastGroup is a Java program.  To run it you must have Java installed on your computer.

Where can I get Java SDK?
FastGroup was compiled with Java SDK version 1.3.  It can obtained from the Sun website
http://java.sun.com.

Which computer operating systems support FastGroup?
FastGroup was written in Java 1.3 and should be supported by UNIX, Mac, and Windows
operating systems.  We have tested the program in Windows 98, ME, and 2000.

How are group names assigned?
The name for each group begins with "g#-".  The number (#) is assigned sequentially as groups
are found by the program.  After the hyphen, the name of the first query sequence used in the
grouping is given.  This sequence is the same as that displayed in the fasta_groups.txt file. 

What is FASTA-format?
For more information, see http://www.ncbi.nlm.nih.gov/BLAST/fasta.html.

>sequence1
CAATGGCGCCGACGACCGTGCTTGAATCGGGCCTGAAGGAGACTTCTATCCAGTTT
>sequence2
TAATGGCGCCGACGACCGTGCCTCAATCGGCCACGAATAAGACGTCCATGGCAGT
>sequence3
GAATGGCGCCGACGACCGTGCCTCAATCGGCCTCGAAGGAGACCTTCATGGCAGTT
>sequence4
TAATGGCGCCGACGACCGTGCATCAACCGGCCCGGAAGAAGACCTCCATGGCAGT

How do I make an alignment and a phylogeny tree from the fasta_groups.txt file?
We use Clustal X Multiple Sequence Alignment Program (version 1.8, June 1999) developed by
the National Center for Biotechnology Information (NCBI; Bldg 38A, NIH 8600 Rockville Pike,
Bethesda, MD 20894).  The fasta_groups.txt file can be opened directly in Clustal X. Clustal X
can be obtained as part of the NCBI SOFTWARE DEVELOPMENT TOOLKIT which is
available by anonymous ftp from http://www.ncbi.nlm.nih.gov. 

If you have trimmed the sequences to a specific primer site using FastGroup and will be making
an alignment, it is suggested the primer site be used as "end for display" for importation into
Clustal X, because it starts the alignment off with a conserved region.  I find that this yields more
reasonable alignments.

     Jeanmougin, F., Thompson, J.D., Gouy, M., Higgins,D.G. and Gibson,T.J. (1998)
Multiple sequence alignment with Clustal X. Trends Biochem Sci, 23, 403_5.

     Thompson,J.D., Gibson,T.J., Plewniak,F., Jeanmougin,F. and Higgins,D.G. (1997)
The Clustal X windows interface: flexible strategies for multiple sequence 
alignment aided by quality analysis tools. Nucleic Acids Research, 24:4876_4882.

How do I BLAST all of the sequences in my fasta_groups.txt file?
All of the sequences in the fasta_groups.txt file can be BLAST against GenBank together using 
BLASTCL3.  BLASTCL3 be obtained from NCBI (http://www.ncbi.nlm.nih.gov/BLAST/). 
Complete instructions for BLASTCL3 are in a readme file with the program.  I suggest that if
you are analyzing a large number of sequencing using this approach, that you limit the output
using the "-K" parameter.

Example of a typical BLASTCL3 command line:
     blastcl3 -p blastn -d nr -i c:\blast\testfile.txt -o out.total -T T
blastcl3  =    launch blastcl3
-p blastn      =    use the blastn algorithm for search
-d nr          =    use the non-redundant database
-i        =    path to input file (i.e., location of fasta_groups.txt file)
-o        =    name of output file (i.e., the results)
-T T      =    html format the results 
-K 10          =    limit the number of reported hits to 10

Frequently Asked Questions Specific for Intel and AMD Computers

How do I install and run FastGroup?
1.   Create a folder called FastGroup on the C drive.
2.   Save the FastGroup.jar file in the FastGroup folder.
3.   Double clicking FastGroup.jar will open the GUI.
4.   Adjust the various FastGroup parameters as need.  

How do I use a folder of individual files as my input library?
1.   Create a "myseqs" directory on the c: drive
2.   Copy-and-paste files to this directory as needed

Note - This only works if the files are unformatted text with each sequence is in an individual
file.  An example of this sort of file would be the "seq" files output by ABI sequencers.

How do I use a FASTA-formatted document as an input library?
1) Make sure that the sequences are in a FASTA-formatted text document (i.e., txt; see example). 
The easiest way to make text files is in Notepad (copyright Microsoft Corp).  Also make sure that
there is not an extra carriage return (i.e., Enter) at the end of the file. 
2) Check "Use sequences in file" and put the pathway, including the extension, into the text field
(e.g., if you have a FASTA file with your sequence on the c: drive called "TestSeqs", the path
would be c:\TestSeqs.txt).

Notes - Make sure the input file is saved as a text file
            Make sure that there is not a hard return at the end of the last sequence in the input file.

Disclaimer and License

FastGroup is provided "AS IS".  There is no warranty of any kind.

The authors are not liable for any damages or harm, which may result from the use or inability to
use this product.

These versions of FastGroup can be used and distributed freely for private or academic purposes.