<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2003-4-7-r42</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Computational identification of <it>Drosophila </it>microRNA genes</p>
         </title>
         <aug>
            <au id="A1" ce="yes" ca="yes">
               <snm>Lai</snm>
               <mi>C</mi>
               <fnm>Eric</fnm>
               <insr iid="I1"/>
               <email>lai@fruitfly.org</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Tomancak</snm>
               <fnm>Pavel</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A3">
               <snm>Williams</snm>
               <mi>W</mi>
               <fnm>Robert</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A4">
               <snm>Rubin</snm>
               <mi>M</mi>
               <fnm>Gerald</fnm>
               <insr iid="I1"/>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California at Berkeley, 539 Life Sciences Addition, Berkeley, CA 94720, USA</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2003</pubdate>
         <volume>4</volume>
         <issue>7</issue>
         <fpage>R42</fpage>
         <url>http://genomebiology.com/2003/4/7/R42</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/gb-2003-4-7-r42</pubid>
               <pubid idtype="pmpid">12844358</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>8</day>
               <month>4</month>
               <year>2003</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>16</day>
               <month>5</month>
               <year>2003</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>30</day>
               <month>5</month>
               <year>2003</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>30</day>
               <month>6</month>
               <year>2003</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2003</year>
         <collab>Lai et al.; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <shorttitle>
         <p>Computational identification of <it>Drosophila </it>microRNA genes</p>
      </shorttitle>
      <shortabs>
         <p>An informatic procedure has been used to analyze the euchromatic sequences of <it>Drosophila melanogaster </it>and <it>D. pseudoobscura </it>for conserved sequences that adopt an extended stem-loop structure and display other characteristics of known miRNAs.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>MicroRNAs (miRNAs) are a large family of 21-22 nucleotide non-coding RNAs with presumed post-transcriptional regulatory activity. Most miRNAs were identified by direct cloning of small RNAs, an approach that favors detection of abundant miRNAs. Three observations suggested that miRNA genes might be identified using a computational approach. First, miRNAs generally derive from precursor transcripts of 70-100 nucleotides with extended stem-loop structure. Second, miRNAs are usually highly conserved between the genomes of related species. Third, miRNAs display a characteristic pattern of evolutionary divergence.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We developed an informatic procedure called 'miRseeker', which analyzed the completed euchromatic sequences of <it>Drosophila melanogaster </it>and <it>D. pseudoobscura </it>for conserved sequences that adopt an extended stem-loop structure and display a pattern of nucleotide divergence characteristic of known miRNAs. The sensitivity of this computational procedure was demonstrated by the presence of 75% (18/24) of previously identified <it>Drosophila </it>miRNAs within the top 124 candidates. In total, we identified 48 novel miRNA candidates that were strongly conserved in more distant insect, nematode, or vertebrate genomes. We verified expression for a total of 24 novel miRNA genes, including 20 of 27 candidates conserved in a third species and 4 of 11 high-scoring, <it>Drosophila</it>-specific candidates. Our analyses lead us to estimate that drosophilid genomes contain around 110 miRNA genes.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>Our computational strategy succeeded in identifying <it>bona fide </it>miRNA genes and suggests that miRNAs constitute nearly 1% of predicted protein-coding genes in <it>Drosophila</it>, a percentage similar to the percentage of miRNAs recently attributed to other metazoan genomes.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010010">Genome studies</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010002">Bioinformatics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010015">Model organisms</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010016">Molecular biology</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010013">Methods</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Although the analysis of sequenced genomes to date has focused most heavily on the protein-coding set of genes, all genomes also contain a constellation of non-coding RNA genes. With the exception of certain classes of RNAs with strongly conserved sequences and/or structures, such as ribosomal and transfer RNAs, identification of most non-coding RNAs has historically been a relatively serendipitous affair. Only very recently have there been concerted efforts to identify such genes systematically, using both experimental and computational approaches <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
         <p>Our collective ignorance of the totality of non-coding RNA genes was laid bare by recent work on microRNAs (miRNAs), an abundant family of 21-22 nucleotide non-coding RNAs <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. The founding members of this family, lin-4 and let-7, were identified through forward analysis of extant <it>Caenorhabditis elegans </it>mutants <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Both of these RNAs are post-transcriptional regulators of developmental timing that function by binding to the 3' untranslated regions (3' UTRs) of target genes <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. Although they were long regarded as genetic curiosities possibly specific to nematodes, let-7 was subsequently found to be broadly conserved across bilaterian evolution <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> and miRNA genes are now recognized as a pervasive and widespread feature of animal and plant genomes <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>In general, it is thought that miRNA biogenesis proceeds via intermediate precursor transcripts of more than 70 nucleotides that have the capacity to form an extended stem-loop structure (pre-miRNA), although at least some pre-miRNAs are further derived from even longer transcripts (primary miRNA transcripts, or pri-miRNAs). These can exist as long individual pre-miRNA precursor transcripts, as operon-like multiple pre-miRNA precursors, or even as part of primary mRNA transcripts. Processing of pri-miRNA into the pre-miRNA stem-loop occurs in the nucleus, while subsequent processing of pre-miRNA into 21-22 mers is a cytoplasmic event mediated by the RNAse III enzyme Dicer <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>; Dicer is also responsible for cleavage of long perfectly double-stranded RNA into 21-22 nucleotide fragments during RNA interference (RNAi) <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B21">21</abbr></abbrgrp>. These latter molecules, known as silencing RNA (siRNA), bind to and trigger the degradation of perfectly homologous mRNA molecules via RISC, a double-strand RNA-induced silencing complex containing nuclease activity <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>.</p>
         <p>Although the <it>in vivo </it>function of only a few miRNAs is known so far, it is believed that the vast majority are likely to participate in post-transcriptional gene regulation of complementary mRNA targets. Interestingly, perfect or near-perfect target complementarity is associated with mRNA degradation <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>, similar to the effects of siRNA, whereas imperfect base-pairing is associated with regulation by translational inhibition <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B27">27</abbr></abbrgrp>. Recently, siRNAs with imperfect match to target mRNA were observed to function as translational inhibitors <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, suggesting that the type of 21-22 nucleotide RNA-mediated regulation may be largely determined by the quality of target complementarity.</p>
         <p>The vast majority of the approximately 300 miRNAs currently known were identified through direct cloning of short RNA molecules. Although this method has been quite successful thus far, its practicality is limited by the necessity for a considerable amount of RNA as raw material for cloning, and cloned products are often dominated by a few highly expressed miRNAs. For example, 41% of miRNAs cloned from HeLa cells are variants of let-7, 28% of human brain miRNAs are variants of miR-124, and 45% of miRNAs cloned from human heart and 32% of those cloned from early <it>Drosophila </it>embryos are miR-1 <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B29">29</abbr></abbrgrp>. In fact, it has been opined that few additional mammalian miRNAs will be easily identified by the direct cloning method <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>.</p>
         <p>As a complementary approach to miRNA identification, we developed an informatic strategy ('miRseeker') and applied it to the completed genomes of <it>Drosophila melanogaster </it>and <it>D. pseudoobscura</it>, which are some 30 million years diverged. miRseeker subjects conserved intronic and intergenic sequences to an RNA folding and evaluation procedure to identify evolutionarily constrained hairpin structures with features characteristic of known miRNAs. The specificity of this computational procedure was shown by the presence of 18 out of 24 reference miRNAs within the top 124 candidates. We identified a total of 48 novel miRNA candidates whose existence was strongly supported by conservation in other insect, nematode or vertebrate genomes. Expression of 24 novel miRNA genes was verified by northern analysis (including 20 out of 27 candidates that were supported by third-species conservation and 4 out of 11 high-scoring predictions specific to <it>Drosophila</it>), demonstrating that the bioinformatic screen was successful. As might be expected, the newly verified miRNA genes vary tremendously with respect to abundance and developmental expression profile, suggesting diverse roles for these genes. Inference of our false-positive prediction and false-negative verification rates (based on our ability to identify known miRNAs and detect the expression of highly conserved, and thus presumed genuine, novel miRNAs) leads us to estimate that drosophilid genomes contain around 110 miRNA genes, or nearly 1% of the number of predicted protein-coding genes. In combination with other concurrent genomic analyses <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>, it is likely that most miRNAs in completed animal genomes have now been identified. Collectively, this sets the stage for both genome-wide and targeted studies of this functionally elusive family of regulators.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Evolutionarily conserved characteristics of miRNA genes</p>
            </st>
            <p>The starting point for our studies was a reference set of 24 <it>Drosophila</it> pre-miRNA sequences (<it>let-7</it>, the 21 originally identified by Lagos-Quintana and colleagues, <it>mir-125</it>, and a previously undescribed paralog of <it>mir-2 </it>that we named <it>mir-2c </it><abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B29">29</abbr></abbrgrp>). We analyzed this set to derive rules and determine parameters that specifically describe known miRNA genes within anonymous genomic sequence.</p>
            <p>Examination of the genomic sequence of <it>D. melanogaster </it>and <it>D. pseudoobscura </it>showed that all 24 members of the reference set are highly conserved along the entirety of the predicted precursor transcripts, which typically range between 70-100 nucleotides. When viewed in VISTA plot alignments <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, miRNA genes reside in short regions of exceptional conservation, easily seen as local 'peaks' (Figure <figr fid="F1">1</figr>). As is the case for many other non-coding RNA genes, their degree of conservation usually exceeds that of coding regions, due to their lack of third-position wobble. This suggested that miRNA genes might be found by folding fixed lengths of conserved sequence to identify ones that display the high degree of relatively continuous helicity characteristic of known pre-miRNAs. However, pilot studies identified a very large number of conserved stem-loops in genomic sequence, suggesting that additional criteria were necessary to make effective miRNA gene predictions.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>miRNA genes are isolated, evolutionarily conserved genomic sequences that have the capacity to form extended stem-loop structures as RNA</p>
               </caption>
               <text>
                  <p>miRNA genes are isolated, evolutionarily conserved genomic sequences that have the capacity to form extended stem-loop structures as RNA. Shown are VISTA plots of globally aligned sequence from <it>D. melanogaster </it>and <it>D. pseudoobscura</it>, in which the degree of conservation is represented by the height of the peak. This particular region contains a conserved sequence identified in this study that adopts a stem-loop structure characteristic of known miRNAs. Expression of this sequence was confirmed by northern analysis (Table <tblr tid="T2">2</tblr>), and it was subsequently determined to be the fly ortholog of mammalian <it>mir-184</it>. Most conserved sequences do not have the ability to form extended stem-loops, as evidenced by the fold adopted by the sequence in the neighboring peak.</p>
               </text>
               <graphic file="gb-2003-4-7-r42-1"/>
            </fig>
            <p>We next aligned the 24 pairs of orthologous <it>Drosophila </it>pre-miRNA sequences and assessed their pattern of nucleotide divergence. There are only three pairs that have been completely conserved (Figure <figr fid="F2">2a</figr>, class 1), indicating that most pre-miRNAs have diverged to some extent within <it>Drosophila</it>. Unexpectedly, we detected mild selective pressure on the precise sequence of the non-miRNA-encoding arm. This attribute is not self-evident. It might have been the case that point mutations along an arm would be neutral as long as the status of base-pairing was maintained; this is possible due to the acceptability of G-U base-pairing in RNA. Instead, we observed preferential divergence within the loop sequence. Ten members of the reference set have diverged exclusively within their loop sequence (Figure <figr fid="F2">2a</figr>, class 2), whereas there are no members that have diverged exclusively along an arm (Figure <figr fid="F2">2a</figr>, class 5). This is well illustrated by the <it>Drosophila </it>let-7 orthologs, which have accumulated four mismatches and gaps in the loop sequence but maintain perfectly conserved arms (Figure <figr fid="F2">2b</figr>). Thus, the terminal loop is the most evolutionary labile portion of pre-miRNA.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Classification of conserved stem-loop sequences</p>
               </caption>
               <text>
                  <p>Classification of conserved stem-loop sequences. <b>(a) </b>Patterns of <it>Drosophila </it>pre-miRNA nucleotide divergence patterns imply a canonical progression in miRNA evolution. The <it>Drosophila </it>orthologs of 23/24 previously described miRNAs are either completely conserved (class 1), contain one or more mismatches or gaps located exclusively in the loop (class 2) or contain an equal or greater number of mutations within the loop compared to the non-miRNA-encoding arm (class 3). We consider these to represent successive steps in the normal evolution of miRNAs and therefore connect them with arrows. Members of classes 1-3 are considered as equally good candidates while members of classes 4-6 are poor candidates. As we expect class 3 candidates to eventually evolve into class 6 candidates (broken arrow), these evolutionary considerations are most relevant to species separated by an evolutionary distance comparable to <it>D. melanogaster </it>and <it>D. pseudoobscura</it>. <b>(b) </b>Preferential divergence of miRNAs within their loop sequences is illustrated by let-7. The <it>Drosophila </it>orthologs of let-7 contain three mismatches and one gap within the loop, whereas both arms have been completely conserved.</p>
               </text>
               <graphic file="gb-2003-4-7-r42-2"/>
            </fig>
            <p>Mutations do eventually accumulate on the non-miRNA-encoding arm, and orthologous pre-miRNAs from more diverged species will often preserve only the 21-24 nucleotide mature miRNA itself. However, because of preferential divergence within the loop, orthologous miRNAs from species of an appropriate evolutionary distance (such as <it>D. melanogaster </it>and <it>D. pseudoobscura</it>) show an equal or greater amount of change within the loop than on the non-miRNA-encoding arm (Figure <figr fid="F2">2a</figr>, class 3). This is the case despite the fact that the loop is typically only a third to a quarter the length of each arm. Of the eleven members of the reference set that show divergence on both an arm and the loop, seven show more changes in the loop than on the non-miRNA-encoding arm and three have an equal number of changes on the loop and non-miRNA-encoding arm (Figure <figr fid="F2">2a</figr>, class 3); only one member of the reference set (miR-2b-1) shows a greater number of changes on the non-miRNA arm than the loop (Figure <figr fid="F2">2a</figr>, class 6). Finally, there are no cases where both arms have diverged (irrespective of loop status), a situation that would imply that the miRNA sequence itself had diverged (Figure <figr fid="F2">2a</figr>, class 4).</p>
            <p>We propose then that classes 1-3 represent the normal pattern of evolutionary divergence of miRNAs, and consider <it>Drosophila </it>candidates that fall into these classes to represent 'good' miRNA candidates. Conversely, we consider classes 4-6 to have a low probability of reflecting a genuine miRNA in <it>Drosophila</it>, regardless of how 'impressive' the helical nature of the conserved stem-loop is. Indeed, we tested one class 4 and seven class 5 candidates by northern blot and failed to observe expression for any of them, despite extensive, conserved stem-loop structure (data not shown). We emphasize that these evolutionary considerations are most relevant to relatively closely related species: since the loop is much shorter than the arms, we expect class 3 candidates to eventually evolve into class 6 candidates in species separated by greater evolutionary distance than the two <it>Drosophila </it>species analyzed in the present study (Figure <figr fid="F2">2a</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Computational prediction of <it>Drosophila</it> miRNA genes using miRseeker</p>
            </st>
            <p>Overall, the collected observations indicated that miRNAs are phylogenetically conserved, extended stem-loop structures that display a characteristic pattern of nucleotide divergence. We proceeded to identify such sequences in the completed drosophilid genomes using the following three-part computational pipeline that we call miRseeker (Figure <figr fid="F3">3</figr>).</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Overview of miRseeker, a computational strategy for identifying <it>Drosophila </it>miRNAs</p>
               </caption>
               <text>
                  <p>Overview of miRseeker, a computational strategy for identifying <it>Drosophila </it>miRNAs. See text for details.</p>
               </text>
               <graphic file="gb-2003-4-7-r42-3"/>
            </fig>
            <sec>
               <st>
                  <p>Extraction of candidate, conserved, 'nongenic' <it>Drosophila</it> sequences</p>
               </st>
               <p>We first subdivided Release 3 of the <it>D. melanogaster </it>genome <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> into 1,287 contigs of 100,500 nucleotides each, with 500 nucleotides of overlap at either end. These were matched to the approximately 18,000 contigs in the first assembly of the <it>D. pseudoobscura </it>genome produced by the Human Genome Sequencing Center at the Baylor College of Medicine <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, using a dataset provided by the Berkeley Genome Pipeline <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. We then aligned the repeat-masked <it>D. melanogaster </it>sequence to corresponding <it>D. pseudoobscura </it>sequence using the global alignment tool AVID <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B39">39</abbr></abbrgrp>. We subsequently eliminated from the alignment all sequences associated with the following Release 3.1 annotations <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>: exons, transposable elements, snRNA, snoRNA, tRNA and rRNA genes. In total, we were able to align 51.3 out of 90.2 megabases of intronic and intergenic <it>D. melanogaster </it>sequence by this procedure.</p>
               <p>Using the reference set, we empirically determined parameters for extracting conserved sequences that could contain miRNA genes (designated as 'regions'). We found that a 100-unit segment of the alignment (where a unit is either a single paired or gapped nucleotide) containing no more than 13% gaps or 15% mismatches, was sufficient to identify all known miRNA genes within their respective genomic neighborhoods, with a minimum of additionally selected sequences.</p>
               <p>Conserved intergenic or intronic sequences are frequently longer than 100 nucleotides. We chose to evaluate these as a series of 'regions' that overlap each other by around 10 nucleotides, and grouped these regions into a single 'super-region'. The rationale for defining 'regions' and 'super-regions' came from our observation that RNA folding algorithms would not necessarily identify characteristic pre-miRNA structures if they were folded within the context of longer RNAs, owing to base-pairing with non-miRNA sequence. Thus, region-folding should offer optimal structures, while tracking of super-regions would ensure that multiple overlapping regions were evaluated as a single candidate gene. We took care to verify that our windowing parameters segregated individual miRNAs within known miRNA clusters (the <it>mir-2</it>, <it>mir-13 </it>and <it>mir-3 &#8594; mir-6 </it>clusters <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>) into distinct super-regions. This analysis identified 436,000 conserved regions that originate from 118,000 super-regions.</p>
            </sec>
            <sec>
               <st>
                  <p>Identification of conserved stem-loops and evaluation of their quality</p>
               </st>
               <p>We analyzed conserved regions with mfold 3.1, an RNA-folding algorithm <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. As miRNA genes can be located on either strand, and the quality of predicted hairpin structures can vary significantly between the respective strands (depending on the amount of G-U base-pairing), we folded each region as both the forward and the reverse complement of the extracted sequence (436,000 regions &#215; 2 = 872,000 mfolds). Evaluation of candidate structures took into account the length of the longest helical arm (with a minimum cutoff of 23 base-pairs) and the free energy of this isolated arm (with a minimum cutoff of &#916;G &#8804;-23.0 kcal/mol). The physical resemblance to the canonical stem-loop precursor was also assessed with metrics that reward continuous helical pairing and progressively penalize internal loops of increasing size. Since unpaired nucleotides in known miRNAs have a tendency to be found in symmetric loops, the presence of asymmetric loops and bulged nucleotides was further penalized. The size of the hairpin loop was not specifically evaluated as it appears to be variable in known pre-miRNAs; however it was indirectly assessed, as maximization of stem length concomitantly minimizes terminal loop size.</p>
               <p>Given a 100-nucleotide input sequence, mfold 3.1 typically returns one to six alternate structures, each containing one to four helical arms; thus, the structure containing the highest-scoring helical arm had to be determined for each folded sequence. The highest-scoring region in each super-region (which could be located on either strand) was then saved as its representative, and these were ordered. For the top 25,000 <it>D. melanogaster </it>super-regions, we repeated this analysis on all regions in the corresponding <it>D. pseudoobscura </it>super-regions. We averaged the scores obtained for each aligned pair of <it>Dm/Dp </it>regions (termed a region-pair) and selected the highest-scoring region-pair within each super-region as its most probable miRNA candidate sequence. We then searched for homologs of these selected regions in <it>Anopheles gambiae </it>using WU-BLAST of the <it>Dm </it>sequence <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>, extending the returned sequences as necessary on their 5' and 3' ends to make 100-nucleotide windows equivalent to the queried sequence. The top three mosquito hits were then folded and scored as before. However, as a large fraction of known fly miRNAs lack mosquito counterparts (Table <tblr tid="T1">1</tblr>), we decided to rank the candidates solely on their average <it>Dm/Dp </it>score.</p>
               <tbl id="T1">
                  <title>
                     <p>Table 1</p>
                  </title>
                  <caption>
                     <p>List of <it>Drosophila </it>miRNAs and additional unverified candidates supported by third-species conservation</p>
                  </caption>
                  <tblbdy cols="11">
                     <r>
                        <c cspan="11" ca="left">
                           <p>
                              <b>Reference set miRNAs</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>Rank</p>
                        </c>
                        <c ca="left">
                           <p>Score</p>
                        </c>
                        <c ca="left">
                           <p>miR name</p>
                        </c>
                        <c ca="left">
                           <p>miR position</p>
                        </c>
                        <c ca="center">
                           <p>Cytological position</p>
                        </c>
                        <c ca="left">
                           <p>Sequence</p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Ano</it>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Apis</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>Other</p>
                        </c>
                        <c ca="left">
                           <p>Nearest gene</p>
                        </c>
                        <c ca="left">
                           <p>Comment</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>2</p>
                        </c>
                        <c ca="left">
                           <p>26.15</p>
                        </c>
                        <c ca="left">
                           <p>miR-2a-2 (1)</p>
                        </c>
                        <c ca="left">
                           <p>2L:19547562</p>
                        </c>
                        <c ca="center">
                           <p>37E</p>
                        </c>
                        <c ca="left">
                           <p>
                              UAUCACAGCCAAGCUUUGAUGAGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of spi (sense)</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>3</p>
                        </c>
                        <c ca="left">
                           <p>26.00</p>
                        </c>
                        <c ca="left">
                           <p>miR-2a-1 (2)</p>
                        </c>
                        <c ca="left">
                           <p>2L:19547974</p>
                        </c>
                        <c ca="center">
                           <p>37E</p>
                        </c>
                        <c ca="left">
                           <p>
                            UAUCACAGCCAGCUUUGAUGAGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Worm</p>
                        </c>
                        <c ca="left">
                           <p>In the intron of spi (sense)</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>6</p>
                        </c>
                        <c ca="left">
                           <p>24.16</p>
                        </c>
                        <c ca="left">
                           <p>miR-2b-2 (3)</p>
                        </c>
                        <c ca="left">
                           <p>2L:19548259</p>
                        </c>
                        <c ca="center">
                           <p>37E</p>
                        </c>
                        <c ca="left">
                           <p>
                             UAUCACAGCCAGCUUUGAGGAGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of spi (sense)</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              (8)
                           </p>
                        </c>
                        <c ca="left">
                           <p>24.01*</p>
                        </c>
                        <c ca="left">
                           <p>miR-2b-1</p>
                        </c>
                        <c ca="left">
                           <p>2L:8250840</p>
                        </c>
                        <c ca="center">
                           <p>28B</p>
                        </c>
                        <c ca="left">
                           <p>
                             UAUCACAGCCAGCUUUGAGGAGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>895 upstream of Btk29A</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; failed conservation filter</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>8</p>
                        </c>
                        <c ca="left">
                           <p>23.52</p>
                        </c>
                        <c ca="left">
                           <p>miR-13b-2 (4)</p>
                        </c>
                        <c ca="left">
                           <p>X:8830202</p>
                        </c>
                        <c ca="center">
                           <p>8C</p>
                        </c>
                        <c ca="left">
                           <p>
                            UAUCACAGCCAUUUUGACGAGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of CG7033 (sense)</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>9</p>
                        </c>
                        <c ca="left">
                           <p>23.45</p>
                        </c>
                        <c ca="left">
                           <p>miR6-3 (5)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724424</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGUGGCUGUUCUUUUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1732 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>12</p>
                        </c>
                        <c ca="left">
                           <p>22.89</p>
                        </c>
                        <c ca="left">
                           <p>miR-12 (6)</p>
                        </c>
                        <c ca="left">
                           <p>X:15240478</p>
                        </c>
                        <c ca="center">
                           <p>13D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAGUAUUACAUCAGGUACUGGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1986 upstream of Ac13E</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 2 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>13</p>
                        </c>
                        <c ca="left">
                           <p>22.84</p>
                        </c>
                        <c ca="left">
                           <p>miR-7 (7)</p>
                        </c>
                        <c ca="left">
                           <p>2R:15669777</p>
                        </c>
                        <c ca="center">
                           <p>57A</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGGAAGACUAGUGAUUUUGUUGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>816 upstream of CG30147</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>17</p>
                        </c>
                        <c ca="left">
                           <p>22.45</p>
                        </c>
                        <c ca="left">
                           <p>miR-14 (8)</p>
                        </c>
                        <c ca="left">
                           <p>2R:4614375</p>
                        </c>
                        <c ca="center">
                           <p>45E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UCAGUCUUUUUCUCUCUCCUA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>5855 upstream of Or45b</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>27</p>
                        </c>
                        <c ca="left">
                           <p>20.94</p>
                        </c>
                        <c ca="left">
                           <p>miR-9 (9)</p>
                        </c>
                        <c ca="left">
                           <p>3L:19515075</p>
                        </c>
                        <c ca="center">
                           <p>76C</p>
                        </c>
                        <c ca="left">
                           <p>
                               UCUUUGGUUAUCUAGCUGUAUGA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>6462 upstream of Shal</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>29</p>
                        </c>
                        <c ca="left">
                           <p>20.77</p>
                        </c>
                        <c ca="left">
                           <p>miR6-2 (10)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724582</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGUGGCUGUUCUUUUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1574 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>31</p>
                        </c>
                        <c ca="left">
                           <p>20.65</p>
                        </c>
                        <c ca="left">
                           <p>miR6-1 (11)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724711</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGUGGCUGUUCUUUUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1445 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>33</p>
                        </c>
                        <c ca="left">
                           <p>20.38</p>
                        </c>
                        <c ca="left">
                           <p>miR-13a (12)</p>
                        </c>
                        <c ca="left">
                           <p>3R:11243269</p>
                        </c>
                        <c ca="center">
                           <p>88F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGCCAUUUUGAUGAGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>4626 upstream of CG6118</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>36</p>
                        </c>
                        <c ca="left">
                           <p>20.08</p>
                        </c>
                        <c ca="left">
                           <p>miR-5 (13)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724858</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               AAAGGAACGAUCGUUGUGAUAUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1298 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>62</p>
                        </c>
                        <c ca="left">
                           <p>18.86</p>
                        </c>
                        <c ca="left">
                           <p>let-7 (14)</p>
                        </c>
                        <c ca="left">
                           <p>2L:18450101</p>
                        </c>
                        <c ca="center">
                           <p>36E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAGGUAGUAGGUUGUAUAGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate/ worm</p>
                        </c>
                        <c ca="left">
                           <p>932 upstream of CG10283</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B9">9</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>18.45*</p>
                        </c>
                        <c ca="left">
                           <p>miR-10</p>
                        </c>
                        <c ca="left">
                           <p>3R:2635277</p>
                        </c>
                        <c ca="center">
                           <p>84B</p>
                        </c>
                        <c ca="left">
                           <p>
                               ACCCUGUAGAUCCGAAUUUGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>13566 upstream of Scr</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; (not on aligned contig)</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>74</p>
                        </c>
                        <c ca="left">
                           <p>18.42</p>
                        </c>
                        <c ca="left">
                           <p>miR-1 (15)</p>
                        </c>
                        <c ca="left">
                           <p>2L:20457182</p>
                        </c>
                        <c ca="center">
                           <p>38D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGGAAUGUAAAGAAGUAUGGAG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate/ worm</p>
                        </c>
                        <c ca="left">
                           <p>14444 upstream of CG15476</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>96</p>
                        </c>
                        <c ca="left">
                           <p>17.79</p>
                        </c>
                        <c ca="left">
                           <p>miR-3 (16)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14725313</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UCACUGGGCAAAGUGUGUCUCA
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>843 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>114</p>
                        </c>
                        <c ca="left">
                           <p>17.49</p>
                        </c>
                        <c ca="left">
                           <p>miR-11 (17)</p>
                        </c>
                        <c ca="left">
                           <p>3R:17439181</p>
                        </c>
                        <c ca="center">
                           <p>93E</p>
                        </c>
                        <c ca="left">
                           <p>
                               CAUCACAGUCUGAGUUCUUGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of E2f (sense)</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>124</p>
                        </c>
                        <c ca="left">
                           <p>17.36</p>
                        </c>
                        <c ca="left">
                           <p>miR-4 (18)</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724998</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               AUAAAGCUAGACAACCAUUGA
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1158 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 7 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>172</p>
                        </c>
                        <c ca="left">
                           <p>16.54</p>
                        </c>
                        <c ca="left">
                           <p>miR-13b-1 (19)</p>
                        </c>
                        <c ca="left">
                           <p>3R:11243135</p>
                        </c>
                        <c ca="center">
                           <p>88F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGCCAUUUUGACGAGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>4760 upstream of CG6118</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>192</p>
                        </c>
                        <c ca="left">
                           <p>16.27</p>
                        </c>
                        <c ca="left">
                           <p>miR-8 (20)</p>
                        </c>
                        <c ca="left">
                           <p>2R:11895154</p>
                        </c>
                        <c ca="center">
                           <p>53D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAAUACUGUCAGGUAAAGAUGUC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3783 downstream of CG6301</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B10">10</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>14.20</p>
                        </c>
                        <c ca="left">
                           <p>miR-125</p>
                        </c>
                        <c ca="left">
                           <p>2L:18450405</p>
                        </c>
                        <c ca="center">
                           <p>36E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UCCCUGAGACCCUAACUUGUGA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate/ worm</p>
                        </c>
                        <c ca="left">
                           <p>628 upstream of CG10283</p>
                        </c>
                        <c ca="left">
                           <p><abbrgrp><abbr bid="B29">29</abbr></abbrgrp>: low score; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>miR-2c</p>
                        </c>
                        <c ca="left">
                           <p>3R:11243493</p>
                        </c>
                        <c ca="center">
                           <p>88F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCACAGCCAGCUUUGAUGGGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>4402 upstream of CG6118</p>
                        </c>
                        <c ca="left">
                           <p>Hom; score n/a; 3 miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <p/>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="11" ca="left">
                           <p>
                              <b>Newly verified miRNAs</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>Rank</p>
                        </c>
                        <c ca="left">
                           <p>Score</p>
                        </c>
                        <c ca="left">
                           <p>miR name</p>
                        </c>
                        <c ca="left">
                           <p>miR position</p>
                        </c>
                        <c ca="center">
                           <p>Cytological position</p>
                        </c>
                        <c ca="left">
                           <p>Sequence</p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Anos</it>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Apis</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>Other</p>
                        </c>
                        <c ca="left">
                           <p>Nearest gene</p>
                        </c>
                        <c ca="left">
                           <p>Comment</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>4</p>
                        </c>
                        <c ca="left">
                           <p>24.67</p>
                        </c>
                        <c ca="left">
                           <p>miR-184</p>
                        </c>
                        <c ca="left">
                           <p>2R:8394117</p>
                        </c>
                        <c ca="center">
                           <p>50A</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGGACGGAGAACUGAUAAGGG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>24406 upstream of CG17048</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>7</p>
                        </c>
                        <c ca="left">
                           <p>24.15</p>
                        </c>
                        <c ca="left">
                           <p>miR-274</p>
                        </c>
                        <c ca="left">
                           <p>3L:11614451</p>
                        </c>
                        <c ca="center">
                           <p>68C</p>
                        </c>
                        <c ca="left">
                           <p>
                               UUUUGUGACCGACACUAACGGGUAAU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of CG32085 (antisense)</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>10</p>
                        </c>
                        <c ca="left">
                           <p>23.10</p>
                        </c>
                        <c ca="left">
                           <p>miR-275</p>
                        </c>
                        <c ca="left">
                           <p>2L:7418027</p>
                        </c>
                        <c ca="center">
                           <p>27F</p>
                        </c>
                        <c ca="left">
                           <p>
                               cAGUCAGGUACCUGAAGUAGCGCGCG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1070 upstream of CG5261</p>
                        </c>
                        <c ca="left">
                           <p>2miR cluster (+Ano and Apis); expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>16</p>
                        </c>
                        <c ca="left">
                           <p>22.57</p>
                        </c>
                        <c ca="left">
                           <p>miR-92a</p>
                        </c>
                        <c ca="left">
                           <p>3R:21461594</p>
                        </c>
                        <c ca="center">
                           <p>96E</p>
                        </c>
                        <c ca="left">
                           <p>
                               CAUUGCACUUGUCCCGGCCUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>6578 upstream of BcDNA:LD22548</p>
                        </c>
                        <c ca="left">
                           <p>2miR cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>21</p>
                        </c>
                        <c ca="left">
                           <p>21.72</p>
                        </c>
                        <c ca="left">
                           <p>miR-219</p>
                        </c>
                        <c ca="left">
                           <p>3L:17263886</p>
                        </c>
                        <c ca="center">
                           <p>74A</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAUUGUCCAAACGCAAUUCUUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>4955 upstream of CG6485</p>
                        </c>
                        <c ca="left">
                           <p>Expression not seen</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>25</p>
                        </c>
                        <c ca="left">
                           <p>21.12</p>
                        </c>
                        <c ca="left">
                           <p>miR-276a</p>
                        </c>
                        <c ca="left">
                           <p>3L:10322758</p>
                        </c>
                        <c ca="center">
                           <p>67E</p>
                        </c>
                        <c ca="left">
                           <p>
                               CAGCGAGGUAUAGAGUUCCUACG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>47587 upstream of CG12362</p>
                        </c>
                        <c ca="left">
                           <p>Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>28</p>
                        </c>
                        <c ca="left">
                           <p>20.88</p>
                        </c>
                        <c ca="left">
                           <p>miR-277</p>
                        </c>
                        <c ca="left">
                           <p>3R:5925763</p>
                        </c>
                        <c ca="center">
                           <p>85F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGUAAAUGCACUAUCUGGUACGACAU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1391 upstream of Fmr1</p>
                        </c>
                        <c ca="left">
                           <p>2 miR cluster; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>30</p>
                        </c>
                        <c ca="left">
                           <p>20.73</p>
                        </c>
                        <c ca="left">
                           <p>miR-278</p>
                        </c>
                        <c ca="left">
                           <p>2R:10720792</p>
                        </c>
                        <c ca="center">
                           <p>52B</p>
                        </c>
                        <c ca="left">
                           <p>
                               ggUGGGACUUUCGUCCGUUUGUAA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>386 upstream of fus</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>34</p>
                        </c>
                        <c ca="left">
                           <p>20.27</p>
                        </c>
                        <c ca="left">
                           <p>miR-133</p>
                        </c>
                        <c ca="left">
                           <p>2L:20586360</p>
                        </c>
                        <c ca="center">
                           <p>38D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UUGGUCCCCUUCAACCAGCUGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>1059 downstream of CG15475</p>
                        </c>
                        <c ca="left">
                           <p>3 miR cluster; expression verified; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>37</p>
                        </c>
                        <c ca="left">
                           <p>20.03</p>
                        </c>
                        <c ca="left">
                           <p>miR-279</p>
                        </c>
                        <c ca="left">
                           <p>3R:25030674</p>
                        </c>
                        <c ca="center">
                           <p>99A</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGUGACUAGAUCCACACUCAU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1328 upstream of CG31044</p>
                        </c>
                        <c ca="left">
                           <p>Related to miR-286; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>38</p>
                        </c>
                        <c ca="left">
                           <p>19.90</p>
                        </c>
                        <c ca="left">
                           <p>miR-33</p>
                        </c>
                        <c ca="left">
                           <p>3L:19716503</p>
                        </c>
                        <c ca="center">
                           <p>76C</p>
                        </c>
                        <c ca="left">
                           <p>
                               AGGUGCAUUGUAGUCGCAUUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>In the intron of HLH106 (sense)</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>39</p>
                        </c>
                        <c ca="left">
                           <p>19.77</p>
                        </c>
                        <c ca="left">
                           <p>miR-280</p>
                        </c>
                        <c ca="left">
                           <p>2R:3358854</p>
                        </c>
                        <c ca="center">
                           <p>44C</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGUAUUUACGUUGCAUAUGAAAUGAUA
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>21740 upstream of CG30358</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>41</p>
                        </c>
                        <c ca="left">
                           <p>19.73</p>
                        </c>
                        <c ca="left">
                           <p>miR-281a</p>
                        </c>
                        <c ca="left">
                           <p>2R:7235078</p>
                        </c>
                        <c ca="center">
                           <p>48E</p>
                        </c>
                        <c ca="left">
                           <p>
                               ACUGUCGACGGACAGCUCUCUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>356 downstream of SmD3</p>
                        </c>
                        <c ca="left">
                           <p>Duplicated cluster; expression verified; 1 copy in Ano</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>43</p>
                        </c>
                        <c ca="left">
                           <p>19.64</p>
                        </c>
                        <c ca="left">
                           <p>miR-282</p>
                        </c>
                        <c ca="left">
                           <p>3L:3231652</p>
                        </c>
                        <c ca="center">
                           <p>63C</p>
                        </c>
                        <c ca="left">
                           <p>
                               aaucUAGCCUCUACUAGGCUUUGUCUGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>7132 upstream of CG14959</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>44</p>
                        </c>
                        <c ca="left">
                           <p>19.55</p>
                        </c>
                        <c ca="left">
                           <p>miR-283</p>
                        </c>
                        <c ca="left">
                           <p>X:15238971</p>
                        </c>
                        <c ca="center">
                           <p>13D</p>
                        </c>
                        <c ca="left">
                           <p>
                               AAAUAUCAGCUGGUAAUUCUGGG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3493 upstream of Ac13E</p>
                        </c>
                        <c ca="left">
                           <p>2 miR cluster; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>46</p>
                        </c>
                        <c ca="left">
                           <p>19.52</p>
                        </c>
                        <c ca="left">
                           <p>miR-284</p>
                        </c>
                        <c ca="left">
                           <p>3R:8377257</p>
                        </c>
                        <c ca="center">
                           <p>87C</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAAGUCAGCAACUUGAUUCCAGCAAUUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1128 upstream of CG6989</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>47</p>
                        </c>
                        <c ca="left">
                           <p>19.47</p>
                        </c>
                        <c ca="left">
                           <p>miR-281b</p>
                        </c>
                        <c ca="left">
                           <p>2R:7234866</p>
                        </c>
                        <c ca="center">
                           <p>48E</p>
                        </c>
                        <c ca="left">
                           <p>
                               ACUGUCGACGGAUAGCUCUCUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>144 downstream of SmD3</p>
                        </c>
                        <c ca="left">
                           <p>Duplicated cluster; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>49</p>
                        </c>
                        <c ca="left">
                           <p>19.35</p>
                        </c>
                        <c ca="left">
                           <p>miR-34</p>
                        </c>
                        <c ca="left">
                           <p>3R:5926677</p>
                        </c>
                        <c ca="center">
                           <p>85F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGGCAGUGUGGUUAGCUGGUUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate/ worm</p>
                        </c>
                        <c ca="left">
                           <p>477 upstream of Fmr1</p>
                        </c>
                        <c ca="left">
                           <p>2 miR cluster; expression verified; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>50</p>
                        </c>
                        <c ca="left">
                           <p>19.27</p>
                        </c>
                        <c ca="left">
                           <p>miR-263a</p>
                        </c>
                        <c ca="left">
                           <p>2L:11942273</p>
                        </c>
                        <c ca="center">
                           <p>33B</p>
                        </c>
                        <c ca="left">
                           <p>
                               aAUGGCACUGGAAGAAUUCACg
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>4764 downstream of CG16964</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified; <abbrgrp><abbr bid="B34">34</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>59</p>
                        </c>
                        <c ca="left">
                           <p>18.89</p>
                        </c>
                        <c ca="left">
                           <p>miR-124</p>
                        </c>
                        <c ca="left">
                           <p>2L:17544454</p>
                        </c>
                        <c ca="center">
                           <p>36D</p>
                        </c>
                        <c ca="left">
                           <p>
                               AUAAGGCACGCGGUGAAUGCCA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate/ worm</p>
                        </c>
                        <c ca="left">
                           <p>10606 downstream of CG7094</p>
                        </c>
                        <c ca="left">
                           <p>2 miR cluster; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>66</p>
                        </c>
                        <c ca="left">
                           <p>18.58</p>
                        </c>
                        <c ca="left">
                           <p>miR-79</p>
                        </c>
                        <c ca="left">
                           <p>2L:16676639</p>
                        </c>
                        <c ca="center">
                           <p>36A</p>
                        </c>
                        <c ca="left">
                           <p>
                               AUAAAGCUAGAUUACCAAAGC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Worm</p>
                        </c>
                        <c ca="left">
                           <p>822 upstream of CG31782</p>
                        </c>
                        <c ca="left">
                           <p>3 miR cluster; expression verified; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>67</p>
                        </c>
                        <c ca="left">
                           <p>18.57</p>
                        </c>
                        <c ca="left">
                           <p>miR-276b</p>
                        </c>
                        <c ca="left">
                           <p>3L:10277315</p>
                        </c>
                        <c ca="center">
                           <p>67E</p>
                        </c>
                        <c ca="left">
                           <p>
                               CAGCGAGGUAUAGAGUUCCUACG
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>7073 downstream of CG6559</p>
                        </c>
                        <c ca="left">
                           <p>Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>77</p>
                        </c>
                        <c ca="left">
                           <p>18.36</p>
                        </c>
                        <c ca="left">
                           <p>miR-210</p>
                        </c>
                        <c ca="left">
                           <p>X:17859179</p>
                        </c>
                        <c ca="center">
                           <p>16F</p>
                        </c>
                        <c ca="left">
                           <p>
                               UUGUGCGUGUGACAGCGGCUA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>1193 downstream of CG32553</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>83</p>
                        </c>
                        <c ca="left">
                           <p>18.11</p>
                        </c>
                        <c ca="left">
                           <p>miR-285</p>
                        </c>
                        <c ca="left">
                           <p>3L:11903642</p>
                        </c>
                        <c ca="center">
                           <p>68E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAGCACCAUUCGAAAUCAGUGCU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>1592 upstream of CG7252</p>
                        </c>
                        <c ca="left">
                           <p>Similar to miR-29</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>18.08*</p>
                        </c>
                        <c ca="left">
                           <p>miR-100</p>
                        </c>
                        <c ca="left">
                           <p>2L:18449518</p>
                        </c>
                        <c ca="center">
                           <p>36E</p>
                        </c>
                        <c ca="left">
                           <p>
                               AACCCGUAAAUCCGAACUUGUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>1515 upstream of CG10283</p>
                        </c>
                        <c ca="left">
                           <p>Failed conservation filter; 3 miR cluster; expression verified; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>91</p>
                        </c>
                        <c ca="left">
                           <p>17.93</p>
                        </c>
                        <c ca="left">
                           <p>miR-92b</p>
                        </c>
                        <c ca="left">
                           <p>3R:21466486</p>
                        </c>
                        <c ca="center">
                           <p>96E</p>
                        </c>
                        <c ca="left">
                           <p>
                               AAUUGCACUAGUCCCGGCCU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>1686 upstream of BcDNA:LD22548</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified; 2 miR cluster; <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>145</p>
                        </c>
                        <c ca="left">
                           <p>17.12</p>
                        </c>
                        <c ca="left">
                           <p>miR-286</p>
                        </c>
                        <c ca="left">
                           <p>2R:14724858</p>
                        </c>
                        <c ca="center">
                           <p>56E</p>
                        </c>
                        <c ca="left">
                           <p>
                               AGUGACUAGACCGAACACUCG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1013 upstream of CG11018</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified; 7 miR cluster; related to miR-279</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>146</p>
                        </c>
                        <c ca="left">
                           <p>17.11</p>
                        </c>
                        <c ca="left">
                           <p>bantam</p>
                        </c>
                        <c ca="left">
                           <p>3L:622845</p>
                        </c>
                        <c ca="center">
                           <p>61C</p>
                        </c>
                        <c ca="left">
                           <p>
                               AGUGAGAUCAUUUUGAAAGCUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Worm</p>
                        </c>
                        <c ca="left">
                           <p>6301 upstream of CG12030</p>
                        </c>
                        <c ca="left">
                           <p>
                              <abbrgrp>
                                 <abbr bid="B44">44</abbr>
                              </abbrgrp>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>208</p>
                        </c>
                        <c ca="left">
                           <p>16.09</p>
                        </c>
                        <c ca="left">
                           <p>miR-289</p>
                        </c>
                        <c ca="left">
                           <p>3L:13578391</p>
                        </c>
                        <c ca="center">
                           <p>70C</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAAAUAUUUAAGUGGAGCCUGCGACU
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of bru-3 (antisense)</p>
                        </c>
                        <c ca="left">
                           <p>Expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>13.73</p>
                        </c>
                        <c ca="left">
                           <p>miR-287</p>
                        </c>
                        <c ca="left">
                           <p>2L:17552694</p>
                        </c>
                        <c ca="center">
                           <p>36D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGUGUUGAAAAUCGUUUGCAC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>14896 upstream of Oli</p>
                        </c>
                        <c ca="left">
                           <p>Very low score;found by proximity to miR-124; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>13.35</p>
                        </c>
                        <c ca="left">
                           <p>miR-87</p>
                        </c>
                        <c ca="left">
                           <p>2L:9942828</p>
                        </c>
                        <c ca="center">
                           <p>30D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAGCAAAAUUUCAGGUGUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Worm</p>
                        </c>
                        <c ca="left">
                           <p>2009 upstream of CG13126</p>
                        </c>
                        <c ca="left">
                           <p>Hom: very low score</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>miR-263b</p>
                        </c>
                        <c ca="left">
                           <p>3L:15666960</p>
                        </c>
                        <c ca="center">
                           <p>72D</p>
                        </c>
                        <c ca="left">
                           <p>
                               cuUGGCACUGGGAGAAUUCACa
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c ca="left">
                           <p>Vertebrate</p>
                        </c>
                        <c ca="left">
                           <p>4243 upstream of comm</p>
                        </c>
                        <c ca="left">
                           <p>Hom; score n/a</p>
                        </c>
                     </r>
                     <r>
                        <c>
                           <p/>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>miR-288</p>
                        </c>
                        <c ca="left">
                           <p>2L:20588106</p>
                        </c>
                        <c ca="center">
                           <p>38D</p>
                        </c>
                        <c ca="left">
                           <p>
                               UUUCAUGUCGAUUUCAUUUCAUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2805 downstream of CG15475</p>
                        </c>
                        <c ca="left">
                           <p>Score n/a; found by proximity to miR-133; expression verified</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <p/>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="11" ca="left">
                           <p>
                              <b>Unverified Ano-conserved candidates</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>Rank</p>
                        </c>
                        <c ca="left">
                           <p>Score</p>
                        </c>
                        <c ca="left">
                           <p>miR name</p>
                        </c>
                        <c ca="left">
                           <p>miR position</p>
                        </c>
                        <c ca="center">
                           <p>Cytological position</p>
                        </c>
                        <c ca="left">
                           <p>Sequence</p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Ano</it>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <it>Apis</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>Other</p>
                        </c>
                        <c ca="left">
                           <p>Nearest gene</p>
                        </c>
                        <c ca="left">
                           <p>Comment</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="11">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>1</p>
                        </c>
                        <c ca="left">
                           <p>26.76</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2R:4681879</p>
                        </c>
                        <c ca="center">
                           <p>46A</p>
                        </c>
                        <c ca="left">
                           <p>
                               CAUCACACCCAGGUUGAGUGAGU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>In the intron of Mmp2 (antisense)</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>5</p>
                        </c>
                        <c ca="left">
                           <p>24.35</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3R:121090</p>
                        </c>
                        <c ca="center">
                           <p>82A</p>
                        </c>
                        <c ca="left">
                           <p>
                               AAAUUGACUCUAGUAGGGAGUCC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>533 downstream of CG9780</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>14</p>
                        </c>
                        <c ca="left">
                           <p>22.63</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>X:1545630</p>
                        </c>
                        <c ca="center">
                           <p>2B</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGCAGGUUUCGUCGACAACGA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>732 upstream of CG32806</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>19</p>
                        </c>
                        <c ca="left">
                           <p>22.13</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3L:21585985</p>
                        </c>
                        <c ca="center">
                           <p>79A</p>
                        </c>
                        <c ca="left">
                           <p>
                               CGAUUUGUCUUUUUCCGCUUACUG
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1727 downstream of CG7160</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>20</p>
                        </c>
                        <c ca="left">
                           <p>21.95</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3L:18809845</p>
                        </c>
                        <c ca="center">
                           <p>75E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UUUUGAUUGUUGCUCAGAAAGCC
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3283 upstream of CG6865</p>
                        </c>
                        <c ca="left">
                           <p>No expression seen either strand</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>23</p>
                        </c>
                        <c ca="left">
                           <p>21.38</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3L:8530512</p>
                        </c>
                        <c ca="center">
                           <p>66D</p>
                        </c>
                        <c ca="left">
                           <p>
                               GUGAGAUAUGUUUGAUAUUCUUGGUUGUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2374 upstream of CG6638</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>40</p>
                        </c>
                        <c ca="left">
                           <p>19.75</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>X:12366993</p>
                        </c>
                        <c ca="center">
                           <p>11B</p>
                        </c>
                        <c ca="left">
                           <p>
                               UAUCAUAAGACACACGCGGCUAU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>in the intron of tomosyn (sense)</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>54</p>
                        </c>
                        <c ca="left">
                           <p>19.06</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2R:11128979</p>
                        </c>
                        <c ca="center">
                           <p>52E</p>
                        </c>
                        <c ca="left">
                           <p>
                               guUAUUGCUUGAGAAUACACGUAGUU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>15915 upstream of Dg</p>
                        </c>
                        <c ca="left">
                           <p>No expression seen either strand</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>61</p>
                        </c>
                        <c ca="left">
                           <p>18.86</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2L:859210</p>
                        </c>
                        <c ca="center">
                           <p>21D</p>
                        </c>
                        <c ca="left">
                           <p>
                               AGUUUGUUCGUUUGGCUCGAGUUAU
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2208 downstream of CG13949</p>
                        </c>
                        <c ca="left">
                           <p>NT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>104</p>
                        </c>
                        <c ca="left">
                           <p>17.64</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2L:16676008</p>
                        </c>
                        <c ca="center">
                           <p>36A</p>
                        </c>
                        <c ca="left">
                           <p>
                               UCUUUGGUAUUCUAGCUGUAGA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>1453 upstream of CG31782</p>
                        </c>
                        <c ca="left">
                           <p>No expression seen; miR-79 cluster</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>117</p>
                        </c>
                        <c ca="left">
                           <p>17.44</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3R:21403955</p>
                        </c>
                        <c ca="center">
                           <p>96E</p>
                        </c>
                        <c ca="left">
                           <p>
                               UGAUAUUGUCCUGUCACAGCAGUA
                           </p>
                        </c>
                        <c ca="center">
                           <p>+</p>
                        </c>
                        <c ca="center">
                           <p>-</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>3265 upstream of CG12250</p>
                        </c>
                        <c ca="left">
                           <p>No expression seen</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>123</p>
                        </c>
                        <c ca="left">
                           <p>17.36</p>
                        </c>
                        <c>
                           <p/>
                        </c>
                        <c ca="left">
                           <p>2L:7418192</p>
                        </c>
                        <c ca="center">
                           <p>27F</p>
                        </c>
                        <c ca="left">
          