<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1756-8722-1-10</ui>
   <ji>1756-8722</ji>
   <fm>
      <dochead>Short report</dochead>
      <bibl>
         <title>
            <p>Detection of <it>NPM1 </it>exon 12 mutations and <it>FLT3 </it>&#8211; internal tandem duplications by high resolution melting analysis in normal karyotype acute myeloid leukemia</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Tan</snm>
               <mi>YC</mi>
               <fnm>Angela</fnm>
               <insr iid="I1"/>
               <email>angela.tan@petermac.org</email>
            </au>
            <au id="A2">
               <snm>Westerman</snm>
               <mi>A</mi>
               <fnm>David</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>david.westerman@petermac.org</email>
            </au>
            <au id="A3">
               <snm>Carney</snm>
               <mi>A</mi>
               <fnm>Dennis</fnm>
               <insr iid="I2"/>
               <email>dennis.carney@petermac.org</email>
            </au>
            <au id="A4">
               <snm>Seymour</snm>
               <mi>F</mi>
               <fnm>John</fnm>
               <insr iid="I2"/>
               <email>john.seymour@petermac.org</email>
            </au>
            <au id="A5">
               <snm>Juneja</snm>
               <fnm>Surender</fnm>
               <insr iid="I4"/>
               <email>surender.juneja@mh.org.au</email>
            </au>
            <au id="A6" ca="yes">
               <snm>Dobrovic</snm>
               <fnm>Alexander</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>alexander.dobrovic@petermac.org</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Pathology, Peter MacCallum Cancer Centre, Melbourne, Australia</p>
            </ins>
            <ins id="I2">
               <p>Department of Haematology and Medical Oncology, Peter MacCallum Cancer Centre, Melbourne, Australia</p>
            </ins>
            <ins id="I3">
               <p>Department of Pathology, University of Melbourne, Parkville, Australia</p>
            </ins>
            <ins id="I4">
               <p>Royal Melbourne Hospital, Parkville, Australia</p>
            </ins>
         </insg>
         <source>Journal of Hematology &amp; Oncology</source>
         <issn>1756-8722</issn>
         <pubdate>2008</pubdate>
         <volume>1</volume>
         <issue>1</issue>
         <fpage>10</fpage>
         <url>http://www.jhoonline.org/content/1/1/10</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18664261</pubid>
               <pubid idtype="doi">10.1186/1756-8722-1-10</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>20</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>29</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>29</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Tan et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Molecular characterisation of normal karyotype acute myeloid leukemia (NK-AML) allows prognostic stratification and potentially can alter treatment choices and pathways. Approximately 45&#8211;60% of patients with NK-AML carry <it>NPM1 </it>gene mutations and are associated with a favourable clinical outcome when <it>FLT3</it>-internal tandem duplications (ITD) are absent. High resolution melting (HRM) is a novel screening method that enables rapid identification of mutation positive DNA samples.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We developed HRM assays to detect <it>NPM1 </it>mutations and <it>FLT3</it>-ITD and tested diagnostic samples from 44 NK-AML patients. Eight were <it>NPM1 </it>mutation positive only, 4 were both <it>NPM1 </it>mutation and <it>FLT3</it>-ITD positive and 4 were <it>FLT3</it>-ITD positive only. A novel point mutation Y572C (c.1715A>G) in exon 14 of <it>FLT3 </it>was also detected. In the group with <it>de novo </it>NK-AML, 40% (12/29) were <it>NPM1 </it>mutation positive whereas <it>NPM1 </it>mutations were observed in 20% (3/15) of secondary NK-AML cases. Sequencing was performed and demonstrated 100% concordance with the HRM results.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>HRM is a rapid and efficient method of screening NK-AML samples for both novel and known <it>NPM1 </it>and <it>FLT3 </it>mutations. <it>NPM1 </it>mutations can be observed in both primary and secondary NK-AML cases.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Acute myeloid leukemia with a normal karyotype (NK-AML) is considered to have an intermediate prognostic risk with 5 year disease free survival (DFS) ranging between 24&#8211;42% <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. However, there is marked variability in outcome suggesting significant biological and molecular heterogeneity within this group of AML <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>.</p>
         <p>In 2005, Falini <it>et al</it>. described a set of common mutations within the final exon of the <it>NPM1 </it>gene in primary NK-AML patients, which alter the N-terminal domain nuclear localisation signal leading to abnormal cytoplasmic accumulation of the NPM1 phosphoprotein <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. While the precise functional effect of the <it>NPM1 </it>mutation is incompletely understood, several groups confirmed that NK-AML patients have a high incidence of <it>NPM1 </it>exon 12 mutations (~24% &#8211; 60%) <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Mutations in <it>NPM1 </it>are the most frequent genetic change known in patients with NK-AML and a number of studies have shown that <it>NPM1 </it>mutation positive patients have a better prognosis with longer event-free and overall survival (OS) <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>Schnittger <it>et al. </it>demonstrated that the favourable prognostic implications of <it>NPM1 </it>mutation status are overridden in <it>FLT3</it>-ITD positive cases which have a uniformly poor prognosis <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. These findings demonstrate the need to screen patients for mutations in <it>FLT3</it>-ITD alongside <it>NPM1 </it><abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. However, such a molecular screening program can be demanding on the resources of a diagnostic laboratory. Therefore, in this study we assessed the use of high resolution melting (HRM) analysis as a rapid method to screen NK-AML patient samples for the critical molecular changes in <it>NPM1 </it>and <it>FLT3</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <p>In this study, we developed HRM assays allowing rapid assessment of the mutation status of <it>NPM1 </it>and the presence of the <it>FLT3</it>-ITD in the same run. In HRM, the PCR product is subjected to melting in the presence of a dye that only fluoresces when bound to double stranded DNA <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. As melting is sequence dependent, monitoring the precise melting behaviour by observing the change in fluorescence allows the detection of variant sequences. In addition, sequence variants in the DNA such as mutations give rise to heteroduplexes that form earlier melting products allowing ready detection of mutations even at comparatively low concentrations.</p>
         <p>Samples from 44 patients with NK-AML were analysed. The median age of the patients was 62 years (range 18&#8211;89 years) and 27 (61%) patients were male. Twenty nine (66%) had <it>de novo </it>AML and 15 (34%) had secondary AML. Sixteen patients generated an abnormal melting profile in one of the two tested amplicons, 8 were <it>NPM1 </it>mutation positive only, 4 were <it>NPM1 </it>positive and <it>FLT3</it>-ITD positive and 4 were <it>FLT3</it>-ITD positive only (Figure <figr fid="F1">1</figr>.).</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Detection of NPM1 mutations and FLT3-ITD using high resolution melting analysis</p>
            </caption>
            <text>
               <p><b>Detection of NPM1 mutations and FLT3-ITD using high resolution melting analysis.</b> (A) The melt curve of NPM1 exon 12 and (B) The difference plot of NPM1 exon 12. Six patient samples are shown in comparison to five normal controls.  Four patients (#6, #12, #14 and #38) are NPM1 mutation positive and two patients (#33 and #43) are NPM1 mutation negative. (C) The melt curve of FLT3 exon 14 and (D) The difference plot of FLT3 exon 14 - Six patient samples are shown in comparison to five normal controls.  Three patients (#6, #33 and #43) are FLT3-ITD positive and three patients (#12, #14 and #48) are FLT3-ITD negative. (E) The melt curve of FLT3 exon 14 and (F) The difference plot of FLT3 exon 14 - Eight patient samples are shown in comparison to five normal controls.  One patient (#19) is positive for FLT3 Y572C and seven patients (#4, #5, #10, #24, #25, #26 and #30) are FLT3 mutation negative.  All samples are shown in duplicate.</p>
            </text>
            <graphic file="1756-8722-1-10-1"/>
         </fig>
         <p>Sequencing confirmed all the HRM detected mutations and did not reveal any further mutations, indicating that HRM was capable of detecting mutations with 100% sensitivity in this cohort.</p>
         <p>All the <it>NPM1 </it>mutations detected involved one of two 4 base insertions that altered the tryptophan at amino acid position 288 and the <it>FLT3</it>-ITD ranged from 33&#8211;102 bases (Table <tblr tid="T1">1</tblr>). These mutations were similar to those previously described <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. All 12 <it>NPM1 </it>mutation positive patients were also positive by immunohistochemistry (IHC) on bone marrow trephine sections, showing typical cytoplasmic localisation (data not shown).</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Patient demographics and list of <it>NPM1 </it>and <it>FLT3</it>-ITD mutations detected</p>
            </caption>
            <tblbdy cols="9">
               <r>
                  <c ca="center">
                     <p>#</p>
                  </c>
                  <c ca="center">
                     <p>Age</p>
                  </c>
                  <c ca="center">
                     <p>Sex*</p>
                  </c>
                  <c ca="center">
                     <p>FAB</p>
                  </c>
                  <c ca="center">
                     <p>Prior Disease&#8224;</p>
                  </c>
                  <c ca="center">
                     <p>HRM &#8211; NPM1&#8225;</p>
                  </c>
                  <c ca="center">
                     <p>Seq &#8211; NPM1&#167;</p>
                  </c>
                  <c ca="center">
                     <p>HRM &#8211; FLT3-</p>
                     <p>ITD</p>
                  </c>
                  <c ca="center">
                     <p>Seq-FLT3-ITD|</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>64</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>63</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M6</p>
                  </c>
                  <c ca="center">
                     <p>MDS</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>36</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>69</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>basophilic leukemia</p>
                  </c>
                  <c ca="center">
                     <p>RAEB-T</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>68</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>81</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M5</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1754_1798<it>dup</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>19</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>8</p>
                  </c>
                  <c ca="center">
                     <p>68</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M6</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>9</p>
                  </c>
                  <c ca="center">
                     <p>72</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>CMML</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>11</p>
                  </c>
                  <c ca="center">
                     <p>66</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4/5</p>
                  </c>
                  <c ca="center">
                     <p>MDS transformed</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>12</p>
                  </c>
                  <c ca="center">
                     <p>51</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>13</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="center">
                     <p>MDS/pelvic chloroma</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>14</p>
                  </c>
                  <c ca="center">
                     <p>53</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>15</p>
                  </c>
                  <c ca="center">
                     <p>59</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1811_1837<it>dup </it>1838_1867<it>ins</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>16</p>
                  </c>
                  <c ca="center">
                     <p>69</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>17</p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>MDS</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>18</p>
                  </c>
                  <c ca="center">
                     <p>74</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>19</p>
                  </c>
                  <c ca="center">
                     <p>66</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M0</p>
                  </c>
                  <c ca="center">
                     <p>ca prostate</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863dupTCTG</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1715A>G</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>20</p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>MDS</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>21</p>
                  </c>
                  <c ca="center">
                     <p>75</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>MDS</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>22</p>
                  </c>
                  <c ca="center">
                     <p>56</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M0</p>
                  </c>
                  <c ca="center">
                     <p>NHL on TX</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>23</p>
                  </c>
                  <c ca="center">
                     <p>18</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>24</p>
                  </c>
                  <c ca="center">
                     <p>73</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>25</p>
                  </c>
                  <c ca="center">
                     <p>56</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>therapy related</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>26</p>
                  </c>
                  <c ca="center">
                     <p>53</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>27</p>
                  </c>
                  <c ca="center">
                     <p>64</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M0</p>
                  </c>
                  <c ca="center">
                     <p>MDS</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>28</p>
                  </c>
                  <c ca="center">
                     <p>63</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M5a</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>861_864<it>ins</it>CTGC</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>29</p>
                  </c>
                  <c ca="center">
                     <p>71</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M5b</p>
                  </c>
                  <c ca="center">
                     <p>MDS transformed</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1754_1789<it>dup</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>30</p>
                  </c>
                  <c ca="center">
                     <p>89</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M6</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>31</p>
                  </c>
                  <c ca="center">
                     <p>28</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>32</p>
                  </c>
                  <c ca="center">
                     <p>69</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>basophilic leukemia</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>33</p>
                  </c>
                  <c ca="center">
                     <p>36</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M5b</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1783_1812<it>dup</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>34</p>
                  </c>
                  <c ca="center">
                     <p>54</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>35</p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>36</p>
                  </c>
                  <c ca="center">
                     <p>82</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1786G>C 1787_1818<it>dup</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>37</p>
                  </c>
                  <c ca="center">
                     <p>68</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M5b</p>
                  </c>
                  <c ca="center">
                     <p>CMML</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>38</p>
                  </c>
                  <c ca="center">
                     <p>61</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>39</p>
                  </c>
                  <c ca="center">
                     <p>49</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>ins ? bp &#182;|</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>40</p>
                  </c>
                  <c ca="center">
                     <p>83</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>860_863<it>dup</it>TCTG</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>41</p>
                  </c>
                  <c ca="center">
                     <p>72</p>
                  </c>
                  <c ca="center">
                     <p>F</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>CMML</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>57</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M4</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>43</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Aberrant</p>
                  </c>
                  <c ca="center">
                     <p>1741_1831<it>dup </it>1832_1842<it>ins</it></p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>44</p>
                  </c>
                  <c ca="center">
                     <p>49</p>
                  </c>
                  <c ca="center">
                     <p>M</p>
                  </c>
                  <c ca="center">
                     <p>M6</p>
                  </c>
                  <c ca="center">
                     <p>Nil</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
                  <c ca="center">
                     <p>Normal</p>
                  </c>
                  <c ca="center">
                     <p>Neg</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>&#8224; MDS = myelodysplastic syndrome; RAEB-T = refractory anemia with excess of blasts in transformation; CMML = chronic myelomonocytic leukemia; Ca prostate = prostate cancer; NHL = Non-Hodgkin lymphoma.</p>
               <p>&#8225;Normal = normal melt profile, Aberrant = abnormal melt profile.</p>
               <p>&#167;Neg = no mutation detected in the sequence; numbering according to <it>NPM1 </it>reference sequence NM_002520.5</p>
               <p>| Numbering according to <it>FLT3 </it>reference sequence NM_004119.2 (5'UTR not included)</p>
               <p>&#182; The size of the internal tandem duplication could not be determined due to the low levels of mutant peaks in the sequence,</p>
            </tblfn>
         </tbl>
         <p>The incidence of <it>NPM1 </it>mutations in the <it>de novo </it>AML cases was 40% (12/29), consistent with the incidence reported in previous studies <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Interestingly, 3/15 of the secondary AML cases were <it>NPM1 </it>mutation positive which contrasts with an earlier study, where cytoplasmic localisation of NPM indicative of <it>NPM1 </it>mutations was not seen in 135 secondary AML samples by IHC <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>.</p>
         <p>A novel point mutation Y572C in exon 14 of <it>FLT3 </it>was also detected. This tyrosine residue within the juxtamembrane domain of <it>FLT3 </it>has been shown to be phosphorylated <it>in vivo </it><abbrgrp><abbr bid="B14">14</abbr></abbrgrp> and could be included in the newly described class of <it>FLT3 </it>juxtamembrane domain point mutations for which the similar mutation Y591C has been reported <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. This illustrates the power of HRM to detect novel as well known mutations. The use of HRM to screen for <it>FLT3</it>-ITD has been previously reported <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>HRM is rapidly becoming the most important mutation scanning methodology. It is an in-tube method, meaning that PCR amplification and subsequent analysis are sequentially performed in the one tube or well. This makes it more convenient than other scanning methodologies such as denaturing high-performance liquid chromatography <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. We used a real-time PCR machine with HRM capability rather than a stand-alone HRM instrument. This facilitates quality control as the success of the amplification can be assessed on the same platform as the melting analysis.</p>
         <p>HRM has no real disadvantages in mutation scanning except that extra care needs to be taken in designing PCR reactions to avoid primer dimers and non-specific amplification. Secondly, DNA needs to be prepared in a uniform fashion to avoid variation in salt concentration that will affect the melting. In addition, the exact nature of any mutation cannot be determined without sequencing. Nevertheless, performing HRM as an initial screen for potential mutations significantly reduces the volume of samples requiring sequencing with consequent reduction of cost and labour, and improvements to turn around time.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>HRM is likely to play a major role in clinical applications as it enables rapid detection of defined and novel molecular changes in clinical samples. In this study, the conditions have been optimised to enable screening of normal karyotype AML patients for both <it>NPM1 </it>and <it>FLT3</it>-ITD in the same run. This has enhanced patient prognostication and clinical decision making regarding therapeutic approaches. The assays are suitable both for individual patient diagnosis and for large scale clinical trials.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Patients and samples</p>
            </st>
            <p>DNA was extracted from archival bone marrow smears from 44 NK-AML patients from 1999&#8211;2007 sent to the Pathology Department of The Peter MacCallum Cancer Centre. Normal peripheral blood samples were obtained from 11 healthy volunteers. All samples were collected and were obtained in accordance with the Peter MacCallum Cancer Centre Ethics of Human Research guidelines. DNA was extracted from bone marrow smears using a standard phenol/chloroform extraction technique. DNA was extracted from peripheral blood using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI).</p>
         </sec>
         <sec>
            <st>
               <p>High resolution melting analysis</p>
            </st>
            <p>The PCR and melting analysis for <it>NPM1 </it>and <it>FLT3 </it>mutations were all performed on the LightCycler 480 (Roche Diagnostics, Penzberg, Germany) a real-time PCR machine with HRM capability and a 96/384 well capacity. All samples were tested in duplicate. At least 5 different normal controls for each gene were included in each run. Approximately 10 ng of DNA was amplified in a total volume of 10 &#956;L containing 400 nM each of the relevant forward and reverse primer (NPMex12F-TGATGTCTATGAAGTGTTGTGGTTCC, NPMex12R-CTCTGC ATTATAAAAAGGACAGCCAG; or <it>FLT3</it>ex14F-TGCAGAACTGCCTATT CCTAACTGA; <it>FLT3</it>ex14R-TTCCATAAGCTGTTGCGTTCATCAC, 4 mM (<it>NPM1</it>) or 3 mM (<it>FLT3</it>) MgCl<sub>2</sub>, and LightCycler 480 High-Resolution Melting Master (Roche Diagnostics). The cycling conditions were the same for both amplicons allowing them to be performed in the one run. The conditions were 95&#176;C (10 min) and a touch down of 10 cycles of 95&#176;C (10 sec), 65&#176;C&#8211;55&#176;C (10 sec, 1&#176;C/step), 72&#176;C (30 sec) and a further 45 cycles. The melting program was 95&#176;C (1 min) 45&#176;C (1 min), then 65&#176;C&#8211;95&#176;C (5 sec, 1&#176;C/sec). Thirty acquisitions were collected per &#176;C. Upon completion of the run (approximately 2 hours), analysis was performed using the software supplied with the LightCycler 480. The melting curves were normalised and temperature shifted to allow samples to be directly compared. Difference plots were generated by selecting a negative control as the baseline and the fluorescence of all other samples was plotted relative to this sample. Significant differences in fluorescence were indicative of mutations.</p>
         </sec>
         <sec>
            <st>
               <p>Sequencing</p>
            </st>
            <p>Sequencing was performed on all samples. Approximately 10 ng of DNA was amplified in a total volume of 25 &#956;L containing 200 nM each of M13 tagged primers, 2 mM MgCl<sub>2</sub>, 200 &#956;M each dNTPs, 0.5 units FastStart Taq (Roche Diagnostics) and 1&#215; Buffer. The primers used were the same as stated above except that the M13 sequences 5' TGTAAAACGACGGCCAGT and 5' CAGGAAACAGCTATGACC were tagged to the forward and reverse primers respectively. The cycling conditions were 95&#176;C (10 min) and 45 cycles of 94&#176;C (30 sec), 64&#176;C (30 sec), 72&#176;C (30 sec) and 72&#176;C for 10 min. The products were checked on a 2% ethidium bromide stained agarose gel before sequencing.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>Alex Dobrovic has received honoraria from Roche Diagnostics for speaking about HRM.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>AYCT wrote the paper and performed the experiments, AD developed the assay with AYCT, co-wrote the paper and revised the paper in accordance with the reviewers' comments, DAW, DC, and JFS initiated the project, provided the specimens and assisted with writing, SJ provided specimens and performed the immunohistochemical analysis. All authors read and approved the final manuscript.</p>
      </sec>
      <sec>
         <st>
            <p>Note added in proof</p>
         </st>
         <p>After this manuscript was submitted, another report of <it>NPM1 </it>mutations in secondary AML has appeared <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported in part by a grant from Novartis Pharmaceuticals. Michelle McBean from the Diagnostic Molecular Pathology Lab, Peter MacCallum Cancer Centre extracted the DNA samples. Lee Ping Chew provided the clinical information. Prof. Bruno Falini kindly donated the anti-NPM antibody (clone 376) for immunohistochemical analysis. We also thank Michael Krypuy and Chelsee Hewitt for critical reading of this manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Clinical importance of cytogenetics in acute myeloid leukaemia</p>
            </title>
            <aug>
               <au>
                  <snm>Mrozek</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Heinonen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bloomfield</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>Best Pract Res Clin Haematol</source>
            <pubdate>2001</pubdate>
            <volume>14</volume>
            <fpage>19</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/beha.2000.0114</pubid>
                  <pubid idtype="pmpid">11355922</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Outcome of induction and postremission therapy in younger adults with acute myeloid leukemia with normal karyotype: a cancer and leukemia group B study</p>
            </title>
            <aug>
               <au>
                  <snm>Farag</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Ruppert</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Mrozek</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mayer</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Stone</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Carroll</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Powell</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>JO</fnm>
               </au>
               <au>
                  <snm>Pettenati</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Koduru</snm>
                  <fnm>PR</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Clin Oncol</source>
            <pubdate>2005</pubdate>
            <volume>23</volume>
            <fpage>482</fpage>
            <lpage>493</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1200/JCO.2005.06.090</pubid>
                  <pubid idtype="pmpid" link="fulltext">15534356</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Clinical outcome of de novo acute myeloid leukaemia patients with normal cytogenetics is affected by molecular genetic alterations: a concise review</p>
            </title>
            <aug>
               <au>
                  <snm>Baldus</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Mrozek</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Marcucci</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Bloomfield</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>Br J Haematol</source>
            <pubdate>2007</pubdate>
            <volume>137</volume>
            <fpage>387</fpage>
            <lpage>400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2141.2007.06566.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17488484</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype</p>
            </title>
            <aug>
               <au>
                  <snm>Falini</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mecucci</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tiacci</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Alcalay</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rosati</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pasqualucci</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>La Starza</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Diverio</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Colombo</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Santucci</snm>
                  <fnm>A</fnm>
               </au>
               <etal/>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>2005</pubdate>
            <volume>352</volume>
            <fpage>254</fpage>
            <lpage>266</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJMoa041974</pubid>
                  <pubid idtype="pmpid" link="fulltext">15659725</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype</p>
            </title>
            <aug>
               <au>
                  <snm>Boissel</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Renneville</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Biggio</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Philippe</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Cayuela</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Terre</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tigaud</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Castaigne</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Raffoux</snm>
                  <fnm>E</fnm>
               </au>
               <etal/>
            </aug>
            <source>Blood</source>
            <pubdate>2005</pubdate>
            <volume>106</volume>
            <fpage>3618</fpage>
            <lpage>3620</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-05-2174</pubid>
                  <pubid idtype="pmpid" link="fulltext">16046528</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Dohner</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Schlenk</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Habdank</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Scholl</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rucker</snm>
                  <fnm>FG</fnm>
               </au>
               <au>
                  <snm>Corbacioglu</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bullinger</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Frohling</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dohner</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2005</pubdate>
            <volume>106</volume>
            <fpage>3740</fpage>
            <lpage>3746</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-05-2164</pubid>
                  <pubid idtype="pmpid" link="fulltext">16051734</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype</p>
            </title>
            <aug>
               <au>
                  <snm>Schnittger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schoch</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kern</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Mecucci</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tschulik</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Martelli</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Haferlach</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hiddemann</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Falini</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2005</pubdate>
            <volume>106</volume>
            <fpage>3733</fpage>
            <lpage>3739</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-06-2248</pubid>
                  <pubid idtype="pmpid" link="fulltext">16076867</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia</p>
            </title>
            <aug>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kiyoi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ozeki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yamaji</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kodera</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Miyawaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Asou</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kuriyama</snm>
                  <fnm>K</fnm>
               </au>
               <etal/>
            </aug>
            <source>Blood</source>
            <pubdate>2005</pubdate>
            <volume>106</volume>
            <fpage>2854</fpage>
            <lpage>2861</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-04-1733</pubid>
                  <pubid idtype="pmpid" link="fulltext">15994285</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance</p>
            </title>
            <aug>
               <au>
                  <snm>Verhaak</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Goudswaard</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>van Putten</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bijl</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Sanders</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Hugens</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Uitterlinden</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Erpelinck</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Delwel</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lowenberg</snm>
                  <fnm>B</fnm>
               </au>
               <etal/>
            </aug>
            <source>Blood</source>
            <pubdate>2005</pubdate>
            <volume>106</volume>
            <fpage>3747</fpage>
            <lpage>3754</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-05-2168</pubid>
                  <pubid idtype="pmpid" link="fulltext">16109776</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML)</p>
            </title>
            <aug>
               <au>
                  <snm>Thiede</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Creutzig</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Steudel</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Illmer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Schaich</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ehninger</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2006</pubdate>
            <volume>107</volume>
            <fpage>4011</fpage>
            <lpage>4020</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-08-3167</pubid>
                  <pubid idtype="pmpid" link="fulltext">16455956</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>High-resolution genotyping by amplicon melting analysis using LCGreen</p>
            </title>
            <aug>
               <au>
                  <snm>Wittwer</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Reed</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Gundry</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Vandersteen</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Pryor</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Clin Chem</source>
            <pubdate>2003</pubdate>
            <volume>49</volume>
            <issue>6 Pt 1</issue>
            <fpage>853</fpage>
            <lpage>860</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1373/49.6.853</pubid>
                  <pubid idtype="pmpid" link="fulltext">12765979</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Internal tandem duplication of the flt3 gene found in acute myeloid leukemia</p>
            </title>
            <aug>
               <au>
                  <snm>Nakao</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yokota</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Iwai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kaneko</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Horiike</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kashima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sonoda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Fujimoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Misawa</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Leukemia</source>
            <pubdate>1996</pubdate>
            <volume>10</volume>
            <fpage>1911</fpage>
            <lpage>1918</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8946930</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>FLT3 internal tandem duplication mutations in adult acute myeloid leukaemia define a high-risk group</p>
            </title>
            <aug>
               <au>
                  <snm>Abu-Duhier</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Goodeve</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Gari</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Peake</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Rees</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Vandenberghe</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Winship</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Reilly</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <source>Br J Haematol</source>
            <pubdate>2000</pubdate>
            <volume>111</volume>
            <fpage>190</fpage>
            <lpage>195</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2141.2000.02317.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11091200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Identification of Y589 and Y599 in the juxtamembrane domain of Flt3 as ligand-induced autophosphorylation sites involved in binding of Src family kinases and the protein tyrosine phosphatase SHP2</p>
            </title>
            <aug>
               <au>
                  <snm>Heiss</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Masson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sundberg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pedersen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bengtsson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ronnstrand</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2006</pubdate>
            <volume>108</volume>
            <fpage>1542</fpage>
            <lpage>1550</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-07-008896</pubid>
                  <pubid idtype="pmpid" link="fulltext">16684964</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Point mutations in the juxtamembrane domain of FLT3 define a new class of activating mutations in AML</p>
            </title>
            <aug>
               <au>
                  <snm>Reindl</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bagrintseva</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Vempati</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schnittger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ellwart</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Wenig</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hopfner</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Hiddemann</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Spiekermann</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2006</pubdate>
            <volume>107</volume>
            <fpage>3700</fpage>
            <lpage>3707</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2005-06-2596</pubid>
                  <pubid idtype="pmpid" link="fulltext">16410449</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>High-resolution melting analysis for detection of internal tandem duplications</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughn</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Elenitoba-Johnson</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>J Mol Diagn</source>
            <pubdate>2004</pubdate>
            <volume>6</volume>
            <fpage>211</fpage>
            <lpage>216</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1867640</pubid>
                  <pubid idtype="pmpid" link="fulltext">15269297</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Denaturing high-performance liquid chromatography: a valid approach for identifying NPM1 mutations in acute myeloid leukemia</p>
            </title>
            <aug>
               <au>
                  <snm>Roti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Rosati</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Bonasso</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gorello</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Diverio</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martelli</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Falini</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mecucci</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Mol Diagn</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <fpage>254</fpage>
            <lpage>259</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1867590</pubid>
                  <pubid idtype="pmpid" link="fulltext">16645213</pubid>
                  <pubid idtype="doi">10.2353/jmoldx.2006.050098</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features</p>
            </title>
            <aug>
               <au>
                  <snm>Andersen</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Andersen</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Christiansen</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Pedersen-Bjergaard</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Leukemia</source>
            <pubdate>2008</pubdate>
            <volume>22</volume>
            <fpage>951</fpage>
            <lpage>955</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/leu.2008.17</pubid>
                  <pubid idtype="pmpid" link="fulltext">18273044</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
