<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2004-5-2-r9</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl rating="0">
         <title>
            <p><it>In silico</it> identification and experimental validation of PmrAB targets in <it>Salmonella typhimurium</it> by regulatory motif detection</p>
         </title>
         <aug>
            <au id="A1" ca="yes" ce="no" pa="no" da="no">
               <snm>Marchal</snm>
               <fnm>Kathleen</fnm>
               <insr iid="I1"/>
               <email>Kathleen.Marchal@esat.kuleuven.ac.be</email>
            </au>
            <au id="A2" ca="no" ce="no" pa="no" da="no">
               <snm>De Keersmaecker</snm>
               <fnm>Sigrid</fnm>
               <insr iid="I2"/>
            </au>
            <au id="A3" ca="no" ce="no" pa="no" da="no">
               <snm>Monsieurs</snm>
               <fnm>Pieter</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A4" ca="no" ce="no" pa="no" da="no">
               <snm>van Boxel</snm>
               <fnm>Nadja</fnm>
               <insr iid="I2"/>
            </au>
            <au id="A5" ca="no" ce="no" pa="no" da="no">
               <snm>Lemmens</snm>
               <fnm>Karen</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A6" ca="no" ce="no" pa="no" da="no">
               <snm>Thijs</snm>
               <fnm>Gert</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A7" ca="no" ce="no" pa="no" da="no">
               <snm>Vanderleyden</snm>
               <fnm>Jos</fnm>
               <insr iid="I2"/>
            </au>
            <au id="A8" ca="no" ce="no" pa="no" da="no">
               <snm>De Moor</snm>
               <fnm>Bart</fnm>
               <insr iid="I1"/>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>ESAT-SCD, Katholieke Universiteit Leuven, Kasteelpark Arenberg 10, 3001 Leuven-Heverlee, Belgium</p>
            </ins>
            <ins id="I2">
               <p>Centre of Microbial and Plant Genetics, Katholieke Universiteit Leuven, Kasteelpark Arenberg 20, 3001 Leuven-Heverlee, Belgium</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2004</pubdate>
         <volume>5</volume>
         <issue>2</issue>
         <fpage>R9</fpage>
         <url>http://genomebiology.com/2004/5/2/R9</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">14759259</pubid>
               <pubid idtype="doi" link="fulltext">10.1186/gb-2004-5-2-r9</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>13</day>
               <month>6</month>
               <year>2003</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>27</day>
               <month>8</month>
               <year>2003</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>17</day>
               <month>12</month>
               <year>2003</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>29</day>
               <month>1</month>
               <year>2004</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2004</year>
         <collab>Marchal et al.; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <shorttitle>
         <p><it>In silico </it>identification and experimental validation of PmrAB targets in <it>Salmonella typhimurium </it>by regulatory motif detection</p>
      </shorttitle>
      <shortabs>
         <p>A genome-wide computational screen for targets of the PmrA transcription factor in <it>Salmonella typhimurium</it> has identified novel target genes.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The PmrAB (BasSR) two-component regulatory system is required for <it>Salmonella typhimurium </it>virulence. PmrAB-controlled modifications of the lipopolysaccharide (LPS) layer confer resistance to cationic antibiotic polypeptides, which may allow bacteria to survive within macrophages. The PmrAB system also confers resistance to Fe<sup>3+</sup>-mediated killing. New targets of the system have recently been discovered that seem not to have a role in the well-described functions of PmrAB, suggesting that the PmrAB-dependent regulon might contain additional, unidentified targets.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We performed an <it>in silico </it>analysis of possible targets of the PmrAB system. Using a motif model of the PmrA binding site in DNA, genome-wide screening was carried out to detect PmrAB target genes. To increase confidence in the predictions, all putative targets were subjected to a cross-species comparison (phylogenetic footprinting) using a Gibbs sampling-based motif-detection procedure. As well as the known targets, we detected additional targets with unknown functions. Four of these were experimentally validated (<it>yibD</it>, <it>aroQ</it>, <it>mig-13 </it>and <it>sseJ</it>). Site-directed mutagenesis of the PmrA-binding site (PmrA box) in <it>yibD </it>revealed specific sequence requirements.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>We demonstrated the efficiency of our procedure by recovering most of the known PmrAB-dependent targets and by identifying unknown targets that we were able to validate experimentally. We also pinpointed directions for further research that could help elucidate the <it>S. typhimurium </it>virulence pathway.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010014">Microbiology and parasitology</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010002">Bioinformatics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010009">Genetics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010010">Genome studies</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The PmrAB two-component regulatory system is part of a multicomponent feedback loop that acts as one of the key regulatory mechanisms of <it>Salmonella typhimurium </it>virulence <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. The PmrAB regulatory system is itself responsive to Fe<sup>3+ </sup>and mild acid <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> and senses Mg<sup>2+ </sup>indirectly by communicating with the Mg<sup>2+</sup>-sensitive PhoPQ system <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp> via PmrD <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B9">9</abbr></abbrgrp>. PmrD is hypothesized to transduce the signal from the PhoPQ system to the PmrAB system via a posttranslational modification. The gene <it>pmrD </it>is transcriptionally activated by the PhoPQ system but repressed by the PmrAB system <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>. The PmrAB system is required for resistance to the cationic antibiotic polymyxin B <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> and to Fe<sup>3+</sup>-mediated killing <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The Mg<sup>2+</sup>-dependent regulation of PmrAB was shown to be important for gene expression in an intracellular environment <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Fe<sup>3+</sup>-dependent PmrAB regulation, on the other hand, has been hypothesized to be essential for survival in extracellular environments <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. A region in DNA to which the PmrA protein binds has been identified by DNA footprinting analysis <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>.</p>
         <p>In contrast to <it>pmrD</it>, other known target genes of PmrAB in <it>S. typhimurium </it>are transcriptionally activated. One group of targets is involved in LPS modification. PmrAB-induced modifications include the addition of 4-amino-4-deoxy-<smcaps>L</smcaps>-arabinose (Ara4N) and phosphoethanolamine (pEtN) to lipid A <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Loci involved in the Ara4N modification of lipid A are <it>ugd </it><abbrgrp><abbr bid="B6">6</abbr></abbrgrp> and the <it>pmrHFIJKLM </it>loci, both of which are responsible for Ara4N biosynthesis <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp> and incorporation of Ara4N into lipid A <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. LPS modifications are hypothesized to allow bacterial survival within macrophages by lowering the affinity of the LPS for amphipathic cationic peptides with antimicrobial activity that are produced as a consequence of the innate immune response.</p>
         <p>A second class of targets are directly dependent on PmrAB, but have as-yet-undefined functions. <it>pmrC </it>(co-transcribed with <it>pmrAB </it><abbrgrp><abbr bid="B21">21</abbr></abbrgrp>) and <it>pmrG </it>(located upstream of the <it>pmrHFIJKLM </it>operon) are both transcriptionally activated by PmrAB. Mutations in <it>pmrG </it>did not affect the resistance to polymyxin B <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Tamayo <it>et al. </it>recently identified two additional targets of PmrAB - <it>yibD </it>and <it>dgoA</it>. However, none of these was involved in resistance to polymyxin B or to high concentrations of Fe<sup>3+ </sup><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. These genes might therefore represent a group of as-yet-unidentified functions regulated by the PmrAB system <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Also, PmrAB-regulated genes involved in resistance to Fe<sup>3+ </sup>and pEtN addition to LPS remain to be identified <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Together with the recent indications of new PmrAB-dependent functions, this raises the possibility that not all PmrAB targets have yet been identified. Therefore, in this study we used an <it>in silico </it>approach to predict targets of the PmrAB regulatory system. Several methodologies exist for genome-wide screening using a motif model (or mathematical representation) of experimentally verified regulatory sites <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>. These assign to each possible motif position in the genome a score (the specifics of which depend on the methodology) that indicates how well the subsequence located at that position matches the motif model. Genome-wide screenings of this type have proved successful in detecting additional targets of the regulator being investigated. However, more reliable predictions for motifs in specific pathways have been obtained by incorporating cross-species comparisons (phylogenetic footprinting) <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. Because evolutionary forces tend to preferentially retain functional DNA sequences, motifs that are conserved in the intergenic regions of orthologs derived from several related species are more likely to be biologically relevant <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>.</p>
         <p>In this study, we combine both approaches. Putative targets identified by a genome-wide screening were, whenever possible, analyzed by phylogenetic footprinting based on Gibbs sampling <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B37">37</abbr></abbrgrp>. Four interesting targets were validated by wet lab experiments and the PmrA box of a representative target was subjected to site-directed mutagenesis.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Genome-wide screening using a PmrA motif model</p>
            </st>
            <p>Gibbs sampling was used to detect PmrA-binding motifs in the intergenic regions of three experimentally verified PmrAB targets (<it>ugd</it>, <it>pmrC</it>, <it>pmrG</it>). The logo of the statistically overrepresented motif detected is represented in Figure <figr fid="F1">1</figr>. This motif corresponded to the PmrA-binding site experimentally identified by Aguirre <it>et al</it>. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and partially overlapped the PmrA-binding site delineated by Wosten <it>et al</it>. <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. They detected this site upstream of the transcription start of <it>pmrC</it>, in the intergenic region between <it>pmrG </it>and <it>pmrH</it>, and upstream of <it>ugd </it>(on the plus strand) <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. We used the obtained motif model in a genome-wide screening of the <it>S. typhimurium </it>intergenic sequences <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Table <tblr tid="T1">1</tblr> summarizes the results of our screening, using a threshold as described in Materials and methods. From experimentally verified examples, it appears that the PmrA motif can be biologically functional not only when present on the plus strand (as in the case of <it>pmrH</it>), but also when located on the minus strand (for example in <it>pmrG</it>) <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Therefore, both strands of the genome sequence were screened.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Consensus sequence of the PmrA box</p>
               </caption>
               <text>
                  <p>Consensus sequence of the PmrA box. Motif logo representing the initial motif model used to screen the <it>S. typhimurium </it>intergenic sequences.</p>
               </text>
               <graphic file="gb-2004-5-2-r9-1"/>
            </fig>
            <tbl id="T1" hint_layout="double">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>List of the putative PmrAB targets in <it>S. typhimurium</it></p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>Description</p>
                     </c>
                     <c ca="left">
                        <p>Score</p>
                     </c>
                     <c ca="left">
                        <p>Instance</p>
                     </c>
                     <c ca="center">
                        <p>Alignment</p>
                     </c>
                     <c ca="center">
                        <p>Footprint</p>
                     </c>
                     <c ca="left">
                        <p>Distribution (COG)</p>
                     </c>
                     <c ca="left">
                        <p>Distribution <abbrgrp><abbr bid="B38">38</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Minus strand</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>STM1273</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative nitric oxide reductase</p>
                     </c>
                     <c ca="left">
                        <p>0.848436</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGTTTTCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM2132</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Pseudogene; frameshift; putative RBS for <it>STM2133</it></p>
                     </c>
                     <c ca="left">
                        <p>0.814252</p>
                     </c>
                     <c ca="left">
                        <p>TTTTAGATTCACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some or all <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM4596</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paralog of <it>E. coli </it>ORF, hypothetical protein (AAC73478.1); BLAST hit to putative inner membrane protein</p>
                     </c>
                     <c ca="left">
                        <p>0.806962</p>
                     </c>
                     <c ca="left">
                        <p>TTTAATATTCACTTAAA</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM3131</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein; putative RBS for <it>STM3130</it>; putative first gene of operon with <it>STM3130 </it>(putative hypothetical protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.801641</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATTTTTACTTATT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM1020</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Gifsy-2 prophage</p>
                     </c>
                     <c ca="left">
                        <p>0.791616</p>
                     </c>
                     <c ca="left">
                        <p>CTTATTGTTAAGTCAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>stdA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3029</it>; paralog of <it>E. coli </it>putative fimbrial-like protein (AAC73813.1); BLAST hit to putative fimbrial-like protein</p>
                     </c>
                     <c ca="left">
                        <p>0.788548</p>
                     </c>
                     <c ca="left">
                        <p>CAAAACATTAACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Subspecies 1 only?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ugd</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2080</it>; <it>S. typhimurium </it>UDP-glucose 6-dehydrogenase</p>
                     </c>
                     <c ca="left">
                        <p>0.781719</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGAATTAACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>sinR</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0304</it>; <it>S. typhimurium </it>SINR protein. (SW:SINR_SALTY) transcriptional regulator</p>
                     </c>
                     <c ca="left">
                        <p>0.780204</p>
                     </c>
                     <c ca="left">
                        <p>CTTGATATCATCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Subspecies 1 only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM3131</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein; putative RBS for <it>STM3130</it>; putative first gene of operon with <it>STM3130</it>; (putative hypothetical protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.772846</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATACTCACATTAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM4413</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative imidazolonepropionase and related amidohydrolases; putative RBS for <it>STM4412</it>; first gene of operon with <it>STM4412 </it>(<smcaps>D</smcaps>-galactonate transport)</p>
                     </c>
                     <c ca="left">
                        <p>0.771153</p>
                     </c>
                     <c ca="left">
                        <p>GTGAATGTTAAATTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some or all <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>ybdO</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0606</it>; ortholog of <it>E. coli </it>putative transcriptional regulator LYSR-type (AAC73704.1); BLAST hit to putative transcriptional regulator, LysR family</p>
                     </c>
                     <c ca="left">
                        <p>0.769839</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGTAGAGTTTAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>All <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>oraA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2828</it>; ortholog of <it>E. coli </it>regulator, OraA protein (AAC75740.1); BLAST hit to regulator</p>
                     </c>
                     <c ca="left">
                        <p>0.766748</p>
                     </c>
                     <c ca="left">
                        <p>CTTGATGGTAATTTAAC</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>sdhC</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0732</it>; Ortholog of <it>E. coli </it>succinate dehydrogenase, cytochrome b556 (AAC73815.1); Putative RBS for <it>sdhD</it>; first gene of putative operon encoding succinate dehydrogenase</p>
                     </c>
                     <c ca="left">
                        <p>0.765950</p>
                     </c>
                     <c ca="left">
                        <p>CTTATTATTCCCTTAAG</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ycaR</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0987</it>; Ortholog of <it>E. coli </it>ORF, hypothetical protein (AAC74003.1); BLAST hit to putative inner membrane protein; Putative RBS for <it>kdsB</it>; first gene of a putative operon with <it>ksdB </it>(CMP-3-deoxy-<smcaps>D</smcaps>-manno-octulosanate transferase)</p>
                     </c>
                     <c ca="left">
                        <p>0.765889</p>
                     </c>
                     <c ca="left">
                        <p>TTCAATATTAACATAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>lasT</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM4600</it>; Ortholog of <it>E. coli </it>ORF, hypothetical protein (AAC77356.1); BLAST hit to putative tRNA*tRNA methyltransferase</p>
                     </c>
                     <c ca="left">
                        <p>0.765754</p>
                     </c>
                     <c ca="left">
                        <p>ATTTAGGATAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM2137</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein</p>
                     </c>
                     <c ca="left">
                        <p>0.764036</p>
                     </c>
                     <c ca="left">
                        <p>TTTAACCTTAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM1672</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein</p>
                     </c>
                     <c ca="left">
                        <p>0.762904</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATAGTCACTTATT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Subspecies 1 only?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>gcvA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2982</it>; Ortholog of <it>E. coli </it>positive regulator of <it>gcv </it>operon (AAC75850.1); first gene of putative operon (<it>gcvA, ygdD, ygdE </it>containing a SAM-dependent methyltransferase)</p>
                     </c>
                     <c ca="left">
                        <p>0.761166</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGTCGAATGAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ycgO</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1801</it>; Ortholog of <it>E. coli </it>ORF, hypothetical protein (AAC74275.1); BLAST hit to putative CPA1 family, Na:H transport protein</p>
                     </c>
                     <c ca="left">
                        <p>0.760685</p>
                     </c>
                     <c ca="left">
                        <p>TTTAACATTAACATAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM2287</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paralog of <it>E. coli </it>putative sulfatase* phosphatase (AAC75329.1); BLAST hit to putative cytoplasmic protein</p>
                     </c>
                     <c ca="left">
                        <p>0.759519</p>
                     </c>
                     <c ca="left">
                        <p>CTTATTATTCACATAAC</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some or all <it>Salmonella </it>only?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yebW</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1852</it>; Ortholog of <it>E. coli </it>ORF, hypothetical protein (AAC74907.1); BLAST hit to putative inner membrane lipoprotein</p>
                     </c>
                     <c ca="left">
                        <p>0.754895</p>
                     </c>
                     <c ca="left">
                        <p>CTCAATGTTAACTACTT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0897</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Hypothetical protein Fels-1 prophage</p>
                     </c>
                     <c ca="left">
                        <p>0.754468</p>
                     </c>
                     <c ca="left">
                        <p>CGTAAGGCTCTTTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>lpfA</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3640</it>; <it>S. typhimurium </it>long polar fimbrial protein A precursor; first gene of a putative fimbriae synthesis operon</p>
                     </c>
                     <c ca="left">
                        <p>0.753228</p>
                     </c>
                     <c ca="left">
                        <p>ATTAAGAATAAATTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Plus strand</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yjdB*</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM4293</it>; <it>S. typhimurium </it>hypothetical 61.6 kDa protein in <it>basS*pmrA-adiY </it>intergenic region. (SW:YJDB_SALTY) putative integral membrane protein; Putative RBS for <it>basR</it>; first gene of the putative operon (<it>yjdB basR basS</it>)</p>
                     </c>
                     <c ca="left">
                        <p>0.930146</p>
                     </c>
                     <c ca="left">
                        <p>CTTAAGGTTCACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>ugd</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2080</it>; <it>S. typhimurium </it>UDP-glucose 6-dehydrogenase</p>
                     </c>
                     <c ca="left">
                        <p>0.913666</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATATTAACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yfbE/ais</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2297</it>; Ortholog of <it>E. coli </it>putative enzyme (AAC75313.1); first gene of the <it>yfbE </it>operon; shared intergenic with <it>ais</it></p>
                     </c>
                     <c ca="left">
                        <p>0.912660</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGTTAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>STM1269*/STM1268</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative chorismate mutase; intergenic shared with <it>STM1268</it></p>
                     </c>
                     <c ca="left">
                        <p>0.888478</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGTTATCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0692</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paralog of <it>E. coli </it>nitrogen assimilation control protein (AAC75050.1); putative transcriptional regulator, LysR family</p>
                     </c>
                     <c ca="left">
                        <p>0.814773</p>
                     </c>
                     <c ca="left">
                        <p>CTTGATGTTGATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>ybjG/mdfA*</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0865</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC73928.1); putative permease; intergenic shared with <it>mdfA </it>(multidrug translocase)</p>
                     </c>
                     <c ca="left">
                        <p>0.810981</p>
                     </c>
                     <c ca="left">
                        <p>CTTTAAGGTTAATTTAA</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM2901</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Hypothetical protein putative cytoplasmic protein; located downstream of pathogenicity island 1</p>
                     </c>
                     <c ca="left">
                        <p>0.803712</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATATCAATATAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yhjC/yhjB</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3607</it>; Ortholog of <it>E. coli </it>putative transcriptional regulator LysR-type (AAC76546.1); intergenic shared with <it>yhjB </it>(putative transcriptional regulator)</p>
                     </c>
                     <c ca="left">
                        <p>0.796967</p>
                     </c>
                     <c ca="left">
                        <p>TTGAATATTAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yjbE/pgi</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM4222</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC76996.1); BLAST hit to putative outer membrane protein; first gene of the putative operon (<it>yjbE, yjbF, yjbG, yjbH</it>) consisting of putative outer membrane (lipo)proteins; intergenic shared with <it>pgi </it>(glucosephosphate isomerase)</p>
                     </c>
                     <c ca="left">
                        <p>0.791181</p>
                     </c>
                     <c ca="left">
                        <p>TTTAATTTTAACTTATT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yibD*</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3707</it>; Ortholog of <it>E. coli </it>putative regulator (AAC76639.1); BLAST hit to putative glycosyltransferase</p>
                     </c>
                     <c ca="left">
                        <p>0.790879</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATAGTTTCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM1926/flhC</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein Putative RBS for <it>STM1926</it>; first gene of a putative operon with <it>yecG </it>(putative universal stres protein); shared intergenic with <it>flhC </it>en <it>flhD </it>(flagellar transcriptional activator)</p>
                     </c>
                     <c ca="left">
                        <p>0.790699</p>
                     </c>
                     <c ca="left">
                        <p>CCTAATGTTCACTTTTT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some or all <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0334/STM0335</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative cytoplasmic protein; shared intergenic with <it>STM0335</it></p>
                     </c>
                     <c ca="left">
                        <p>0.789514</p>
                     </c>
                     <c ca="left">
                        <p>TTTCATATTCATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>ybdN</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0605</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC73703.1); BLAST hit to putative 3-phosphoadenosine 5-phosphosulfate sulfotransferase (PAPS reductase)*FAD synthetase Putative RBS for <it>ybdM</it>; first gene of a putative operon with <it>ybdM </it>(hypothetical transcriptional regulator)</p>
                     </c>
                     <c ca="left">
                        <p>0.788778</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATATAAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>glgB</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3538</it>; Ortholog of <it>E. coli </it>1,4-alpha-glucan branching enzyme (AAC76457.1); BLAST hit to 1,4-alpha-glucan branching enzyme; Putative RBS for <it>glgX</it>; putative first gene of operon involved in glycogen synthesis</p>
                     </c>
                     <c ca="left">
                        <p>0.779808</p>
                     </c>
                     <c ca="left">
                        <p>TTTAAGGGTAGCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>leuO</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0115</it>; <it>S. typhimurium </it>probable activator protein in leuabcd operon. (SW:LEUO_SALTY) putative transcriptional regulator (LysR family)</p>
                     </c>
                     <c ca="left">
                        <p>0.776490</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATGTTAACTTTTT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0343</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paralog of <it>E. coli </it>orf, hypothetical protein (AAC75237.1); BLAST hit to AAC75237.1 identity in aa 10 - 512 putative Diguanylate cyclase*phosphodiesterase domain</p>
                     </c>
                     <c ca="left">
                        <p>0.774271</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATGTTACTTTAGT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>Subspecies 1 only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>orf242</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1390 S. typhimurium </it>ORF242 (gi|4456866) putative regulatory proteins, <it>merR </it>family</p>
                     </c>
                     <c ca="left">
                        <p>0.773644</p>
                     </c>
                     <c ca="left">
                        <p>CTTAGTCTTCATTTGAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM1868A/mig-3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Lytic enzyme; intergenic shared with <it>mig-3 </it>(phage assembly protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.773462</p>
                     </c>
                     <c ca="left">
                        <p>CTTAATGATTATTTATT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM2763/STM2726</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paralog of <it>E. coli </it>prophage CP4-57 integrase (AAC75670.1); BLAST hit to putative integrase; intergenic shared with <it>STM2726 </it>(putative inner membrane)</p>
                     </c>
                     <c ca="left">
                        <p>0.772053</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATGTCCATTTAGT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p><it>S. typhimurium </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>pntA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1479</it>; Ortholog of <it>E. coli </it>pyridine nucleotide transhydrogenase, alpha subunit (AAC74675.1); Blast hit to AAC74675.1 pyridine nucleotide transhydrogenase (proton pump), alpha subunit; Putative RBS for <it>pntB</it>; first gene of the putative operon (<it>pntA, pntB</it>)</p>
                     </c>
                     <c ca="left">
                        <p>0.770547</p>
                     </c>
                     <c ca="left">
                        <p>TTTAATGTTAATTTCTT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0057/cit2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative citrate-sodium symport; intergenic shared with <it>citC2 </it>(citrate lyase synthetase)</p>
                     </c>
                     <c ca="left">
                        <p>0.767968</p>
                     </c>
                     <c ca="left">
                        <p>CTCATGGTTCATTGAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yrbF</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3313</it>; Ortholog of <it>E. coli </it>putative ATP-binding component of a transport system (AAC76227.1); Blast hit to AAC76227.1 putative ABC superfamily (atp_bind) transport protein; Putative RBS for <it>yrbE</it>; RegulonDB:STMS1H003330; first gene of putative <it>yrb </it>operon (ABC transporter)</p>
                     </c>
                     <c ca="left">
                        <p>0.766758</p>
                     </c>
                     <c ca="left">
                        <p>CCTAATTTTGACTTTAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yejG</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2220</it>; Paralog of <it>E. coli orf</it>, hypothetical protein (AAC75242.1); Blast hit to putative cytoplasmic protein</p>
                     </c>
                     <c ca="left">
                        <p>0.767099</p>
                     </c>
                     <c ca="left">
                        <p>CTTTATGTTTATTTTAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>slsA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3761</it>; putative inner membrane protein</p>
                     </c>
                     <c ca="left">
                        <p>0.765418</p>
                     </c>
                     <c ca="left">
                        <p>CTTTATGTTATTTAAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1110</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yhcN</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3361</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC76270.1); Blast hit to putative outer membrane protein</p>
                     </c>
                     <c ca="left">
                        <p>0.764452</p>
                     </c>
                     <c ca="left">
                        <p>ATTAGTGTATACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yceP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1161</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC74144.1); Blast hit to putative cytoplasmic protein</p>
                     </c>
                     <c ca="left">
                        <p>0.764191</p>
                     </c>
                     <c ca="left">
                        <p>TTTATTGTTCATATAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM4098</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>putative arylsulfate sulfotransferase</p>
                     </c>
                     <c ca="left">
                        <p>0.763003</p>
                     </c>
                     <c ca="left">
                        <p>TCTAATATTTATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>Subspecies 1 only?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>stfA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0195</it>; <it>S. typhimurium </it>major fimbrial subunit StfA</p>
                     </c>
                     <c ca="left">
                        <p>0.762241</p>
                     </c>
                     <c ca="left">
                        <p>ATCAATTTTAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>atpF</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM3869</it>; Ortholog of <it>E. coli </it>membrane-bound ATP synthase, F0 sector, subunit b (AAC76759.1); Blast hit to imembrane-bound ATP synthase, F0 sector, subunit b; Putative RBS for <it>atpH</it>; first gene of a putative operon encoding putative ATP synthase</p>
                     </c>
                     <c ca="left">
                        <p>0.760841</p>
                     </c>
                     <c ca="left">
                        <p>CAGAAGGTTAACTAGAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yegH/wza</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2119</it>; Ortholog of <it>E. coli </it>putative transport protein (AAC75124.1); Blast hit to putative inner membrane protein; intergenic shared with <it>wza </it>(putative polysaccharide export protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.760004</p>
                     </c>
                     <c ca="left">
                        <p>ATTAATATTAAATGAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yjgD/argI</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM4470</it>; <it>S. typhimurium </it>hypothetical protein in <it>argI-miaE </it>intergenic region (ORF15.6). (SW:YJGD_SALTY) putative cytoplasmic protein; Putative binding site for ArgR; shared intergenic regions with <it>argI </it>(arginine ornithine transferase); first gene of a putative operon with <it>miaE </it>(tRNA hydroxylase)</p>
                     </c>
                     <c ca="left">
                        <p>0.759514</p>
                     </c>
                     <c ca="left">
                        <p>ATTAAAATTCACTTTAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>sseJ/STM1630*</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1631</it>; <it>S. typhimurium </it>secreted effector; regulated by SPI-2; shared intergenic with <it>STM1630 </it>(putative inner membrane protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.758303</p>
                     </c>
                     <c ca="left">
                        <p>CTTAAGAAATATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>csrA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM2826</it>; <it>S. typhimurium </it>carbon storage regulator</p>
                     </c>
                     <c ca="left">
                        <p>0.756990</p>
                     </c>
                     <c ca="left">
                        <p>CTTAGGTTTAACAGAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>dinP/yafK</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0313</it>; Ortholog of <it>E. coli </it>damage-inducible protein P; putative tRNA synthetase (AAC73335.1); Blast hit to AAC73335.1 DNA polymerase IV, devoid of proofreading, damage-inducible protein P; intergenic shared with <it>yafKJ </it>(periplasmic protein, putative amido transferase)</p>
                     </c>
                     <c ca="left">
                        <p>0.756938</p>
                     </c>
                     <c ca="left">
                        <p>CATACTGTACACTTAAA</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>STM0346</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Putative outer membrane protein; Homolog of <it>ail </it>and <it>ompX</it></p>
                     </c>
                     <c ca="left">
                        <p>0.756369</p>
                     </c>
                     <c ca="left">
                        <p>CATTAGGTGCTCTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="center">
                        <p>/</p>
                     </c>
                     <c ca="left">
                        <p>1000</p>
                     </c>
                     <c ca="left">
                        <p>Some <it>Salmonella </it>only</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ybfA/STM0707</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0708</it>; Ortholog of <it>E. coli orf</it>, hypothetical protein (AAC73793.1); Blast hit to putative periplasmic protein; intergenic shared with <it>STM0707 </it>(hypothetical protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.754265</p>
                     </c>
                     <c ca="left">
                        <p>ATTAGTATTAATTTAAC</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes?</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yncD/STM1587</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM1587</it>; Ortholog of <it>E. coli </it>putative outer membrane receptor for iron transport (AAC74533.1); Blast hit to paral putative outer membrane receptor; intergenic shared with <it>STM1586 </it>(putative receptor)</p>
                     </c>
                     <c ca="left">
                        <p>0.754063</p>
                     </c>
                     <c ca="left">
                        <p>CATTTTCTTAACTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1100</p>
                     </c>
                     <c ca="left">
                        <p>All nine genomes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>yafC/STM0275</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>STM0256</it>; Ortholog of <it>E. coli </it>putative transcriptional regulator LysR-type (AAC73313.1); Blast hit to putative transcriptional regulator, LysR family; intergenic shared <it>STM0275 </it>(drug efflux protein)</p>
                     </c>
                     <c ca="left">
                        <p>0.753257</p>
                     </c>
                     <c ca="left">
                        <p>CAAAATATCAATTTAAT</p>
                     </c>
                     <c ca="center">
                        <p>m</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>1111</p>
                     </c>
                     <c ca="left">
                        <p>Other distributions</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Name: name of the gene in the <it>S. typhimurium </it>genome (NC_003197). For genes that are divergently transcribed and have a shared intergenic region, the gene for which the motif is detected on the plus strand is indicated first and the gene for which the motif is on the minus strand is indicated after the slash. Description: annotation of the encoded proteins and genome location of the genes (derived from GenBank and Sanger annotation). Score: normalized score assigned to the respective motifs by MotifLocator. Site: instance of the motif as detected in the respective intergenic sequence. Distribution (COG): distribution of the protein as determined by our analysis. The distribution is indicated by a binary profile that indicates the presence 1 versus absence 0 of the protein in species (serovars) of, respectively, <it>Salmonella</it>, <it>E. coli</it>, <it>Shigella </it>and <it>Yersinia </it>(for example, 1111 indicates protein present in all four species; 1000: protein present in <it>Salmonella </it>species only). Distribution: distribution of the protein encoded by the corresponding gene in nine bacterial genomes as determined by McClelland <it>et al. </it><abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Proteins having close homologs in at least one <it>Salmonella </it>strain but not in <it>E. coli </it>or <it>K. pneumoniae </it>are indicated by 'some <it>Salmonella </it>only'. Genes that contain close homologs in all genomes are indicated by 'all nine genomes'. Other combinations are indicated by 'other distributions'. ? indicates that the authors were not certain about the statement. Differences between the distribution as determined by McClelland <it>et al. </it>and the one determined by our analysis is due to the difference in selection criteria used to identify close homologs (see Materials and methods). Alignment: indicates whether the intergenic regions in the dataset could be locally aligned (nd, no local alignment detected that contained the original sequence of <it>S. typhimurium</it>; m, local alignment detected. If the dataset only contained homologs from <it>Salmonella </it>species, local alignments were considered noninformative (indicated by /)). Footprint: denotes whether the PmrA motif is conserved in the close homologs. +, the retrieved putative PmrA motif is conserved; -, the intergenic sequences of the orthologs could be locally aligned but the PmrA motif was not part of the conserved regions. Most promising PmrAB targets that contained a PmrA motif matching the PmrA consensus (Figure <figr fid="F4">4</figr>) are in bold face. PmrA motifs that are experimentally validated in this study are indicated by an asterisk.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Identification of close homologs</p>
            </st>
            <p>We can expect to detect conserved biologically active PmrA motifs only in species that have a functional counterpart of the <it>S. typhimurium </it>PmrAB system. Of all the completely sequenced bacterial species, only the genomes of <it>S. typhimurium</it>, <it>S. typhi</it>, <it>Escherichia coli</it>, <it>Shigella flexneri </it>and <it>Yersinia pestis </it>contain the amino-acid motif that determines the specificity of the sensor protein PmrB (the amino acids suggested to be involved in binding Fe<sup>3+ </sup><abbrgrp><abbr bid="B4">4</abbr></abbrgrp>). Also, the protein domains involved in the binding of PmrA to DNA were almost perfectly conserved in the PmrA orthologs in the species above (PF00486 domain, see supplementary information on our website <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>). Therefore, these &#947;-proteobacterial species were used to perform phylogenetic footprinting analysis. For each gene containing a potential hit of the PmrA motif in the <it>S. typhimurium </it>genome sequence, close homologs were selected as described in Materials and methods.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic footprinting using Gibbs sampling</p>
            </st>
            <p>For each dataset we aimed at constructing a local multiple alignment. We used Gibbs sampling to generate motifs that can be used as alignment seeds. Alignments were subsequently constructed based on the positions of these motif seeds. Potential seeds were selected using a heuristic described in the supplementary information on <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Such multiple alignments summarize the motifs in the intergenic sequences that are conserved between species. We used the alignments to verify whether the putative PmrA motifs retrieved by the genome-wide screening were conserved in other species. Table <tblr tid="T1">1</tblr> gives an overview of the results of the genome-wide screening and the phylogenetic footprinting approach (individual alignments are displayed in the supplementary information at <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>).</p>
         </sec>
         <sec>
            <st>
               <p>Detailed analysis of the putative PmrAB targets</p>
            </st>
            <p>Putative PmrA motifs were detected in the intergenic regions of genes encoding transcriptional regulators, outer-membrane and secreted proteins, proteins with functions involved in flagella and fimbria synthesis, proteins with a function related to the modification of cellular components, putative transport proteins, proteins involved in amino-acid synthesis and also in phage remnants. As mentioned above, if the putative PmrAB-regulated genes contained close homologs in other species, the intergenic sequences of these close homologs were locally aligned to check whether putative PmrA motifs were conserved in these other species as well. For some of the datasets, however, no local alignment could be identified (no motif detected). Closer inspection showed that most of these datasets contained highly homologous paralogs of the original sequence. The intergenic sequences of these paralogs showed an overall low degree of conservation (for example, STM0057) with the original intergenic sequence in <it>S. typhimurium </it>(data not shown). In some of the datasets, a local alignment of the respective intergenic regions could be detected, but the putative PmrA motif was not present within the conserved parts of the alignment (for example, <it>leuO</it>). For these putative PmrAB targets, phylogenetic footprinting could not strengthen the confidence in the prediction of the PmrA motif. If such putative motifs are biologically active, their activity will be restricted to <it>Salmonella </it>serovars or <it>S. typhimurium</it>.</p>
            <p>Our analysis revealed that PmrA motifs, present in the intergenic sequences of known PmrAB-dependent <it>S. typhimurium </it>genes, were also conserved in the intergenic sequences of the orthologs of these genes in related species (Figure <figr fid="F2">2</figr>). An overview of the alignments of these known targets is given below.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Local alignments of the most promising targets</p>
               </caption>
               <text>
                  <p>Local alignments of the most promising targets. Examples of local alignments obtained by phylogenetic footprinting of known PmrAB targets and of some promising potential targets. Known motifs or (putative) PmrA motifs are indicated by a box. <b>(a) </b><it>yfbE </it>(<it>pmrH</it>); <b>(b) </b><it>yjdB </it>(<it>pmrC</it>); <b>(c) </b><it>ugd</it>; <b>(d) </b><it>yibD</it>; <b>(e) </b><it>ybjG </it>(<it>mig-13</it>); <b>(f) </b><it>STM1269 </it>(<it>aroQ</it>); <b>(g) </b><it>sseJ</it>.</p>
               </text>
               <graphic file="gb-2004-5-2-r9-2"/>
            </fig>
            <p><it>pmrH </it>(the first gene of an operon that contains the genes <it>pmrHFIJKLM</it>; Table <tblr tid="T1">1</tblr>) is the only known PmrAB-regulated gene for which the PmrA motif is conserved in all genome sequences analyzed (including that of <it>Y. pestis</it>). In <it>pmrC</it>, encoding a gene with unknown function <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B22">22</abbr></abbrgrp>, the PmrA motif is conserved in the intergenic regions of its orthologs in <it>E. coli </it>strains, <it>Salmonella </it>species and <it>Shigella</it>. <it>ugd </it>encodes a UDP-<smcaps>D</smcaps>-glucose dehydrogenase required for the synthesis of Ara4N. Three two-component systems are involved in its regulation (PmrAB, PhoPQ and RcsCB) <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B15">15</abbr></abbrgrp> and this is reflected in the presence of the corresponding motifs: <it>ugd </it>contains PmrA, PhoP and RcsB motifs. The experimentally confirmed PmrA motif on the plus strand and part of the -10 sequence as determined by Aguirre <it>et al. </it>have been conserved in <it>S. typhimurium</it>, <it>S. typhi </it>and <it>E. coli </it><abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. The promoter of <it>ugd </it>also has a hit of the PmrA motif on the minus strand. This was, however, not confirmed by DNA footprint analysis <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and might represent a false positive. The PhoP motif on the plus strand in <it>ugd </it>of <it>Salmonella</it>, although occurring as a dyad, is not conserved in close orthologs and was recently demonstrated to be non-functional <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The recognition site for the RcsB protein <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> is also conserved in <it>E. coli</it>. Lastly, <it>yibD </it>encodes a putative glycosyltransferase. The PmrA motif is conserved in <it>E. coli</it>. <it>yibD </it>has recently been identified as a PmrAB target by a genome-wide mutagenesis study. Its actual function is still unknown <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Experimental validation by expression analysis</p>
            </st>
            <p>Our <it>in silico </it>predictions pointed towards putative targets of the PmrAB regulatory system. Some of these have functions that were previously not associated with the PmrAB system. To prove the strength of our <it>in silico </it>approach, four potential targets were selected for biological validation: <it>yibD </it>(novel at the time of our analysis), <it>aroQ </it>(<it>STM1269</it>), <it>mig-13 </it>and <it>sseJ</it>. <it>aroQ </it>and <it>yibD </it>were selected because a perfect repeat of the previously described PmrA half-site (CTTAAT <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>) was detected in their respective intergenic regions. <it>mig-13 </it>(Figure <figr fid="F2">2</figr>) was chosen because it has previously been reported as a gene selectively induced in macrophages, but with further unknown regulation <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. <it>sseJ </it>(Figure <figr fid="F2">2</figr>) was further analyzed because although PmrAB-regulated genes have been implicated in animal virulence <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, no direct link between SPI-2 (<it>Salmonella </it>pathogenicity island 2) gene regulation and PmrAB has been demonstrated yet.</p>
            <p>For each of these targets, green fluorescent protein (GFP) reporter fusions were constructed and their expression was determined by fluorescence-activated cell sorter (FACS) analysis in wild-type <it>S. typhimurium </it>and a <it>pmrA</it>::Tn<it>10</it>d mutant. Because the PmrAB system is sensitive to Mg<sup>2+ </sup>and Fe<sup>3+ </sup>concentration, we tested the effect of these signals on the expression of the fusions <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> (Table <tblr tid="T2">2</tblr>). All experiments were performed at pH 5.8 and pH 7.7. All fusions tested exhibited the same PmrAB-dependent expression behavior at both pH levels. In all experiments, <it>pmrC </it>was used as a positive control.</p>
            <tbl id="T2" hint_layout="double">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Expression analysis of the GFP reporter fusions</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>Fusion</p>
                     </c>
                     <c ca="left">
                        <p>Strain</p>
                     </c>
                     <c ca="center">
                        <p>10 mM MgCl<sub>2</sub></p>
                     </c>
                     <c ca="center">
                        <p>10 &#956;M MgCl<sub>2</sub></p>
                     </c>
                     <c ca="center">
                        <p>100 &#956;M FeCl<sub>3</sub></p>
                     </c>
                     <c ca="center">
                        <p>10 mM MgCl<sub>2 </sub>100 &#956;M FeCl<sub>3</sub></p>
                     </c>
                     <c ca="center">
                        <p>10 &#956;M MgCl<sub>2 </sub>100 &#956;M FeCl<sub>3</sub></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrC::GFP</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>WT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.06 (0.18)</p>
                     </c>
                     <c ca="center">
                        <p>16.8 (1.42)</p>
                     </c>
                     <c ca="center">
                        <p>70.53 (3.84)</p>
                     </c>
                     <c ca="center">
                        <p>27.39 (4.41)</p>
                     </c>
                     <c ca="center">
                        <p>83.2 (3.21)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrA</it>
                              <sup>-</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>1.02 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.08 (0.03)</p>
                     </c>
                     <c ca="center">
                        <p>1.03 (0.03)</p>
                     </c>
                     <c ca="center">
                        <p>1.16 (0.12)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>mig-13::GFP</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>WT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.17 (1.55)</p>
                     </c>
                     <c ca="center">
                        <p>13.50 (2.02)</p>
                     </c>
                     <c ca="center">
                        <p>35.81 (4.67)</p>
                     </c>
                     <c ca="center">
                        <p>17.86 (5.04)</p>
                     </c>
                     <c ca="center">
                        <p>49.23 (5.43)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrA</it>
                              <sup>-</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.69 (0.11)</p>
                     </c>
                     <c ca="center">
                        <p>4.32 (0.48)</p>
                     </c>
                     <c ca="center">
                        <p>5.2 (0.09)</p>
                     </c>
                     <c ca="center">
                        <p>2.67 (0.16)</p>
                     </c>
                     <c ca="center">
                        <p>9.64 (1.19)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>aroQ::GFP</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>WT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.32 (0.22)</p>
                     </c>
                     <c ca="center">
                        <p>20.39 (1.54)</p>
                     </c>
                     <c ca="center">
                        <p>19.39 (0.53)</p>
                     </c>
                     <c ca="center">
                        <p>4.38 (0.19)</p>
                     </c>
                     <c ca="center">
                        <p>19.48 (2.07)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrA</it>
                              <sup>-</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.06 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.09 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.71 (0.09)</p>
                     </c>
                     <c ca="center">
                        <p>1.02 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>1.09 (0.03)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>yibD::GFP</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>WT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.25 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.67 (0.26)</p>
                     </c>
                     <c ca="center">
                        <p>33.35 (7.01)</p>
                     </c>
                     <c ca="center">
                        <p>27.52 (5.64)</p>
                     </c>
                     <c ca="center">
                        <p>52.46 (8.98)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrA</it>
                              <sup>-</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.26 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.21 (0.06)</p>
                     </c>
                     <c ca="center">
                        <p>1.30 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.14 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>1.81 (0.44)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>sseJ::GFP</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>WT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.68 (1.55)</p>
                     </c>
                     <c ca="center">
                        <p>11.25(1.46)</p>
                     </c>
                     <c ca="center">
                        <p>22.58 (1.01)</p>
                     </c>
                     <c ca="center">
                        <p>3.80 (1.13)</p>
                     </c>
                     <c ca="center">
                        <p>8.03 (1.27)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>pmrA</it>
                              <sup>-</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.64 (0.72)</p>
                     </c>
                     <c ca="center">
                        <p>8.72 (1.05)</p>
                     </c>
                     <c ca="center">
                        <p>7.35 (1.55)</p>
                     </c>
                     <c ca="center">
                        <p>2.99 (0.43)</p>
                     </c>
                     <c ca="center">
                        <p>6.47 (1.36)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>All experiments were performed twice. Values indicate the average mean peak fluorescence measurements of at least three samples for the populations grown under the conditions indicated for one representative experiment. Values in parentheses represent standard deviations. All values are expressed in arbitrary units. Strains used: WT = ATCC14028s and <it>pmrA</it><sup>- </sup>= <it>pmrA</it>::Tn<it>10</it>d. For <it>pmrC</it>, <it>aroQ</it>, <it>mig-13 </it>and <it>yibD</it>, values represented in the table correspond to experiments performed at pH 7.7. Similar results were obtained at pH 5.8 (data not shown). For <it>sseJ</it>, values correspond to experiments performed at pH 5.8 because at this pH the overall measured expression was higher. The constitutive <it>gfp </it>fusion (pFPV25.1) varied less than 10% between the conditions tested.</p>
               </tblfn>
            </tbl>
            <p>The <it>pmrC </it>fusion showed a clear induction by either Mg<sup>2+ </sup>deprivation or Fe<sup>3+ </sup>excess. The observed level of induction was higher for the Fe<sup>3+</sup>-dependent signal than for the Mg<sup>2+</sup>-dependent signal and the combination of both signals seemed to act synergistically. For both signals, induction was abrogated in a <it>pmrA</it>::Tn<it>10</it>d background, indicating that induction by Mg<sup>2+ </sup>and Fe<sup>3+ </sup>is solely PmrAB dependent. For the <it>mig-13 </it>fusion, similar observations were made, although induction by low Mg<sup>2+ </sup>and the synergistic effect of both signals were less pronounced. <it>mig-13 </it>also exhibited a considerable background expression level both in a <it>pmrA</it>::Tn<it>10</it>d mutant and in the uninduced state in a wild-type background. <it>aroQ </it>was strongly induced by low Mg<sup>2+ </sup>and induction was abrogated in a <it>pmrA</it>::Tn<it>10</it>d background. The influence of Fe<sup>3+ </sup>was less pronounced. In the case of <it>yibD</it>, the opposite was found: the <it>yibD </it>gene was barely induced by low Mg<sup>2+ </sup>but Fe<sup>3+ </sup>excess resulted in a large induction. For the <it>yibD </it>fusion, although Fe<sup>3+ </sup>excess, but not Mg<sup>2+ </sup>deprivation, seemed to be a sufficient signal to trigger expression, both signals acted synergistically. Also, induction of <it>yibD </it>was abrogated in a <it>pmrA</it>::Tn<it>10</it>d background. Compared to the other fusions, the observed expression levels of the <it>sseJ </it>fusion were rather low in the test conditions. Because <it>sseJ </it>showed a higher overall expression level at pH 5.8, these data were considered most representative (see Table <tblr tid="T2">2</tblr>). Results show an upregulation of <it>sseJ </it>expression in elevated Fe<sup>3+ </sup>concentrations that was absent in the <it>pmrA</it>::Tn<it>10</it>d background. As observed for <it>mig-13</it>, <it>sseJ </it>was expressed at a background level in the mutant <it>pmrA</it>::Tn<it>10</it>d. Interestingly, even at low concentrations, Mg<sup>2+ </sup>seemed to counteract the Fe<sup>3+</sup>-dependent induction.</p>
         </sec>
         <sec>
            <st>
               <p>Site-directed mutagenesis of the PmrA box</p>
            </st>
            <p>We constructed a set of mutant PmrA box sequences by site-directed mutagenesis of the PmrA box of <it>yibD</it>. AT &#8594; GC and GC &#8594; AT substitutions were introduced in the first half-site of the PmrA box (Figure <figr fid="F3">3a</figr>). We focused on the first half-site, as in the experimentally verified target <it>pmrC</it>, the second half-site overlaps with the -35 promoter site <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Expression was compared in different mutagenized fusions and the nonmutated fusion in the wild type and in the <it>pmrA</it>::Tn<it>10</it>d strain in all conditions mentioned above. For simplicity, only the expression values for two inducing conditions are displayed in Figure <figr fid="F3">3b</figr>. One is induction by the combined action of high Fe<sup>3+ </sup>and low Mg<sup>2+ </sup>concentrations and the other is the induction by raised Fe<sup>3+ </sup>levels in the presence of high Mg<sup>2+</sup>. Observations under all other conditions allowed us to draw similar conclusions. Substitutions in the third and fifth positions of the motif box completely abrogated PmrAB-dependent expression. Mutations of the first, second, fourth or sixth position reduced PmrAB-dependent induction. Note that for the mutation in the second position, expression was very low but not completely abrogated. Results from this site-directed mutagenesis experiment of one representative PmrAB target allowed us to demonstrate unequivocally that the PmrA box we identified was responsible for PmrAB-dependent transcriptional activation. It also allowed us to further delineate the sequence requirements of the PmrA consensus.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Site-directed mutagenesis of the PmrA box in <it>yibD</it></p>
               </caption>
               <text>
                  <p>Site-directed mutagenesis of the PmrA box in <it>yibD</it>. <b>(a) </b>Construction of six species of the <it>yibD </it>promoter mutant, designated pCMPG5615 to pCMPG5620, each with a single base substitution (T &#8594; G or A &#8594; C) in the PmrA box. Promoters were fused to GFP and promoter activity was assessed by FACS analysis. <b>(b) </b>Plot of the normalized expression values of the six mutant fusions and the wild-type fusion measured in two distinct conditions in the wild type and <it>pmrA</it>::Tn<it>10</it>d mutant background. Gray bars represent condition 1 (pH 7.7, 100 &#956;M FeCl<sub>3 </sub>+ 10 &#956;M MgCl<sub>2</sub>), white bars correspond to the expression values observed in condition 2 (pH 7.7, 100 &#956;M FeCl<sub>3 </sub>+ 10 mM MgCl<sub>2</sub>). w, wild-type background; m, <it>pmrA</it>::Tn<it>10</it>d mutant background. The <it>pmrC::GFP </it>fusion was included as a positive control. Bars represent the standard deviations of three independent measurements.</p>
               </text>
               <graphic file="gb-2004-5-2-r9-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Other promising PmrAB targets</p>
            </st>
            <p>On the basis of the instances of the PmrA motif in experimentally verified PmrAB targets of <it>Salmonella </it>(verified previously or validated in this study), a PmrA consensus was built (Figure <figr fid="F4">4</figr>). The motif consensus of PmrA was converted into a regular expression (A/C)(C/T)T(A/T)A(T/G/A) N<sub>5</sub>NTT(A/T)A(T/A/G). To construct this regular expression we only considered the two conserved half-sites, because the PmrA motif is believed to be a dyad <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. We preferred the part between the conserved half-sites of the regular expression to be represented as degenerate (that is, N<sub>5</sub>). Indeed, the observed degree of conservation in the intermediate part of the motif model (Figure <figr fid="F4">4b</figr>) is probably related to the restricted sample size of the training set rather than being an intrinsic property of the motif. Promising motifs (indicated in bold in Table <tblr tid="T1">1</tblr>) are, therefore, motifs that match this regular expression and thus contain nucleotides that occur in the conserved half-sites of one of the experimentally verified examples. Promising targets for which the putative PmrA motif was also conserved in species other than <it>Salmonella </it>were <it>mig-13</it>, <it>yrbF</it>, <it>yjgD</it>, <it>ybdO</it>, <it>yejG</it>, <it>lasT </it>and <it>ybdN. </it>Promising targets only present in <it>S. typhimurium </it>and/or <it>S. typhi </it>were <it>STM1269 </it>(<it>aroQ</it>), <it>STM1273</it>, <it>sseJ </it>and <it>lpfA. </it>Note that this listing is just based on an arbitrary selection criterion, that is, a preliminary PmrA motif consensus that will be improved as more PmrAB targets become experimentally validated. As well as the targets mentioned above, Table <tblr tid="T1">1</tblr> contains other targets that are of interest because their annotation relates to the PmrAB system (such as <it>yncD</it>).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Refined consensus of the PmrA box</p>
               </caption>
               <text>
                  <p>Refined consensus of the PmrA box. <b>(a) </b>Alignment of all experimentally verified PmrA sites (<abbrgrp><abbr bid="B15">15</abbr></abbrgrp> or this work) in <it>S. typhimurium </it><abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. PmrA sites in the orthologs of these respective experimentally verified genes are also displayed if these PmrA motif instances deviated from the PmrA motif in <it>S. typhimurium</it>. <b>(b) </b>An adapted motif model of the PmrA site was built (represented by its logo) on the basis of the sequences represented in (a).</p>
               </text>
               <graphic file="gb-2004-5-2-r9-4"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Putative PmrAB targets were detected by genome-wide screening of <it>S. typhimurium </it>intergenic sequences using a PmrA motif model. If possible, the confidence in the predicted motifs was strengthened by a cross-species comparison: we tested whether the PmrA motif was conserved in the intergenic regions of close homologs in related species. To this end, we developed a two-step procedure for phylogenetic footprinting. In the first step, a motif-detection procedure based on Gibbs sampling was performed to generate a list of motifs. In the second step, these motifs were used as seeds to generate local multiple alignments. Eventually, the biological relevance of the obtained alignments was assessed.</p>
         <p>We used the alignments rather than a listing of the high-scoring motifs obtained by Gibbs sampling for the following reasons. First, we observed, as also reported by McCue <it>et al.</it>, a high overall similarity in intergenic regions of the selected species <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. In general, the overall degree in conservation between the intergenic sequences of close homologs is about 93.56% for the sequenced representatives of <it>Escherichia </it>and <it>Shigella </it>species, 69.21% for <it>Shigella </it>and <it>Salmonella </it>and 53.31% for <it>Salmonella </it>and <it>Yersinia</it>. As a result of this property (high correlation in the data), not only the motif itself turns out to be conserved, but also its local neighborhood. Moreover, the degree of conservation between the aligned sequences in a biologically relevant alignment will reflect, in most cases, the phylogenetic relatedness of the species from which the sequences are derived (see Figure <figr fid="F2">2</figr> for examples). By selecting the most promising alignment seeds (based on the appropriate heuristics for the scores) and constructing a local alignment with these seeds, we could also evaluate the local neighborhood of the seed. If this one seemed to be conserved as well, we could be more confident in the obtained alignment and in the motifs contained within the conserved parts. Therefore, the use of local alignments allows a better judgment on the reliability of the motifs.</p>
         <p>Second, Gibbs sampling is a stochastic procedure. The algorithm has to be run repeatedly on the same dataset, each time generating potentially different motifs. As a consequence, the output of a motif-detection approach can be simultaneously redundant and non-exhaustive: some statistically strong motifs are detected repeatedly in different runs. On the other hand, some motifs might never be detected. Indeed, because Gibbs sampling was originally designed for unrelated sequences and because of the high correlation in the data, the number of possible equally scoring motifs (local optima) might be so high that many runs have to be performed before all motifs have been covered. All these local optima coincide with motifs that, when used as seeds, will result in a similar alignment. The same alignment can thus be obtained by several motifs, but there is no guarantee that all possible motifs that result in the same alignment will be detected by Gibbs sampling. Therefore, an alignment is a better summary of the degree of conservation between the intergenic regions than a listing of the highest-scoring motifs.</p>
         <p>Moreover, regulatory systems such as PmrAB might have acquired some very species-specific targets. For such highly specialized regulatory systems, motifs are likely to be present in the intergenic sequences of a selected subset of orthologs only. Because such motifs occur in a restricted number of sequences of the dataset, they will not necessarily correspond to the highest-scoring motifs. Thus, they might be overlooked when selecting on high-scoring motifs by, for instance, setting a threshold on the score. Once a reliable local alignment of a set of intergenic sequences is obtained, one can judge the degree of confidence to put on the prediction of the motif of interest not only by checking in which subset of species the motif is conserved, but also by taking into consideration other factors, such as the functional annotation of the putative target. The motifs that we select on the basis of our heuristic will result in a biologically relevant alignment that includes the maximal number of species. As such, our heuristic tries to overcome the fact that Gibbs sampling is intrinsically unable to cope with correlated data. Note that the motif of interest (PmrA motif) does not necessarily have to correspond to the motif used to produce the alignment.</p>
         <p>We showed that our <it>in silico </it>phylogenetic footprinting approach can be used to confirm targets detected by genome-wide screening. So far, it can only be used for species that show a high degree of conservation in their intergenic regions, similar to the conservation observed in this study. As more complete genomic data become available, the approach might be extended to other species.</p>
         <p>As suggested previously <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>, the high observed similarity in intergenic sequences might be due to the small phylogenetic distance between the species we analyzed. However, it cannot be excluded that because of the small size of the intergenic regions in bacteria and the very similar habitat and mechanism of regulation among the &#947;-proteobacterial species used in this study, a large part of the complete intergenic region is functional and therefore conserved. This hypothesis was also put forward by Rajewsky <it>et al. </it><abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. The alignment of the intergenic region of the well-characterized <it>ugd </it>indeed points in that direction. Large parts of the conserved regions of the alignments correspond to experimentally verified motifs.</p>
         <p>Remarkably, most potential PmrAB-regulated genes exhibited a footprint of the PmrA motif in <it>E. coli </it>only, and several target genes had no counterpart at all in organisms other than <it>Salmonella </it>species. This indicates a high degree of specialization of the PmrAB two-component system in <it>Salmonella</it>. Such specialization could also explain the considerable differences between PmrAB-dependent regulons in related species. For instance, in both <it>Y. pestis </it>and <it>S. typhimurium </it>the attenuated virulence of <it>phoP </it>mutants is ascribed to a defect in LPS modification, a process shown to be PmrAB-dependent <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. So far, two <it>S. typhimurium </it>loci have been postulated to be involved in this LPS remodeling: <it>pmrHFIJKLM </it>and <it>ugd</it>. Only for <it>pmrH </it>did we detect an ortholog in <it>Y. pestis </it>and a conserved footprint of the PmrA motif in the promoter region of this ortholog. The Ugd protein does not even have a functional counterpart in <it>Y. pestis</it>. This low similarity in PmrAB regulon composition indicates that a different network of genes must be responsible for a similar phenotype in distinct species. This is not completely unexpected in view of the very different LPS composition of <it>Salmonella </it>and <it>Y. pestis </it><abbrgrp><abbr bid="B42">42</abbr></abbrgrp>.</p>
         <p>For most of the known experimentally verified targets, clear phylogenetic footprints of the PmrA motif could be detected in the intergenic regions of close homologs. In the intergenic region of <it>pmrD </it>we could recover the consensus sequence only partially (that is, one half-site) because the second half-site overlaps with the coding region (data not shown) and this was not included in the current analysis. Another PhoPQ-dependent gene that contributes to resistance to antimicrobial peptides is <it>mig-14 </it><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. However, we could not find the presence of a clear PmrA consensus in the promoter of <it>mig-14</it>. Neither could we detect a PmrA motif in <it>dgoA</it>, which was previously shown to be regulated by PmrAB <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. This would indicate that both targets are only indirectly dependent on PmrAB. It can, however, not be excluded that they represent false negatives of our screening.</p>
         <p>As well as the known targets, several putative new predictions could be made. Some of these predictions are consistent with previously published observations. Indeed, the PmrAB system is part of a complex regulatory cascade acting downstream of the pleiotropic PhoPQ system. The PhoPQ regulon is responsible for intracellular survival of bacteria and genes dependent on PhoPQ are induced in bacteria inside macrophages. Part of the PhoPQ regulon has been discovered to be dependent only indirectly on PhoPQ, via PmrAB. This PmrAB-dependent subset is known to confer resistance to cationic peptides by encoding genes involved in LPS modification and genes contributing to resistance to raised Fe<sup>3+ </sup>concentration. Genes encoding proteins involved in modification of membrane components and outer-membrane proteins are therefore sensible additional putative PmrAB targets. Another target worth mentioning in view of the Fe<sup>3+</sup>-sensitivity of the PmrAB system is <it>yncD</it>, which encodes a putative outer-membrane receptor for iron transport.</p>
         <p>Phage remnants, such as <it>mig-3</it>, have been described as macrophage inducible, PhoPQ-dependent genes <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, and thus can be PmrAB-dependent. This might explain the PmrA motif in the intergenic region between <it>STM1868A </it>and <it>mig-3</it>. Detweiler <it>et al. </it>showed that two genes, <it>virK </it>and <it>somA</it>, both coexpressed with the SPI-2 system, confer resistance to cationic peptides and their expression is PhoPQ-dependent. Also, four fimbrial operons had genes that were coexpressed with SPI-2 <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Predictions of the PmrAB-dependence of <it>sseJ</it>, which encodes a secreted effector of the SPI-2 system, or of genes that are involved in fimbrial synthesis (such as in <it>lpfA</it>, encoding the <it>S. typhimurium </it>long polar fimbria A precursor), could therefore be in agreement with these findings. Recently, the study of Kim <it>et al. </it>related PmrAB-dependent regulation to swarming motility functions in <it>S. typhimurium </it><abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. This could explain why we detected a putative PmrA motif in the intergenic region of <it>flhC</it>, which encodes a master transcriptional activator of flagellar genes.</p>
         <p>To confirm the predictive power of our methodology further, four putative PmrAB targets were validated biologically. Expression analysis clearly demonstrated PmrAB-dependence of <it>yibD</it>, which confirms the recent observations of Tamayo <it>et al. </it><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The observed PmrA-dependence of <it>mig-13 </it>accords with its being upregulated in macrophages in <it>in vivo </it>conditions <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. The clear PmrAB-dependence of <it>aroQ</it>, which encodes a periplasmic chorismate mutase, is striking. In general, chorismate mutases are involved in the synthesis of tyrosine and phenylalanine and are key to the synthesis of a plethora of secondary metabolites <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. The function of periplasmic chorismate mutases, which differ from the cytoplasmic chorismate mutases in their long carboxy-terminal extension <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>, is still unclear. Periplasmic AroQ proteins have also been detected in <it>Y. pestis</it>, <it>Pseudomonas aeruginosa</it>, <it>Mycobacterium </it>species, <it>Erwinia herbicola </it>and in the phytoparasitic nematode <it>Meloidogyne javanica </it><abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. Strikingly, all these organisms containing AroQ interact with a eukaryotic host. This observation, together with the fact that AroQ is dependent on the key virulence regulator PmrAB in <it>S. typhimurium</it>, suggests that the as-yet-unknown function of AroQ might be involved in bacteria-host interactions.</p>
         <p>Despite its low expression level in our <it>in vitro </it>conditions, the <it>sseJ </it>fusion showed a clear PmrAB-dependent induction by Fe<sup>3+ </sup>excess. SseJ is a secreted effector protein that is translocated across the membrane of the <it>Salmonella</it>-containing vacuole (SCV) by SPI-2. From recent evidence it was speculated that the putative acyltransferase activity of SseJ would be involved in modifying the lipid composition of the SCV <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>, thereby interfering with the trafficking and maturation properties of the SCV in infected cells. The PmrA-dependence of <it>sseJ </it>would therefore link expression of genes involved in bacterial LPS modification with those involved in regulating the lipid composition of the SCV membrane.</p>
         <p>Further experimental analysis will shed light on how these previously undescribed PmrAB-dependent proteins, with unknown functions, relate to the known part of the PmrAB-dependent regulon.</p>
         <p>The extent to which each of the tested strains reacted to the signals Fe<sup>3+ </sup>or/and Mg<sup>2+ </sup>varied considerably. This is not surprising in view of the complex regulatory system that integrates both these signals. Indeed, both signals are transduced via the PhoPQ, PmrD, PmrAB multicomponent system, which includes a posttranslational signal transduction and a transcriptional feedback loop <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Depending on the affinities between the interacting components of such dynamic systems, small changes in the initial concentrations of the components might result in large differences in the observed expression levels <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. A more detailed study of the dynamics of this system might reveal how such systems can integrate signals so differently.</p>
         <p>Site-directed mutagenesis of the PmrA box in the <it>yibD </it>promoter indicated a crucial role for the T at position 3 and the A at position 5 of the first half-site of the motif. As can be deduced from the consensus site in Figure <figr fid="F4">4</figr>, no degeneracy is allowed at positions 3 and 5. This observation allows us to extrapolate to a certain extent the sequence requirements of the PmrA box in <it>yibD </it>to other PmrAB targets. Some positions seem essential, whereas it appears that the specific choice of nucleotide at the other positions affects the level of induction. By altering the nucleotides, the binding affinities of the regulatory protein to the box can be modified, allowing specific fine-tuning of gene expression in a cell.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>We conclusively demonstrate that our <it>in silico </it>approach reliably identifies additional PmrAB-dependent targets. Although false positives will still be present among these predicted targets, the method offers an interesting approach for further elucidation of genetic networks involved in the expression of <it>S. typhimurium </it>virulence genes. We predicted the PmrAB-dependent regulation of four additional targets: <it>yibD</it>, <it>aroQ</it>, <it>mig-13 </it>and <it>sseJ</it>. Our approach might become extendable to other species when more genome sequences become available.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>Selection of intergenic sequences</p>
            </st>
            <p>Genome sequences were obtained from GenBank <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. All intergenic regions used in this study were extracted using the modules of INCLUSive <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> to automatically parse GenBank entries <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Here, we define an intergenic sequence as a region that contains the noncoding sequence between two coding regions. No overlap with coding regions is allowed. Intergenic regions with lengths smaller than 10 base-pairs (bp) were discarded because of computational reasons.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of motif models</p>
            </st>
            <p>A motif model (a probabilistic representation of the consensus DNA pattern that is recognized by the respective regulatory protein) for PmrA was constructed using MotifSampler <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. The PmrA training set consisted of the promoter regions of three known PmrAB-regulated genes (<it>ugd </it><abbrgrp><abbr bid="B7">7</abbr><abbr bid="B15">15</abbr><abbr bid="B17">17</abbr></abbrgrp>, <it>pmrH </it><abbrgrp><abbr bid="B7">7</abbr><abbr bid="B14">14</abbr><abbr bid="B17">17</abbr><abbr bid="B19">19</abbr></abbrgrp> and <it>pmrC </it><abbrgrp><abbr bid="B2">2</abbr><abbr bid="B14">14</abbr></abbrgrp>) for which the binding of the PmrA protein to the promoter regions was verified by DNA footprint analysis <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Genome-wide screening</p>
            </st>
            <p>The intergenic regions of the complete genome of <it>S. typhimurium </it>LT2 (NC_003197 <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>) were screened using MotifLocator <abbrgrp><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. The scoring scheme used by MotifLocator is extensively described in Thijs <it>et al. </it><abbrgrp><abbr bid="B55">55</abbr></abbrgrp> and uses an extension of the classical position-weight matrix scoring scheme <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. Given the motif model <it>&#952; </it>and the background model <it>B<sub>m </sub></it>a score <it>W</it>(<it>x</it>) is computed for each window <it>x </it>of length <it>l </it>in the sequence <it>S</it>. <it>W</it>(<it>x</it>) compares the score of the subsequence within the window being generated by the motif model to the score of the subsequence within the window being generated by the background model. <it>b<sub>j</sub></it>: nucleotide at position <it>j </it>in the segment.</p>
            <p>
               <graphic file="gb-2004-5-2-r9-i1.gif"/>
            </p>
            <p>Both the plus and minus strand were screened using a background model of order 3. The higher-order background allows implicit compensation for motifs that are located in a context highly resembling the global nucleotide composition of the genome. To apply a threshold on the scores, the scores of different motifs were normalized such that their values ranged between 0 and 1. The normalized scores <graphic file="gb-2004-5-2-r9-i2.gif"/> are displayed in Table <tblr tid="T1">1</tblr>.</p>
            <p>
               <graphic file="gb-2004-5-2-r9-i3.gif"/>
            </p>
            <p>Hits with a score above 0.75 were retained (corresponding to a selection of the 0.003% top-scoring hits of the total number of possible motif positions in the genome. Possible positions are identified as overlapping windows of length <it>l</it>). To give a rough assessment of the number of hits with a score similar to the chosen threshold that could be expected from the specific nucleotide composition of the genome, we generated 100 random sets of intergenic sequences using a third-order background model. These random sets were scored with the same PmrA motif model. From these results it appeared that the true set contained three times more hits with a score above the threshold than an average random genome.</p>
         </sec>
         <sec>
            <st>
               <p>Identification of datasets</p>
            </st>
            <p>Highly similar homologs of the putative PmrAB-regulated genes were identified in the genome sequences of <it>S. typhimurium </it>(NC_003197), <it>S. typhi </it>(NC_003198), <it>S. flexneri </it>(NC_004337), <it>E. coli </it>O157:H7 (NC_002695), <it>E. coli </it>O157:H7 EDL933 (NC_002655), <it>E. coli </it>K12 (NC_000913), <it>Y. pestis </it>CO92 (NC_003143) and <it>Y. pestis </it>KIM (NC_004088). In general, only true orthologs are likely to have retained a similar function and therefore a similar mechanism of regulation <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. However, ortholog identification is a difficult problem and discriminating between true orthologs and paralogs is not always straightforward. Because our motif-detection algorithm is, to some extent, robust against the presence of noise and allows for the presence of sequences that do not contain the motif <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>, we did not make an <it>a priori </it>distinction between true orthologs and paralogs if both appeared highly similar to the original protein. This motivated us to use the principle of clusters of orthologs for dataset construction <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. The pairwise BLAST scores obtained by mutually aligning the whole-genome sequences using BlastP <abbrgrp><abbr bid="B59">59</abbr></abbrgrp> were used as input of the cluster program TRIBE-MCL <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. Stringent criteria were applied to retain only closely related orthologs and paralogs (cut-off of the BLAST hit was an E-value of 1e<sup>-80</sup>). For those proteins that, when BLASTed against themselves, gave rise to an E-value higher than 1e<sup>-80 </sup>(<it>yjbE</it>, <it>STM1926</it>, <it>STM0344</it>, <it>yhcN</it>, <it>STM1868A</it>, <it>yceP</it>, <it>atpF</it>, <it>yjgD</it>, <it>csrA</it>, <it>ybfA</it>) the threshold was relaxed (E-value 1e<sup>-20</sup>). The choice of the stringent threshold was essential to maximally reduce the noise in the datasets.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic footprinting by Gibbs sampling</p>
            </st>
            <p>We used a two-step procedure for phylogenetic footprinting. In the first step, Gibbs sampling is performed to generate a list of motifs. Subsequently, local alignments are generated by selecting motifs that can be used as alignment seeds and by assessing the relevance of the alignments by a test statistic.</p>
            <sec>
               <st>
                  <p>Motif detection by Gibbs sampling</p>
               </st>
               <p>An advanced Gibbs sampling procedure for motif detection was used (MotifSampler). MotifSampler allows us to search for overrepresented motifs in each dataset. The motif length, the maximal number of different motifs and the background model are user-defined parameter settings of the algorithm described in Thijs <it>et al. </it><abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. A recent extension of the algorithm allows to automatically determine the number of instances of a certain motif per sequence <abbrgrp><abbr bid="B55">55</abbr></abbrgrp> and requires a predefined indication on the prior probability of expecting at least one motif per sequence. For each dataset, 100 runs of the MotifSampler were performed under the following conditions: motif lengths varying from 6, 8, 10, 12; background order 0; prior probability default value 0.7. Because Gibbs sampling is a stochastic procedure, each run can give rise to different motifs. To summarize the results from the 100 runs, all detected motifs were mutually compared and similar motifs were grouped. The information content was used as a similarity measure to compare motifs. For each dataset, therefore, a list of different potential motifs was obtained. Motifs in this list were ranked according to their log-likelihood score (LL-score) <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>Generating reliable local alignments using the detected motifs</p>
               </st>
               <p>From the obtained list, motifs that could be used as seeds to generate a biologically relevant alignment were selected using a heuristic <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. Motifs with a high LL-score that occurred preferentially once in each sequence were chosen (starting with those motifs that had the highest consensus score). Moreover, we preferentially selected motifs that occurred in the maximal number of species. For each dataset, multiple alignments were constructed using the position of these retrieved motifs as alignment initializations (seeds) until a reliable alignment was obtained. The alignment was considered biologically relevant if within a window of 100 bp around the motif it exhibited a degree of conservation that reflected the overall observed homology between intergenic sequences of the selected species (interspecies homology).</p>
               <p>To assign a more quantitative criterion to the alignment, a <it>p</it>-value was assigned to each alignment that was calculated as follows: for each window of 100 bp around the motif, the largest conserved block not overlapping with the core motif was identified (using the consensus score of minimal 0.7 as minimal similarity measure). This <it>p</it>-value expresses the probability of observing a conserved block of the same length in a randomly aligned dataset of similar composition. Distributions of conserved blocks in randomly aligned sequences were constructed <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. These random datasets take into account the observed high pairwise sequence homology between intergenic sequences derived from similar species (serovars) (homology between <it>E. coli </it>sequences, homology between <it>Salmonella </it>sequences, homology between <it>Y. pestis </it>sequences), but not the interspecies homology between intergenic regions (for example, between <it>E. coli </it>and <it>Salmonella</it>). All alignments with a <it>p</it>-value less than 0.15 (the <it>p</it>-value of <it>ugd</it>) were considered as relevant (indicated in Table <tblr tid="T1">1</tblr> with 'm'). Because the obtained alignments are local, they are gapless. In some cases, more than one alignment might be essential to cover the complete intergenic region.</p>
               <p>Selected alignments are displayed in the supplementary information at <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Sequence editing was done in BioEdit <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Functional annotation</p>
            </st>
            <p>Functional annotation was derived from the National Center for Biotechnology Information (NCBI) <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B52">52</abbr></abbrgrp> and from the Sanger annotation of <it>S. typhi </it><abbrgrp><abbr bid="B64">64</abbr></abbrgrp>. Specific genomic context was derived from NCBI <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B52">52</abbr></abbrgrp>. The distribution of the putative targets (unique for <it>Salmonella </it>species versus more widely distributed), as derived from our clusters of orthologous groups (COGs), was verified by comparison to the analysis of McClelland <it>et al. </it><abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, who included, in addition to the species we used, several subspecies of <it>Salmonella </it>(six genomes), and species more distantly related to <it>Salmonella </it>(<it>Klebsiella pneumoniae</it>).</p>
         </sec>
         <sec>
            <st>
               <p>Bacterial strains and growth conditions</p>
            </st>
            <p>The bacterial strains and plasmids used in this study are listed in Table <tblr tid="T3">3</tblr>. Bacteria were grown overnight at 37&#176;C with aeration in Luria-Bertani (LB) broth or in the nitrogen minimal medium of Nelson and Kennedy <abbrgrp><abbr bid="B65">65</abbr></abbrgrp> with modifications as previously described <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. The pH of the medium was buffered with 100 mM Tris-HCl, adjusted to pH 7.4 or pH 5.8. MgCl<sub>2 </sub>was added at a final concentration of 10 &#956;M or 10 mM. FeCl<sub>3 </sub>was used at a final concentration of 100 &#956;M from a freshly prepared 10 mM stock. Antibiotics were used, when appropriate, at the following concentrations: tetracycline, 30 &#956;g/ml; and ampicillin, 100 &#956;g/ml.</p>
            <tbl id="T3" hint_layout="double">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Bacterial strains</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c cspan="2" ca="left">
                        <p>Strain or plasmid</p>
                     </c>
                     <c ca="left">
                        <p>Relevant genotype</p>
                     </c>
                     <c ca="left">
                        <p>Reference or source</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Salmonella</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ATCC 14028s</p>
                     </c>
                     <c ca="left">
                        <p>Wild type</p>
                     </c>
                     <c ca="left">
                        <p>ATCC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>JSG421</p>
                     </c>
                     <c ca="left">
                        <p><it>pmrA</it>::Tn<it>10</it>d</p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B21">21</abbr></abbrgrp> kind gift of J.S. Gunn</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>LB5010</p>
                     </c>
                     <c ca="left">
                        <p><it>metA22 metE551 ilv-452 leu-3121 trp</it>&#916;<it>2 xyl-404 galE856 hsdLT6 hsdSA29 hsdSB121 rpsL120</it></p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B67">67</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>E. coli</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>DH5&#945;</p>
                     </c>
                     <c ca="left">
                        <p>F&#966;80&#916;<it>lacZ</it>M15 &#916;(<it>lacZYAargF</it>)U169 <it>deoP recA1 endA1 hsdR17 </it>(r<sub>k</sub><sup>-</sup>m<sub>k</sub><sup>-</sup>)</p>
                     </c>
                     <c ca="left">
                        <p>Gibco BRL</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Plasmids</p>
                     </c>
                     <c ca="left">
                        <p>pCRII-TOPO</p>
                     </c>
                     <c ca="left">
                        <p>Cloning vector, Amp<sup>R</sup></p>
                     </c>
                     <c ca="left">
                        <p>Invitrogen</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pFPV25</p>
                     </c>
                     <c ca="left">
                        <p>ColE1 <it>mob bla </it>promoterless <it>gfp</it>mut3, Amp<sup>R</sup></p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B40">40</abbr></abbrgrp> kind gift of R. Valdivia and S. Falkow</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pFPV25.1</p>
                     </c>
                     <c ca="left">
                        <p>Constitutive <it>rpsM </it>promoter in pFPV25, Amp<sup>R</sup></p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B40">40</abbr></abbrgrp> kind gift of R. Valdivia and S. Falkow</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611</p>
                     </c>
                     <c ca="left">
                        <p>pFPV25 with <it>yibD </it>promoter</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5612</p>
                     </c>
                     <c ca="left">
                        <p>pFPV25 with <it>ybjG </it>promoter</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5613</p>
                     </c>
                     <c ca="left">
                        <p>pFPV25 with <it>STM1269 </it>promoter</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5614</p>
                     </c>
                     <c ca="left">
                        <p>pFPV25 with <it>yjdB </it>promoter</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5621</p>
                     </c>
                     <c ca="left">
                        <p>pFPV25 with <it>sseJ </it>promoter</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5615</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif C&#8594;A</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5616</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif T&#8594;G</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5617</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif T&#8594;G</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5618</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif A&#8594;C</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5619</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif A&#8594;C</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pCMPG5620</p>
                     </c>
                     <c ca="left">
                        <p>pCMPG5611 with point mutated putative PmrA motif T&#8594;C</p>
                     </c>
                     <c ca="left">
                        <p>This work</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Molecular methods</p>
            </st>
            <p>Plasmid DNA, after passage through <it>S. typhimurium </it>LB5010 <abbrgrp><abbr bid="B67">67</abbr></abbrgrp>, was introduced into bacterial strains by electroporation. Polymerase chain reaction (PCR) was carried out in a Personal Mastercycler (Eppendorf, Hamburg, Germany) with <it>Pfx </it>DNA polymerase, using the manufacturer's instructions. The constructs containing the putative promoter regions of <it>yibD</it>, <it>mig-13</it>, <it>aroQ</it>, <it>sseJ </it>and <it>pmrC </it>and the site-directed mutated <it>yibD </it>promoter fragments were all verified by sequence analysis.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of plasmids</p>
            </st>
            <p>To construct the <it>gfp </it>reporter fusions of <it>yibD</it>, <it>mig-13</it>, <it>aroQ, sseJ </it>and <it>pmrC</it>, the primers listed in Table <tblr tid="T4">4</tblr> were used in a PCR reaction (as described above) to amplify the respective promoter regions from the ATCC14028s genome. Restriction sites in the primers are indicated in bold face in Table <tblr tid="T4">4</tblr>. The promoter fragments were digested with <it>Eco</it>RI and <it>Bam</it>HI and cloned into pCRII-TOPO that had been digested with <it>Eco</it>RI and <it>Bam</it>HI. The promoter fragments were subcloned as <it>Eco</it>RI/<it>Bam</it>HI fragments into the corresponding sites of pFPV25 <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, resulting in the pCMPG plasmids listed in Table <tblr tid="T3">3</tblr>. These plasmids were electroporated into ATCC14028s and JSG421 <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> after propagation through LB5010, as described above. Cloning steps were carried out in <it>E. coli </it>DH5&#945;.</p>
            <tbl id="T4" hint_layout="double">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Primers used to construct the GFP promoter fusions</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>Sequence 5' to 3'</p>
                     </c>
                     <c ca="left">
                        <p>Description</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="3" ca="left">
                        <p>Amplification of promoter regions</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-115</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GAATTC</b>TAATTCGAGTTGCTTAAAGGCGGC</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>yibD </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-116</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GGATCC</b>GCTCCCGCATTATATAACGGG</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>yibD </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-117</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GAATTC</b>GCCAATAAAAACCGCGCAGAGTG</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>mig-13 </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-118</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GGATCC</b>AGCGAGTTGTTAAGGTTTTCCAGC</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>mig-13</it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-119</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GAATTC</b>GAAGATTCCGCAGAATCAACGGCC</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>aroQ </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-120</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GGATCC</b>GGTGCTGCACATCAATAAAGAACAAAG</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>aroQ </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-121</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GAATTC</b>GTATTGCATCTGGGCGGTCATCG</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>pmrC </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-122</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CC<b>GGATCC</b>AGGCGATTTGCCCAAGAACAGG</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>pmrC </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-224</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>AT<b>GAATTC</b>GCTTCCCCATCCCAAACCACC</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>sseJ </it>promoter region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Pro-225</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>AT<b>GGATCC</b>GGAAGGCGTGCGCTTTCTTTTATC</monospace>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Amplification of <it>sseJ </it>promoter region</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Restriction sites in the primers are indicated in bold type.</p>
               </tblfn>
            </tbl>
            <p>The single base-pair substitutions in the putative PmrA motif occurring in the <it>yibD </it>promoter sequence were introduced via a PCR approach using the QuickChange Site-Directed mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions. The <it>yibD </it>promoter sequence introduced into pCRII-TOPO was used as the parent plasmid and appropriate primers were applied (sequences not shown). The site-directed mutated <it>yibD </it>promoter fragments were subcloned into pFPV25 (<it>Eco</it>RI/<it>Bam</it>HI), resulting in plasmids pCMPG5615 &#8594; pCMPG5620, as listed in Table <tblr tid="T3">3</tblr>. These reporter plasmids were electroporated into ATCC14028s and JSG421.</p>
         </sec>
         <sec>
            <st>
               <p>Fluorescence-activated cell sorter-based expression analysis</p>
            </st>
            <p>Bacterial strains harboring the reporter constructs were grown overnight in nitrogen (N)-minimal medium pH 7.4 plus 10 mM MgCl<sub>2</sub>, harvested, washed in N-minimal medium pH 7.4 without MgCl<sub>2</sub>, and diluted 1:100 in N-minimal medium pH 7.4 plus 10 mM MgCl<sub>2</sub>. Mid-log-phase bacteria were then inoculated into the indicated media and grown for 3 h to allow expression of GFP. Bacteria were diluted into PBS and analyzed by flow cytometry with a Becton Dickinson FACSCalibur and CellQuest acquisition and analysis software <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> with gates set to forward and side scatters characteristic of the bacteria.</p>
         </sec>
         <sec>
            <st>
               <p>Nomenclature</p>
            </st>
            <p>As the gene names used in the annotation of the <it>S. typhimurium </it>genome sequence do not always match the 'common' names used in the PmrAB literature, we give a summary of the synonyms below. <it>STM1269 </it>(<it>aroQ</it>); <it>ybjG </it>(<it>mig-13</it>); <it>pmrAB </it>(<it>basSR</it>); <it>ugd </it>(<it>udg</it>, <it>pagA</it>, <it>pmrE</it>); <it>pmrHFIJKLM </it>(<it>yfbE</it>, <it>pmrF</it>, <it>yfbG</it>, <it>STM2300</it>, <it>pqa</it>, <it>STM2302</it>, <it>STM2303</it>); <it>pmrC </it>(<it>yjdB</it>); <it>pmrG </it>(<it>ais</it>); <it>pbgP </it>(<it>yfbE</it>,<it>pmrH</it>).</p>
         </sec>
         <sec>
            <st>
               <p>Availability of data</p>
            </st>
            <p>All additional information of our analysis is available on our supplementary website <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>.</p>
         </sec>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work is partially supported by Instituut voor de aanmoediging van Innovatie door Wetenschap en Technologie in Vlaanderen (IWT) projects STWW-00162, STWW-Genprom, GBOU-SQUAD-20160; Research Council KULeuven GOA Mefisto-666, IDO genetic networks; and FWO: Fund for Scientific Research-Flanders (Belgium) projects G.0115.01 and G.0413.03; IUAP V-22 (2002-2006). K.M. is a postdoctoral researcher of the FWO: Fund for Scientific Research-Flanders (Belgium). We thank John Gunn and Stanley Falkow and their respective co-workers for the kind gift of the strains and four anonymous reviewers for valuable comments on the manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1" rating="0">
            <title>
               <p>Closing the loop: the PmrA/PmrB two-component system negatively controls expression of its posttranscriptional activator PmrD.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kato</snm>
                  <fnm>A</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Latifi</snm>
                  <fnm>T</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2003</pubdate>
            <volume>100</volume>
            <fpage>4706</fpage>
            <lpage>4711</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1073/pnas.0836837100</pubid>
                  <pubid idtype="pmpid" link="fulltext">12676988</pubid>
                  <pubid idtype="pmcid" link="fulltext">153620</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2" rating="0">
            <title>
               <p>Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of <it>Salmonella enterica </it>serovar <it>typhimurium</it>.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gunn</snm>
                  <fnm>JS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ryan</snm>
                  <fnm>SS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Van Velkinburgh</snm>
                  <fnm>JC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ernst</snm>
                  <fnm>RK</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2000</pubdate>
            <volume>68</volume>
            <fpage>6139</fpage>
            <lpage>6146</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/IAI.68.11.6139-6146.2000</pubid>
                  <pubid idtype="pmpid" link="fulltext">11035717</pubid>
                  <pubid idtype="pmcid" link="fulltext">97691</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3" rating="0">
            <title>
               <p>Identification of genes affecting <it>Salmonella enterica </it>serovar <it>enteritidis </it>infection of chicken macrophages.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Zhao</snm>
                  <fnm>Y</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Jansen</snm>
                  <fnm>R</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gaastra</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Arkesteijn</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>van der Zeijst</snm>
                  <fnm>BA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>van Putten</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <fpage>5319</fpage>
            <lpage>5321</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/IAI.70.9.5319-5321.2002</pubid>
                  <pubid idtype="pmpid" link="fulltext">12183592</pubid>
                  <pubid idtype="pmcid" link="fulltext">128292</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4" rating="0">
            <title>
               <p>A signal transduction system that responds to extracellular iron.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Wosten</snm>
                  <fnm>MM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kox</snm>
                  <fnm>LF</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Chamnongpol</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Soncini</snm>
                  <fnm>FC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2000</pubdate>
            <volume>103</volume>
            <fpage>113</fpage>
            <lpage>125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)00092-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">11051552</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5" rating="0">
            <title>
               <p>Mg<sup>2+ </sup>as an extracellular signal: environmental regulation of <it>Salmonella </it>virulence.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Garcia Vescovi</snm>
                  <fnm>E</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Soncini</snm>
                  <fnm>FC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1996</pubdate>
            <volume>84</volume>
            <fpage>165</fpage>
            <lpage>174</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">8548821</pubid>
                  <pubid idtype="doi">10.1016/S0092-8674(00)81003-X</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6" rating="0">
            <title>
               <p>Two-component regulatory systems can interact to process multiple environmental signals.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Soncini</snm>
                  <fnm>FC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1996</pubdate>
            <volume>178</volume>
            <fpage>6796</fpage>
            <lpage>6801</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid" link="fulltext">178578</pubid>
                  <pubid idtype="pmpid" link="fulltext">8955299</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7" rating="0">
            <title>
               <p>Molecular basis of the magnesium deprivation response in <it>Salmonella typhimurium</it>: identification of PhoP-regulated genes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Soncini</snm>
                  <fnm>FC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Garcia Vescovi</snm>
                  <fnm>E</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Solomon</snm>
                  <fnm>F</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1996</pubdate>
            <volume>178</volume>
            <fpage>5092</fpage>
            <lpage>5099</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid" link="fulltext">178303</pubid>
                  <pubid idtype="pmpid" link="fulltext">8752324</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8" rating="0">
            <title>
               <p>The pleiotropic two-component regulatory system PhoP-PhoQ.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2001</pubdate>
            <volume>183</volume>
            <fpage>1835</fpage>
            <lpage>1842</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/JB.183.6.1835-1842.2001</pubid>
                  <pubid idtype="pmpid" link="fulltext">11222580</pubid>
                  <pubid idtype="pmcid" link="fulltext">95077</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9" rating="0">
            <title>
               <p>A small protein that mediates the activation of a two-component system by another two-component system.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kox</snm>
                  <fnm>LF</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Wosten</snm>
                  <fnm>MM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>1861</fpage>
            <lpage>1872</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/emboj/19.8.1861</pubid>
                  <pubid idtype="pmpid" link="fulltext">10775270</pubid>
                  <pubid idtype="pmcid">302009</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10" rating="0">
            <title>
               <p><it>mig-14 </it>is a <it>Salmonella </it>gene that plays a role in bacterial resistance to antimicrobial peptides.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Brodsky</snm>
                  <fnm>IE</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ernst</snm>
                  <fnm>RK</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Falkow</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <fpage>3203</fpage>
            <lpage>3213</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/JB.184.12.3203-3213.2002</pubid>
                  <pubid idtype="pmpid" link="fulltext">12029036</pubid>
                  <pubid idtype="pmcid" link="fulltext">135090</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11" rating="0">
            <title>
               <p>Spontaneous <it>pmrA </it>mutants of <it>Salmonella typhimurium </it>LT2 define a new two-component regulatory system with a possible role in virulence.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Roland</snm>
                  <fnm>KL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Martin</snm>
                  <fnm>LE</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Esther</snm>
                  <fnm>CR</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Spitznagel</snm>
                  <fnm>JK</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1993</pubdate>
            <volume>175</volume>
            <fpage>4154</fpage>
            <lpage>4164</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid" link="fulltext">204845</pubid>
                  <pubid idtype="pmpid" link="fulltext">8391535</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12" rating="0">
            <title>
               <p>Control of the <it>Salmonella ugd </it>gene by three two-component regulatory systems.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mouslim</snm>
                  <fnm>C</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>47</volume>
            <fpage>335</fpage>
            <lpage>344</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.2003.03318.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12519186</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13" rating="0">
            <title>
               <p>Fe(III)-mediated cellular toxicity.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Chamnongpol</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dodson</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Cromie</snm>
                  <fnm>MJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Harris</snm>
                  <fnm>ZL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>45</volume>
            <fpage>711</fpage>
            <lpage>719</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.2002.03041.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12139617</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14" rating="0">
            <title>
               <p>Molecular characterization of the PmrA regulon.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Wosten</snm>
                  <fnm>MM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Groisman</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1999</pubdate>
            <volume>274</volume>
            <fpage>27185</fpage>
            <lpage>27190</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1074/jbc.274.38.27185</pubid>
                  <pubid idtype="pmpid" link="fulltext">10480935</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15" rating="0">
            <title>
               <p>Phosphorylated PmrA interacts with the promoter region of <it>ugd </it>in <it>Salmonella enterica </it>serovar <it>typhimurium</it>.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Aguirre</snm>
                  <fnm>A</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lejona</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Vescovi</snm>
                  <fnm>EG</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Soncini</snm>
                  <fnm>FC</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2000</pubdate>
            <volume>182</volume>
            <fpage>3874</fpage>
            <lpage>3876</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/JB.182.13.3874-3876.2000</pubid>
                  <pubid idtype="pmpid" link="fulltext">10851011</pubid>
                  <pubid idtype="pmcid" link="fulltext">94567</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16" rating="0">
            <title>
               <p>Lipid A modifications in polymyxin-resistant <it>Salmonella typhimurium</it>: PmrA-dependent 4-amino-4-deoxy-L-arabinose, and phosphoethanolamine incorporation.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Zhou</snm>
                  <fnm>Z</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ribeiro</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Cotter</snm>
                  <fnm>RJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Raetz</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2001</pubdate>
            <volume>276</volume>
            <fpage>43111</fpage>
            <lpage>43121</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1074/jbc.M106960200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11535603</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17" rating="0">
            <title>
               <p>PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gunn</snm>
                  <fnm>JS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lim</snm>
                  <fnm>KB</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Krueger</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kim</snm>
                  <fnm>K</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Guo</snm>
                  <fnm>L</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hackett</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>27</volume>
            <fpage>1171</fpage>
            <lpage>1182</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.1998.00757.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9570402</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18" rating="0">
            <title>
               <p>Oxidative decarboxylation of UDP-glucuronic acid in extracts of polymyxin-resistant <it>Escherichia coli</it>. Origin of lipid A species modified with 4-amino-4-deoxy-L-arabinose.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Breazeale</snm>
                  <fnm>SD</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ribeiro</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Raetz</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2002</pubdate>
            <volume>277</volume>
            <fpage>2886</fpage>
            <lpage>2896</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1074/jbc.M109377200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11706007</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19" rating="0">
            <title>
               <p>An inner membrane enzyme in <it>Salmonella and Escherichia coli </it>that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Trent</snm>
                  <fnm>MS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ribeiro</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Cotter</snm>
                  <fnm>RJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Raetz</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2001</pubdate>
            <volume>276</volume>
            <fpage>43122</fpage>
            <lpage>43131</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1074/jbc.M106961200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11535604</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20" rating="0">
            <title>
               <p>Accumulation of a polyisoprene-linked amino sugar in polymyxin-resistant <it>Salmonella typhimurium </it>and <it>Escherichia coli</it>: structural characterization and transfer to lipid A in the periplasm.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Trent</snm>
                  <fnm>MS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ribeiro</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Doerrler</snm>
                  <fnm>WT</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Cotter</snm>
                  <fnm>RJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Raetz</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2001</pubdate>
            <volume>276</volume>
            <fpage>43132</fpage>
            <lpage>43144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1074/jbc.M106962200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11535605</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21" rating="0">
            <title>
               <p>PhoP-PhoQ activates transcription of <it>pmrAB</it>, encoding a two-component regulatory system involved in <it>Salmonella typhimurium </it>antimicrobial peptide resistance.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gunn</snm>
                  <fnm>JS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1996</pubdate>
            <volume>178</volume>
            <fpage>6857</fpage>
            <lpage>6864</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid" link="fulltext">178586</pubid>
                  <pubid idtype="pmpid" link="fulltext">8955307</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22" rating="0">
            <title>
               <p>Identification and genetic characterization of PmrA-regulated genes and genes involved in polymyxin B resistance in <it>Salmonella enterica </it>serovar Typhimurium.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Tamayo</snm>
                  <fnm>R</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ryan</snm>
                  <fnm>SS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>McCoy</snm>
                  <fnm>AJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gunn</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <fpage>6770</fpage>
            <lpage>6778</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/IAI.70.12.6770-6778.2002</pubid>
                  <pubid idtype="pmpid" link="fulltext">12438352</pubid>
                  <pubid idtype="pmcid" link="fulltext">133008</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23" rating="0">
            <title>
               <p>Methods for calculating the probabilities of finding patterns in sequences.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Staden</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Comput Appl Biosci</source>
            <pubdate>1989</pubdate>
            <volume>5</volume>
            <fpage>89</fpage>
            <lpage>96</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">2720468</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24" rating="0">
            <title>
               <p>A web site for the computational analysis of yeast regulatory sequences.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>van Helden</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Andre</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Collado-Vides</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Yeast</source>
            <pubdate>2000</pubdate>
            <volume>16</volume>
            <fpage>177</fpage>
            <lpage>187</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1002/(SICI)1097-0061(20000130)16:2&lt;177::AID-YEA516>3.0.CO;2-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">10641039</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25" rating="0">
            <title>
               <p>Identifying DNA and protein patterns with statistically significant alignments of multiple sequences.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hertz</snm>
                  <fnm>GZ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Stormo</snm>
                  <fnm>GD</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <fpage>563</fpage>
            <lpage>577</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/bioinformatics/15.7.563</pubid>
                  <pubid idtype="pmpid" link="fulltext">10487864</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26" rating="0">
            <title>
               <p>Comparative analysis of FUR regulons in gamma-proteobacteria.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Panina</snm>
                  <fnm>EM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mironov</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gelfand</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2001</pubdate>
            <volume>29</volume>
            <fpage>5195</fpage>
            <lpage>5206</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/29.24.5195</pubid>
                  <pubid idtype="pmpid" link="fulltext">11812853</pubid>
                  <pubid idtype="pmcid" link="fulltext">97565</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27" rating="0">
            <title>
               <p>Toucan: deciphering the <it>cis</it>-regulatory logic of coregulated genes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Aerts</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Coessens</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Staes</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Moreau</snm>
                  <fnm>Y</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2003</pubdate>
            <volume>31</volume>
            <fpage>1753</fpage>
            <lpage>1764</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/gkg268</pubid>
                  <pubid idtype="pmpid" link="fulltext">12626717</pubid>
                  <pubid idtype="pmcid" link="fulltext">152870</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28" rating="0">
            <title>
               <p>Prediction of transcription regulatory sites in Archaea by a comparative genomic approach.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gelfand</snm>
                  <fnm>MS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mironov</snm>
                  <fnm>AA</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2000</pubdate>
            <volume>28</volume>
            <fpage>695</fpage>
            <lpage>705</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/28.3.695</pubid>
                  <pubid idtype="pmpid" link="fulltext">10637320</pubid>
                  <pubid idtype="pmcid" link="fulltext">102549</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29" rating="0">
            <title>
               <p>Computational analysis of the transcriptional regulation of pentose utilization systems in the gamma subdivision of Proteobacteria.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Laikova</snm>
                  <fnm>ON</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mironov</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gelfand</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>2001</pubdate>
            <volume>205</volume>
            <fpage>315</fpage>
            <lpage>322</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1016/S0378-1097(01)00495-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">11750821</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30" rating="0">
            <title>
               <p>Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rodionov</snm>
                  <fnm>DA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gelfand</snm>
                  <fnm>MS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mironov</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rakhmaninova</snm>
                  <fnm>AB</fnm>
               </au>
            </aug>
            <source>J Mol Microbiol Biotechnol</source>
            <pubdate>2001</pubdate>
            <volume>3</volume>
            <fpage>319</fpage>
            <lpage>324</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11321589</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31" rating="0">
            <title>
               <p>A comparative genomics approach to prediction of new members of regulons.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Tan</snm>
                  <fnm>K</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Moreno-Hagelsieb</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Collado-Vides</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Stormo</snm>
                  <fnm>GD</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <fpage>566</fpage>
            <lpage>584</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1101/gr.149301</pubid>
                  <pubid idtype="pmpid" link="fulltext">11282972</pubid>
                  <pubid idtype="pmcid">311042</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32" rating="0">
            <title>
               <p>Prediction and overview of the RpoN-regulon in closely related species of the Rhizobiales.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dombrecht</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Vanderleyden</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Michiels</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <fpage>research0076.1</fpage>
            <lpage>0076.11</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1186/gb-2002-3-12-research0076</pubid>
                  <pubid idtype="pmpid" link="fulltext">12537565</pubid>
                  <pubid idtype="pmcid" link="fulltext">151178</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33" rating="0">
            <title>
               <p>Phylogenetic footprinting of transcription factor binding sites in proteobacterial genomes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>McCue</snm>
                  <fnm>L</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thompson</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Carmack</snm>
                  <fnm>C</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ryan</snm>
                  <fnm>MP</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Liu</snm>
                  <fnm>JS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Derbyshire</snm>
                  <fnm>V</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lawrence</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2001</pubdate>
            <volume>29</volume>
            <fpage>774</fpage>
            <lpage>782</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/29.3.774</pubid>
                  <pubid idtype="pmpid" link="fulltext">11160901</pubid>
                  <pubid idtype="pmcid" link="fulltext">30389</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34" rating="0">
            <title>
               <p>Factors influencing the identification of transcription factor binding sites by cross-species comparison.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>McCue</snm>
                  <fnm>LA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thompson</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Carmack</snm>
                  <fnm>CS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lawrence</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2002</pubdate>
            <volume>12</volume>
            <fpage>1523</fpage>
            <lpage>1532</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1101/gr.323602</pubid>
                  <pubid idtype="pmpid" link="fulltext">12368244</pubid>
                  <pubid idtype="pmcid" link="fulltext">187528</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35" rating="0">
            <title>
               <p>Cross-species sequence comparisons: a review of methods and available resources.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Frazer</snm>
                  <fnm>KA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Elnitski</snm>
                  <fnm>L</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Church</snm>
                  <fnm>DM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dubchak</snm>
                  <fnm>I</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hardison</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2003</pubdate>
            <volume>13</volume>
            <fpage>1</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1101/gr.222003</pubid>
                  <pubid idtype="pmpid" link="fulltext">12529301</pubid>
                  <pubid idtype="pmcid">430969</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36" rating="0">
            <title>
               <p>Recognition of regulatory sites by genomic comparison.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gelfand</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Res Microbiol</source>
            <pubdate>1999</pubdate>
            <volume>150</volume>
            <fpage>755</fpage>
            <lpage>771</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1016/S0923-2508(99)00117-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">10673013</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37" rating="0">
            <title>
               <p>Conservation of DNA regulatory motifs and discovery of new motifs in microbial genomes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>McGuire</snm>
                  <fnm>AM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hughes</snm>
                  <fnm>JD</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Church</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2000</pubdate>
            <volume>10</volume>
            <fpage>744</fpage>
            <lpage>757</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1101/gr.10.6.744</pubid>
                  <pubid idtype="pmpid" link="fulltext">10854408</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38" rating="0">
            <title>
               <p>Complete genome sequence of <it>Salmonella enterica </it>serovar <it>Typhimurium </it>LT2.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>McClelland</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Sanderson</snm>
                  <fnm>KE</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Spieth</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Clifton</snm>
                  <fnm>SW</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Latreille</snm>
                  <fnm>P</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Courtney</snm>
                  <fnm>L</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Porwollik</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ali</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dante</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Du</snm>
                  <fnm>F</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>2001</pubdate>
            <volume>413</volume>
            <fpage>852</fpage>
            <lpage>856</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1038/35101614</pubid>
                  <pubid idtype="pmpid" link="fulltext">11677609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39" rating="0">
            <title>
               <p>Supplementary information</p>
            </title>
            <url>http://www.esat.kuleuven.ac.be/~kmarchal/Supplementary_Information_GenBiol_2004/PmrAwebsite.html</url>
         </bibl>
         <bibl id="B40" rating="0">
            <title>
               <p>Fluorescence-based isolation of bacterial genes expressed within host cells.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Valdivia</snm>
                  <fnm>RH</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Falkow</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1997</pubdate>
            <volume>277</volume>
            <fpage>2007</fpage>
            <lpage>2011</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1126/science.277.5334.2007</pubid>
                  <pubid idtype="pmpid" link="fulltext">9302299</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41" rating="0">
            <title>
               <p>The evolution of DNA regulatory regions for proteo-gamma bacteria by interspecies comparisons.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rajewsky</snm>
                  <fnm>N</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Socci</snm>
                  <fnm>ND</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Zapotocky</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Siggia</snm>
                  <fnm>ED</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2002</pubdate>
            <volume>12</volume>
            <fpage>298</fpage>
            <lpage>308</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1101/gr.207502. Article published online before print in January 2002</pubid>
                  <pubid idtype="pmpid" link="fulltext">11827949</pubid>
                  <pubid idtype="pmcid" link="fulltext">155268</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42" rating="0">
            <title>
               <p>Structural characterization of lipo-oligosaccharide (LOS) from <it>Yersinia pestis</it>: regulation of LOS structure by the PhoPQ system.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hitchen</snm>
                  <fnm>PG</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Prior</snm>
                  <fnm>JL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Oyston</snm>
                  <fnm>PC</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Panico</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Wren</snm>
                  <fnm>BW</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Titball</snm>
                  <fnm>RW</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Morris</snm>
                  <fnm>HR</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dell</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>44</volume>
            <fpage>1637</fpage>
            <lpage>1650</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.2002.02990.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12067350</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43" rating="0">
            <title>
               <p><it>virK</it>, <it>somA </it>and <it>rcsC </it>are important for systemic <it>Salmonella enterica </it>serovar <it>Typhimurium</it> infection and cationic peptide resistance.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Detweiler</snm>
                  <fnm>CS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Monack</snm>
                  <fnm>DM</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Brodsky</snm>
                  <fnm>IE</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mathew</snm>
                  <fnm>H</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Falkow</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>48</volume>
            <fpage>385</fpage>
            <lpage>400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.2003.03455.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12675799</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44" rating="0">
            <title>
               <p>Swarm-cell differentiation in <it>Salmonella enterica s</it>erovar <it>Typhimurium </it>results in elevated resistance to multiple antibiotics.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kim</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Killam</snm>
                  <fnm>T</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Sood</snm>
                  <fnm>V</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Surette</snm>
                  <fnm>MG</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2003</pubdate>
            <volume>185</volume>
            <fpage>3111</fpage>
            <lpage>3117</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/JB.185.10.3111-3117.2003</pubid>
                  <pubid idtype="pmpid" link="fulltext">12730171</pubid>
                  <pubid idtype="pmcid" link="fulltext">154059</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45" rating="0">
            <title>
               <p>A metabolic node in action: chorismate-utilizing enzymes in microorganisms.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Dosselaere</snm>
                  <fnm>F</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Vanderleyden</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Crit Rev Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>27</volume>
            <fpage>75</fpage>
            <lpage>131</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/20014091096710</pubid>
                  <pubid idtype="pmpid" link="fulltext">11450855</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46" rating="0">
            <title>
               <p>The emerging periplasm-localized subclass of AroQ chorismate mutases, exemplified by those from <it>Salmonella typhimurium </it>and <it>Pseudomonas aeruginosa</it>.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Calhoun</snm>
                  <fnm>DH</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Bonner</snm>
                  <fnm>CA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gu</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Xie</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Jensen</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <fpage>research0030.1</fpage>
            <lpage>0030.16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1186/gb-2001-2-8-research0030</pubid>
                  <pubid idtype="pmpid" link="fulltext">11532214</pubid>
                  <pubid idtype="pmcid" link="fulltext">55327</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47" rating="0">
            <title>
               <p>Complementary activities of SseJ and SifA regulate dynamics of the <it>Salmonella typhimurium </it>vacuolar membrane.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ruiz-Albert</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Yu</snm>
                  <fnm>XJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Beuzon</snm>
                  <fnm>CR</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Blakey</snm>
                  <fnm>AN</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Galyov</snm>
                  <fnm>EE</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Holden</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>44</volume>
            <fpage>645</fpage>
            <lpage>661</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1046/j.1365-2958.2002.02912.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11994148</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48" rating="0">
            <title>
               <p>The <it>Salmonella enterica </it>serovar <it>typhimurium </it>translocated effectors SseJ and SifB are targeted to the <it>Salmonella</it>-containing vacuole.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Freeman</snm>
                  <fnm>JA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ohl</snm>
                  <fnm>ME</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>SI</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2003</pubdate>
            <volume>71</volume>
            <fpage>418</fpage>
            <lpage>427</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1128/IAI.71.1.418-427.2003</pubid>
                  <pubid idtype="pmpid" link="fulltext">12496192</pubid>
                  <pubid idtype="pmcid" link="fulltext">143161</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49" rating="0">
            <title>
               <p>Network motifs in the transcriptional regulation network of <it>Escherichia coli.</it></p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Shen-Orr</snm>
                  <fnm>SS</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Milo</snm>
                  <fnm>R</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mangan</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Alon</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2002</pubdate>
            <volume>31</volume>
            <fpage>64</fpage>
            <lpage>68</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1038/ng881</pubid>
                  <pubid idtype="pmpid" link="fulltext">11967538</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50" rating="0">
            <title>
               <p>GenBank</p>
            </title>
            <url>http://www.ncbi.nih.gov/genomes/MICROBES/Complete.html</url>
         </bibl>
         <bibl id="B51" rating="0">
            <title>
               <p>INCLUSive: INtegrated Clustering, Upstream sequence retrieval and motif Sampling.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Moreau</snm>
                  <fnm>Y</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Smet</snm>
                  <fnm>F</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Mathys</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lescot</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rombauts</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rouze</snm>
                  <fnm>P</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>331</fpage>
            <lpage>332</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/bioinformatics/18.2.331</pubid>
                  <pubid idtype="pmpid" link="fulltext">11847086</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52" rating="0">
            <title>
               <p>GenBank.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Benson</snm>
                  <fnm>DA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Karsch-Mizrachi</snm>
                  <fnm>I</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ostell</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rapp</snm>
                  <fnm>BA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Wheeler</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <fpage>17</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/30.1.17</pubid>
                  <pubid idtype="pmpid" link="fulltext">11752243</pubid>
                  <pubid idtype="pmcid" link="fulltext">99127</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53" rating="0">
            <title>
               <p>A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lescot</snm>
                  <fnm>M</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rombauts</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Rouze</snm>
                  <fnm>P</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Moreau</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Comput Biol</source>
            <pubdate>2002</pubdate>
            <volume>9</volume>
            <fpage>447</fpage>
            <lpage>464</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1089/10665270252935566</pubid>
                  <pubid idtype="pmpid" link="fulltext">12015892</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54" rating="0">
            <title>
               <p>BioI@Sista Software: MotifLocator</p>
            </title>
            <url>http://www.esat.kuleuven.ac.be/~dna/BioI/Software.html</url>
         </bibl>
         <bibl id="B55" rating="0">
            <title>
               <p>Probabilistic methods to search for regulatory elements in sets of coregulated genes.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>PhD thesis</source>
            <publisher>Katholieke Universiteit Leuven, Faculty of Applied Sciences</publisher>
            <pubdate>2003</pubdate>
         </bibl>
         <bibl id="B56" rating="0">
            <title>
               <p>Information content of binding sites on nucleotide sequences.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Schneider</snm>
                  <fnm>T</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Stormo</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Gold</snm>
                  <fnm>L</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ehrenfeucht</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1986</pubdate>
            <volume>188</volume>
            <fpage>415</fpage>
            <lpage>431</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0022-2836(86)90165-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">3525846</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57" rating="0">
            <title>
               <p>Genome-specific higher-order background models to improve motif detection.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Marchal</snm>
                  <fnm>K</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Thijs</snm>
                  <fnm>G</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Keersmaecker</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Monsieurs</snm>
                  <fnm>P</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>De Moor</snm>
                  <fnm>B</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Vanderleyden</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Trends Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>11</volume>
            <fpage>61</fpage>
            <lpage>66</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1016/S0966-842X(02)00030-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">12598125</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58" rating="0">
            <title>
               <p>The COG database: a tool for genome-scale analysis of protein functions and evolution.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Tatusov</snm>
                  <fnm>RL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Galperin</snm>
                  <fnm>MY</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Natale</snm>
                  <fnm>DA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2000</pubdate>
            <volume>28</volume>
            <fpage>33</fpage>
            <lpage>36</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/28.1.33</pubid>
                  <pubid idtype="pmpid" link="fulltext">10592175</pubid>
                  <pubid idtype="pmcid" link="fulltext">102395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59" rating="0">
            <title>
               <p>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Madden</snm>
                  <fnm>TL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Schaffer</snm>
                  <fnm>AA</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Zhang</snm>
                  <fnm>J</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Zhang</snm>
                  <fnm>Z</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>W</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <fpage>3389</fpage>
            <lpage>3402</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/25.17.3389</pubid>
                  <pubid idtype="pmpid" link="fulltext">9254694</pubid>
                  <pubid idtype="pmcid" link="fulltext">146917</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60" rating="0">
            <title>
               <p>An efficient algorithm for large-scale detection of protein families.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Enright</snm>
                  <fnm>AJ</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Van Dongen</snm>
                  <fnm>S</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ouzounis</snm>
                  <fnm>CA</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <fpage>1575</fpage>
            <lpage>1584</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi" link="fulltext">10.1093/nar/30.7.1575</pubid>
                  <pubid idtype="pmpid" link="fulltext">11917018</pubid>
                  <pubid idtype="pmcid" link="fulltext">101833</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61" rating="0">
            <title>
               <p>Development of a heuristic for the selection of alignment seeds from a list of motifs generated by Gibbs sampling</p>
            </title>
            <url>ftp://www.esat.kuleuven.ac.be/pub/sista/marchal/Supplementary_information_GenBiol_2004/website/reports/heuristic.pdf</url>
         </bibl>
         <bibl id="B62" rating="0">
            <title>
               <p>Methodology to identify conserved sequence blocks in an alignment of intergenic sequences</p>
            </title>
            <url>ftp://www.esat.kuleuven.ac.be/pub/sista/marchal/Supplementary_information_GenBiol_2004/website/reports/Validation_Alignments_221003.pdf</url>
         </bibl>
         <bibl id="B63" rating="0">
            <title>
               <p>BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Hall</snm>
                  <fnm>TA</fnm>
               </au>
            </aug>
            <source>Nuceicl Acids Symp</source>
            <pubdate>1999</pubdate>
            <volume>41</volume>
            <fpage>95</fpage>
            <lpage>98</lpage>
         </bibl>
         <bibl id="B64" rating="0">
            <title>
               <p>The Sanger Institute</p>
            </title>
            <url>http://www.sanger.ac.uk/Info/Intro</url>
         </bibl>
         <bibl id="B65" rating="0">
            <title>
               <p>Magnesium transport in <it>Escherichia coli. </it>Inhibition by cobaltous ion.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Nelson</snm>
                  <fnm>DL</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Kennedy</snm>
                  <fnm>EP</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1971</pubdate>
            <volume>246</volume>
            <fpage>3042</fpage>
            <lpage>3049</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">4928897</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B66" rating="0">
            <title>
               <p>The <it>mgtB </it>Mg<sup>2+ </sup>transport locus of <it>Salmonella typhimurium </it>encodes a P-type ATPase.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Snavely</snm>
                  <fnm>MD</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Miller</snm>
                  <fnm>CG</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Maguire</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1991</pubdate>
            <volume>266</volume>
            <fpage>815</fpage>
            <lpage>823</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1824701</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B67" rating="0">
            <title>
               <p><it>Salmonella typhimurium </it>LT2 strains which are r- m+ for all three chromosomally located systems of DNA restriction and modification.</p>
            </title>
            <aug>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Bullas</snm>
                  <fnm>LR</fnm>
               </au>
               <au ca="no" ce="no" pa="no" da="no">
                  <snm>Ryu</snm>
                  <fnm>JI</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1983</pubdate>
            <volume>156</volume>
            <fpage>471</fpage>
            <lpage>474</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid" link="fulltext">215113</pubid>
                  <pubid idtype="pmpid" link="fulltext">6352690</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
