<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1756-0500-2-52</ui>
   <ji>1756-0500</ji>
   <fm>
      <dochead>Short Report</dochead>
      <bibl>
         <title>
            <p>Nucleotide-binding oligomerization domain containing 1 (<it>NOD1</it>) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Huebner</snm>
               <fnm>Claudia</fnm>
               <insr iid="I1"/>
               <insr iid="I7"/>
               <email>c.huebner@auckland.ac.nz</email>
            </au>
            <au ca="yes" id="A2">
               <snm>Ferguson</snm>
               <mi>R</mi>
               <fnm>Lynnette</fnm>
               <insr iid="I1"/>
               <insr iid="I7"/>
               <email>l.ferguson@auckland.ac.nz</email>
            </au>
            <au id="A3">
               <snm>Han</snm>
               <mnm>Yeo</mnm>
               <fnm>Dug</fnm>
               <insr iid="I1"/>
               <insr iid="I7"/>
               <email>dy.han@auckland.ac.nz</email>
            </au>
            <au id="A4">
               <snm>Philpott</snm>
               <fnm>Martin</fnm>
               <insr iid="I1"/>
               <insr iid="I7"/>
               <email>m.philpott@auckland.ac.nz</email>
            </au>
            <au id="A5">
               <snm>Barclay</snm>
               <mi>L</mi>
               <fnm>Murray</fnm>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>Murray.Barclay@cdhb.govt.nz</email>
            </au>
            <au id="A6">
               <snm>Gearry</snm>
               <mi>B</mi>
               <fnm>Richard</fnm>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>richard.gearry@cdhb.govt.nz</email>
            </au>
            <au id="A7">
               <snm>McCulloch</snm>
               <fnm>Alan</fnm>
               <insr iid="I4"/>
               <insr iid="I7"/>
               <email>alan.mcculloch@agresearch.co.nz</email>
            </au>
            <au id="A8">
               <snm>Demmers</snm>
               <mi>S</mi>
               <fnm>Pieter</fnm>
               <insr iid="I5"/>
               <insr iid="I7"/>
               <email>DemmersP@crop.cri.nz</email>
            </au>
            <au id="A9">
               <snm>Browning</snm>
               <mi>L</mi>
               <fnm>Brian</fnm>
               <insr iid="I6"/>
               <email>b.browning@auckland.ac.nz</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Discipline of Nutrition, The University of Auckland, Private Bag 92019, Auckland 1023, New Zealand</p>
            </ins>
            <ins id="I2">
               <p>Department of Gastroenterology, Christchurch Hospital, Christchurch 8011, New Zealand</p>
            </ins>
            <ins id="I3">
               <p>Department of Medicine, University of Otago, Christchurch, New Zealand</p>
            </ins>
            <ins id="I4">
               <p>Information Services, Plant and Food Research, Mosgiel 9053, New Zealand</p>
            </ins>
            <ins id="I5">
               <p>Information Services, AgResearch Limited, Mosgiel 9053, New Zealand</p>
            </ins>
            <ins id="I6">
               <p>Department of Statistics, The University of Auckland, Private Bag 92019, Auckland 1023, New Zealand</p>
            </ins>
            <ins id="I7">
               <p>Nutrigenomics, Web, New Zealand</p>
            </ins>
         </insg>
         <source>BMC Research Notes</source>
         <issn>1756-0500</issn>
         <pubdate>2009</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>52</fpage>
         <url>http://www.biomedcentral.com/1756-0500/2/52</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19327158</pubid>
               <pubid idtype="doi">10.1186/1756-0500-2-52</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>20</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>27</day>
               <month>3</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>27</day>
               <month>3</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Ferguson et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The nucleotide-binding oligomerization domain containing 1 (<it>NOD1</it>) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of <it>NOD1 </it>single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line.</p>
            </sec>
            <sec>
               <st>
                  <p>Findings</p>
               </st>
               <p>DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in <it>NOD1</it>, using the MassARRAY<sup>&#174; </sup>iPLEX Gold assay. Transcriptional activation of the protein produced by <it>NOD1 </it>(Nod1) was studied after infection of Caco2 cells with <it>Escherichia coli </it>LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50&#8211;0.88, p &lt; 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The <it>NOD1 </it>gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Pathogens are sensed by pattern recognition receptors (PRRs), including cytosolic nucleotide oligomerisation domain (Nod) proteins, resulting in downstream responses involving the activation of transcription factors and the induction of apoptosis genes. Intestinal epithelial cells are among several cell types that express such proteins, including Nod1 and Nod 2 <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
         <p>Since initial publications claiming that single nucleotide polymorphisms (SNPs) in <it>NOD2 </it>provide a major risk factor for CD <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>, there have been many reports of other susceptibility alleles <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Nod2 recognizes a range of bacteria through a cell wall peptidoglycan. However, the related Nod1 may be even more important, since it senses a wider range of pathogens. In epithelial cells, Nod1 appears to be indispensable for sensing of intracellular gram-negative bacteria <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
         <p>The <it>NOD</it>1 gene (MIM# 605980) is located on chromosome 7p14.3. An initial study reported no relationship between SNPs in <it>NOD1 </it>and risk of IBD in European patients <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. However, McGovern and co-workers <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> pointed out that the SNP tested was a rare variant, and that the risk of complex diseases is associated with regulatory mutations that occur commonly in a population. These authors reported an association between a complex insertion/deletion polymorphism in <it>NOD1 </it>and susceptibility to CD in a European population. However, although Canto et al, <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> found similar results in their Spanish subjects, several other studies have failed to replicate this finding in other European populations <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>. Although the main focus of the original McGovern et al., <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> paper was on the complex deletion, associations were also observed between IBD and several other SNPs, including <it>NOD1 </it>c.156C>G (P &lt; 0.02) and g27606C>T, (P &lt; 0.05). They also reported an association with haplotypes containing g.45343G>A.</p>
         <p>SNPs in the genes for three different pattern recognition receptors (<it>NOD2</it>, <it>DLG5</it> and <it>TLR4</it>) have been previously associated with CD in the New Zealand population <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Here we consider the implications of three different <it>NOD1 </it>SNPs for their effects on IBD susceptibility in a Caucasian population from the Canterbury region of New Zealand. We also consider the functional role of Nod1 in relation to invasion of the gastrointestinal colon cell line, Caco2 by the CD-associated bacterium, <it>Escherichia coli </it>LF82 <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Case control study</p>
            </st>
            <p>Clinical and demographic characteristics of the IBD cohort are given in Table <tblr tid="T1">1</tblr>. The SNPs selected for analysis were: c.156C>G (rs2075818; synonymous SNP), g.27606T>C (rs2075822; intronic SNP), and g.45343G>A (rs2907748; intronic SNP) (Table <tblr tid="T2">2</tblr>; <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p><it>NOD1 </it>polymorphisms tested in the Canterbury population</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>rs Number</p>
                     </c>
                     <c ca="left">
                        <p>Location</p>
                     </c>
                     <c ca="left">
                        <p>Nucleotide change<sup>a</sup></p>
                     </c>
                     <c ca="left">
                        <p>Protein domain</p>
                     </c>
                     <c ca="left">
                        <p>Frequency<sup>b</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs2075818</p>
                     </c>
                     <c ca="left">
                        <p>Exon 4</p>
                     </c>
                     <c ca="left">
                        <p>c.156C>G</p>
                     </c>
                     <c ca="left">
                        <p>CARD</p>
                     </c>
                     <c ca="left">
                        <p>0.869 (n = 214)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>g.21984C>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs2075822</p>
                     </c>
                     <c ca="left">
                        <p>Intron 6</p>
                     </c>
                     <c ca="left">
                        <p>g.27606T>C</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>0.706 (n = 92)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs2907748</p>
                     </c>
                     <c ca="left">
                        <p>Intron 11</p>
                     </c>
                     <c ca="left">
                        <p>g.45343G>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>0.735 (n = 200)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>a. The position is numbered from the first nucleotide of exon 1. The sequence is obtained from dbSNP <url>http://www.ncbi.nlm.nih.gov/SNP/</url>.</p>
                  <p>b. Frequency of major SNPs in a European population as a mean for European samples submitted to dbSNP <url>http://www.ncbi.nlm.nih.gov/SNP/</url>.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Summary of clinical and demographic data for the set of Caucasian IBD patients</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CD</p>
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>UC</p>
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>IC</p>
                        <p>n (%)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gender</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Female</p>
                     </c>
                     <c ca="center">
                        <p>249 (64.2)</p>
                     </c>
                     <c ca="center">
                        <p>214 (52.8)</p>
                     </c>
                     <c ca="center">
                        <p>15 (55.6)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Male</p>
                     </c>
                     <c ca="center">
                        <p>139 (35.8)</p>
                     </c>
                     <c ca="center">
                        <p>191 (47.2)</p>
                     </c>
                     <c ca="center">
                        <p>12 (44.4)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Age at first diagnosis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Below 17</p>
                     </c>
                     <c ca="center">
                        <p>39 (10.0)</p>
                     </c>
                     <c ca="center">
                        <p>26 (6.4)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Between 17 and 40</p>
                     </c>
                     <c ca="center">
                        <p>199 (51.3)</p>
                     </c>
                     <c ca="center">
                        <p>184 (45.4)</p>
                     </c>
                     <c ca="center">
                        <p>15 (55.6)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Above 40</p>
                     </c>
                     <c ca="center">
                        <p>150 (38.7)</p>
                     </c>
                     <c ca="center">
                        <p>195 (48.2)</p>
                     </c>
                     <c ca="center">
                        <p>12 (44.4)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CD location</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Ileal</p>
                     </c>
                     <c ca="center">
                        <p>125 (32.2)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Colonic</p>
                     </c>
                     <c ca="center">
                        <p>169 (43.6)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Ileocolonic</p>
                     </c>
                     <c ca="center">
                        <p>90 (23.2)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Upper GI</p>
                     </c>
                     <c ca="center">
                        <p>4 (1.0)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>UC location</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Proctitis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>140 (34.6)</p>
                     </c>
                     <c ca="center">
                        <p>3 (11.1)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Left colon</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>107 (26.4)</p>
                     </c>
                     <c ca="center">
                        <p>5 (18.5)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Pancolitis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>154 (38.0)</p>
                     </c>
                     <c ca="center">
                        <p>19 (70.4)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Unknown</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>4 (1.0)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Behaviour</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Non-stricturing, non-penetrating perianal disease</p>
                     </c>
                     <c ca="center">
                        <p>47 (21.5)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Stricturing perianal disease</p>
                     </c>
                     <c ca="center">
                        <p>46 (38.0)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Penetrating perianal disease</p>
                     </c>
                     <c ca="center">
                        <p>17 (35.4)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Any relative with IBD: Yes (n = 143)</p>
                     </c>
                     <c ca="center">
                        <p>74 (19.1)</p>
                     </c>
                     <c ca="center">
                        <p>65 (16.1)</p>
                     </c>
                     <c ca="center">
                        <p>5 (18.5)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Bowel resection: Yes (n = 214)</p>
                     </c>
                     <c ca="center">
                        <p>142 (36.6)</p>
                     </c>
                     <c ca="center">
                        <p>70 (17.3)</p>
                     </c>
                     <c ca="center">
                        <p>2 (7.4)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Smoker at diagnosis: Yes (n = 147)</p>
                     </c>
                     <c ca="center">
                        <p>97 (25.7)</p>
                     </c>
                     <c ca="center">
                        <p>49 (12.3)</p>
                     </c>
                     <c ca="center">
                        <p>2 (7.7)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ever used immunomodulators: Yes (n = 296)</p>
                     </c>
                     <c ca="center">
                        <p>203 (52.3)</p>
                     </c>
                     <c ca="center">
                        <p>86 (21.2)</p>
                     </c>
                     <c ca="center">
                        <p>8 (29.6)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Extraintestinal manifestations: Yes (n = 142)</p>
                     </c>
                     <c ca="center">
                        <p>75 (19.3)</p>
                     </c>
                     <c ca="center">
                        <p>64 (15.8)</p>
                     </c>
                     <c ca="center">
                        <p>3 (11.1)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Carrying the <it>NOD1</it> c.156C>G variant led to statistically significant changes in CD or overall IBD risk, but not UC risk. Table <tblr tid="T3">3</tblr> shows a significant difference in the major (C) allele frequencies between CD patients (81.1%) and controls (73.9%) (p = 0.004), such that those individuals carrying the C allele have an increased probability of developing CD in this population (OR = 1.51, 95% CI = 1.13&#8211;2.02, p = 0.004). CG heterozygotes have a reduced risk of CD (OR = 0.53, 95% CI = 0.37&#8211;0.75, p = 0.002), and of developing IBD as compared with CC homozygotes (OR = 0.64, 95% CI = 0.46&#8211;0.88, p = 0.01).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genotype and allele counts for <it>NOD1/CARD4 </it>variants in New Zealand IBD patients and in New Zealand Caucasians</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="right">
                        <p>SNP</p>
                     </c>
                     <c ca="center">
                        <p>Controls</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>CD</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>UC</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>CD+UC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>OR</p>
                        <p>(95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>OR</p>
                        <p>(95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>n (%)</p>
                     </c>
                     <c ca="center">
                        <p>OR</p>
                        <p>(95% CI)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>NOD1 rs2075818</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>CC</p>
                     </c>
                     <c ca="center">
                        <p>105 (52.2)</p>
                     </c>
                     <c ca="center">
                        <p>255 (66.7)</p>
                     </c>
                     <c ca="center">
                        <p>1.29</p>
                        <p>(0.56&#8211;2.98)</p>
                     </c>
                     <c ca="center">
                        <p>226 (56.5)</p>
                     </c>
                     <c ca="center">
                        <p>0.61</p>
                        <p>(0.28&#8211;1.31)</p>
                     </c>
                     <c ca="center">
                        <p>481 (61.4)</p>
                     </c>
                     <c ca="center">
                        <p>0.84</p>
                        <p>(0.40&#8211;1.77)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>CG</p>
                     </c>
                     <c ca="center">
                        <p>87 (43.3)</p>
                     </c>
                     <c ca="center">
                        <p>111 (29.0)</p>
                     </c>
                     <c ca="center">
                        <p>0.68</p>
                        <p>(0.29&#8211;1.59)</p>
                     </c>
                     <c ca="center">
                        <p>142 (35.5)</p>
                     </c>
                     <c ca="center">
                        <p>0.46</p>
                        <p>(0.21&#8211;1.01)</p>
                     </c>
                     <c ca="center">
                        <p>253 (32.3)</p>
                     </c>
                     <c ca="center">
                        <p>0.53</p>
                        <p>(0.25&#8211;1.13)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>GG</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                        <p>(4.5)</p>
                     </c>
                     <c ca="center">
                        <p>17 (4.4)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>32 (8.0)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>49 (6.3)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Genotype p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.002</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.08</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.01</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HWE p-value</p>
                     </c>
                     <c ca="center">
                        <p>0.10</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.28</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.15</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.05</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>105 (26.1)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>145 (18.9)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>206 (25.8)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>351 (22.4)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>297 (73.9)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>621 (81.1)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>594 (74.3)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>1215 (77.6)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>OR (95% CI)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.66 (0.49&#8211;0.89)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.98 (0.74&#8211;1.30)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.82 (0.63&#8211;1.06)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Allelic p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.004</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.89</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.12</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>NOD1 rs2075822</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>CC</p>
                     </c>
                     <c ca="center">
                        <p>20 (10.0)</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                        <p>(7.3)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                        <p>(4.2)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                        <p>(5.7)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>CT</p>
                     </c>
                     <c ca="center">
                        <p>60 (30.0)</p>
                     </c>
                     <c ca="center">
                        <p>122 (31.9)</p>
                     </c>
                     <c ca="center">
                        <p>1.45</p>
                        <p>(0.76&#8211;2.79)</p>
                     </c>
                     <c ca="center">
                        <p>135 (33.6)</p>
                     </c>
                     <c ca="center">
                        <p>2.65</p>
                        <p>(1.29&#8211;5.41)</p>
                     </c>
                     <c ca="center">
                        <p>257 (32.8)</p>
                     </c>
                     <c ca="center">
                        <p>1.90</p>
                        <p>(1.05&#8211;3.46)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>TT</p>
                     </c>
                     <c ca="center">
                        <p>120 (60.0)</p>
                     </c>
                     <c ca="center">
                        <p>232 (60.7)</p>
                     </c>
                     <c ca="center">
                        <p>1.38</p>
                        <p>(0.75&#8211;2.55)</p>
                     </c>
                     <c ca="center">
                        <p>250 (62.2)</p>
                     </c>
                     <c ca="center">
                        <p>2.45</p>
                        <p>(1.23&#8211;4.85)</p>
                     </c>
                     <c ca="center">
                        <p>482 (61.5)</p>
                     </c>
                     <c ca="center">
                        <p>1.79</p>
                        <p>(1.02&#8211;3.14)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Genotype p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.52</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.02</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HWE p-value</p>
                     </c>
                     <c ca="center">
                        <p>0.007</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.04</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.82</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.17</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>100 (25.0)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>178 (23.3)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>169 (21.0)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>347 (22.1)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>300 (75.0)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>586 (76.7)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>635 (79.0)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>1221 (77.9)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>OR (95% CI)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.91 (0.69&#8211;1.21)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.80 (0.60&#8211;1.06)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.85 (0.66&#8211;1.10)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Allelic p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.52</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.12</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.22</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>NOD1 rs2907748</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>AA</p>
                     </c>
                     <c ca="center">
                        <p>21 (10.3)</p>
                     </c>
                     <c ca="center">
                        <p>31</p>
                        <p>(8.2)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                        <p>(5.0)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                        <p>(6.6)</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>AG</p>
                     </c>
                     <c ca="center">
                        <p>73 (36.7)</p>
                     </c>
                     <c ca="center">
                        <p>129 (34.3)</p>
                     </c>
                     <c ca="center">
                        <p>1.20</p>
                        <p>(0.64&#8211;2.23)</p>
                     </c>
                     <c ca="center">
                        <p>161 (40.3)</p>
                     </c>
                     <c ca="center">
                        <p>2.32</p>
                        <p>(1.18&#8211;4.53)</p>
                     </c>
                     <c ca="center">
                        <p>290 (37.4)</p>
                     </c>
                     <c ca="center">
                        <p>1.64</p>
                        <p>(0.93&#8211;2.89)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>GG</p>
                     </c>
                     <c ca="center">
                        <p>105 (52.8)</p>
                     </c>
                     <c ca="center">
                        <p>216 (57.4)</p>
                     </c>
                     <c ca="center">
                        <p>1.39</p>
                        <p>(0.76&#8211;2.54)</p>
                     </c>
                     <c ca="center">
                        <p>219 (54.7)</p>
                     </c>
                     <c ca="center">
                        <p>2.19</p>
                        <p>(1.14&#8211;4.22)</p>
                     </c>
                     <c ca="center">
                        <p>435 (56.1)</p>
                     </c>
                     <c ca="center">
                        <p>1.71</p>
                        <p>(0.98&#8211;2.96)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Genotype p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.48</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.04</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HWE p-value</p>
                     </c>
                     <c ca="center">
                        <p>0.12</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.07</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.16</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.78</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>115 (28.9)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>191 (25.4)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>201 (25.1)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>392 (25.3)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>283 (71.1)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>561 (74.6)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>599 (74.9)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>1160 (74.7)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>OR (95% CI)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.84 (0.64&#8211;1.10)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.83 (0.63&#8211;1.08)</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.83 (0.65&#8211;1.06)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Allelic p-value</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.20</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.16</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>0.14</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Carrying the <it>NOD1</it> g.27606C>T variant led to statistically significant changes in the probability of developing UC, but not CD (Table <tblr tid="T3">3</tblr>). The CT heterozygote had a 2.65-fold (OR = 2.65, 95% CI = 1.29&#8211;5.41) greater risk, while TT homozygotes had a 2.45-fold (OR = 2.45, 95% CI = 1.23&#8211;4.85) greater risk of developing the disease, as compared with the risk for CC homozygotes (p = 0.02). For g.45343G>A SNP, it is the major allele that carries the increased risk. AG heterozygotes (OR = 2.32, 95% CI = 1.18&#8211;4.53) and GG homozygotes (OR = 2.19, 95% CI = 1.14&#8211;4.22) have an increased risk of developing the disease, as compared with AA homozygotes (p = 0.04). There was no significant difference in the allele frequencies between control subjects and CD, UC, or IBD patients (Table <tblr tid="T3">3</tblr>).</p>
            <p>We also report results from extensive subgroup analysis using sets of cases defined by gender, age of diagnosis, disease location, disease behaviour, need for surgery, smoking history, use of immunomodulators, and presence of family history of IBD (Table <tblr tid="T4">4</tblr>). While several of these categories showed substantially increased risks associated with different SNPs, none explained an undue proportion of the CD cases.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Allelic odds ratios and 95% confidence intervals for comparison of <it>NOD1/CARD4</it> variants with IBD status in New Zealand IBD patients and Caucasians</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center" cspan="2">
                        <p>Allelic odds ratios and 95% confidence intervals for comparison of NOD1 rs2075818</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>Allelic odds ratios and 95% confidence intervals for comparison of NOD1 rs2075822</p>
                     </c>
                     <c ca="center" cspan="2">
                        <p>Allelic odds ratios and 95% confidence intervals for comparison of NOD1 rs2907748</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CD</p>
                     </c>
                     <c ca="center">
                        <p>UC</p>
                     </c>
                     <c ca="center">
                        <p>CD</p>
                     </c>
                     <c ca="center">
                        <p>UC</p>
                     </c>
                     <c ca="center">
                        <p>CD</p>
                     </c>
                     <c ca="center">
                        <p>UC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="center">
                        <p>OR (95% CI)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Female</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.66 (0.46&#8211;0.96)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.94 (0.65&#8211;1.36)</p>
                     </c>
                     <c ca="center">
                        <p>1.14 (0.79&#8211;1.64)</p>
                     </c>
                     <c ca="center">
                        <p>1.18 (0.81&#8211;1.71)</p>
                     </c>
                     <c ca="center">
                        <p>0.94 (0.66&#8211;1.34)</p>
                     </c>
                     <c ca="center">
                        <p>0.87 (0.60&#8211;1.25)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Male</p>
                     </c>
                     <c ca="center">
                        <p>0.66 (0.42&#8211;1.04)</p>
                     </c>
                     <c ca="center">
                        <p>1.02 (0.68&#8211;1.54)</p>
                     </c>
                     <c ca="center">
                        <p>1.03 (0.66&#8211;1.61)</p>
                     </c>
                     <c ca="center">
                        <p>1.33 (0.86&#8211;2.05)</p>
                     </c>
                     <c ca="center">
                        <p>0.71 (0.46&#8211;1.09)</p>
                     </c>
                     <c ca="center">
                        <p>0.76 (0.51&#8211;1.13)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Age at first diagnosis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>0&#8211;16 years</p>
                     </c>
                     <c ca="center">
                        <p>0.62 (0.33&#8211;1.15)</p>
                     </c>
                     <c ca="center">
                        <p>0.94 (0.48&#8211;1.83)</p>
                     </c>
                     <c ca="center">
                        <p>0.75 (0.44&#8211;1.28)</p>
                     </c>
                     <c ca="center">
                        <p>1.11 (0.56&#8211;2.20)</p>
                     </c>
                     <c ca="center">
                        <p>1.11 (0.65&#8211;1.90)</p>
                     </c>
                     <c ca="center">
                        <p>1.20 (0.65&#8211;2.23)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>17&#8211;40 years</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.67 (0.48&#8211;0.94)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91 (0.66&#8211;1.26)</p>
                     </c>
                     <c ca="center">
                        <p>1.03 (0.75&#8211;1.42)</p>
                     </c>
                     <c ca="center">
                        <p>1.17 (0.84&#8211;1.64)</p>
                     </c>
                     <c ca="center">
                        <p>0.88 (0.64&#8211;1.20)</p>
                     </c>
                     <c ca="center">
                        <p>0.83 (0.60&#8211;1.14)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>>40 years</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.66 (0.46&#8211;0.95)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.06 (0.77&#8211;1.45)</p>
                     </c>
                     <c ca="center">
                        <p>1.36 (0.94&#8211;1.96)</p>
                     </c>
                     <c ca="center">
                        <p>1.36 (0.97&#8211;1.91)</p>
                     </c>
                     <c ca="center">
                        <p>0.72 (0.51&#8211;1.02)</p>
                     </c>
                     <c ca="center">
                        <p>0.78 (0.57&#8211;1.07)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CD location</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Ileal</p>
                     </c>
                     <c ca="center">
                        <p>0.82 (0.56&#8211;1.19)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.15 (0.79&#8211;1.67)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.71 (0.49&#8211;1.03)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Colonic</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.59 (0.41&#8211;0.85)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.22 (0.86&#8211;1.72)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.80 (0.57&#8211;1.11)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Ileocolonic</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.60 (0.38&#8211;0.94)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.89 (0.60&#8211;1.33)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.03 (0.69&#8211;1.53)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>UC location</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Proctitis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.94 (0.67&#8211;1.32)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.05 (0.74&#8211;1.49)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.04 (0.75&#8211;1.44)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Left colon</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.14 (0.79&#8211;1.65)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.43 (0.95&#8211;2.16)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.85 (0.58&#8211;1.24)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Pancolitis</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.92 (0.65&#8211;1.31)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.40 (0.96&#8211;2.03)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p><b>0.58 (0.40&#8211;0.84</b>)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CD Behavior</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Inflammatory</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.59 (0.42&#8211;0.82)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.10 (0.80&#8211;1.51)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.87 (0.64&#8211;1.18)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Stricturing</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.67 (0.45&#8211;0.99)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.23 (0.84&#8211;1.81)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p><b>0.67 (0.46&#8211;0.98</b>)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Penetrating</p>
                     </c>
                     <c ca="center">
                        <p>1.00 (0.60&#8211;1.66)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.85 (0.52&#8211;1.40)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.15 (0.71&#8211;1.87)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Ileal/Stricturing</p>
                     </c>
                     <c ca="center">
                        <p>0.71 (0.45&#8211;1.13)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.44 (0.89&#8211;2.32)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p><b>0.48 (0.29&#8211;(0.79</b>)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>Colonic/Inflammatory</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.61 (0.42&#8211;0.89)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1.20 (0.84&#8211;1.72)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.82 (0.58&#8211;1.16)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Any relative with IBD</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.43 (0.25&#8211;0.73)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.72 (0.44&#8211;1.17)</p>
                     </c>
                     <c ca="center">
                        <p>1.06 (0.68&#8211;1.66)</p>
                     </c>
                     <c ca="center">
                        <p>1.37 (0.84&#8211;2.24)</p>
                     </c>
                     <c ca="center">
                        <p>0.79 (0.51&#8211;1.22)</p>
                     </c>
                     <c ca="center">
                        <p><b>0.57 (0.35&#8211;0.93</b>)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Bowel resection</p>
                     </c>
                     <c ca="center">
                        <p>0.75 (0.52&#8211;1.08)</p>
                     </c>
                     <c ca="center">
                        <p>0.91 (0.58&#8211;1.43)</p>
                     </c>
                     <c ca="center">
                        <p>1.10 (0.77&#8211;1.58)</p>
                     </c>
                     <c ca="center">
                        <p>0.88 (0.57&#8211;1.36)</p>
                     </c>
                     <c ca="center">
                        <p>0.72 (0.50&#8211;1.03)</p>
                     </c>
                     <c ca="center">
                        <p>1.28 (0.85&#8211;1.93)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Smoker at diagnosis</p>
                     </c>
                     <c ca="center">
                        <p>0.84 (0.56&#8211;1.26)</p>
                     </c>
                     <c ca="center">
                        <p>1.16 (0.71&#8211;1.90)</p>
                     </c>
                     <c ca="center">
                        <p>1.40 (0.92&#8211;2.14)</p>
                     </c>
                     <c ca="center">
                        <p>1.09 (0.65&#8211;1.83)</p>
                     </c>
                     <c ca="center">
                        <p>0.69 (0.46&#8211;1.03)</p>
                     </c>
                     <c ca="center">
                        <p>0.75 (0.45&#8211;1.26)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ever used immunomodulators</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.70 (0.50&#8211;0.98)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.90 (0.59&#8211;1.36)</p>
                     </c>
                     <c ca="center">
                        <p>1.18 (0.85&#8211;1.64)</p>
                     </c>
                     <c ca="center">
                        <p>1.10 (0.72&#8211;1.67)</p>
                     </c>
                     <c ca="center">
                        <p>0.81 (0.59&#8211;1.11)</p>
                     </c>
                     <c ca="center">
                        <p>0.94 (0.63&#8211;1.40)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Any EIMs</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>0.60 (0.37&#8211;0.97)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.77 (0.48&#8211;1.24)</p>
                     </c>
                     <c ca="center">
                        <p>1.08 (0.69&#8211;1.68)</p>
                     </c>
                     <c ca="center">
                        <p>1.25 (0.77&#8211;2.02)</p>
                     </c>
                     <c ca="center">
                        <p>0.93 (0.61&#8211;1.42)</p>
                     </c>
                     <c ca="center">
                        <p>0.80 (0.51&#8211;1.27)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Table <tblr tid="T5">5</tblr> summarises haplotype analysis. A positive hap-score implies that the haplotype occurs more frequently in the CD or UC case group. A global p-value tests the overall association between haplotypes and the response.</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Haplotype analysis of three-SNP <it>NOD1</it> haplotype in IBD patients and Caucasians in a New Zealand population.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Haplotype</p>
                     </c>
                     <c ca="left">
                        <p>Case subject frequency (%)</p>
                     </c>
                     <c ca="left">
                        <p>Control subject frequency (%)</p>
                     </c>
                     <c ca="left">
                        <p>p-value</p>
                     </c>
                     <c ca="left">
                        <p>OR (95% CI)</p>
                     </c>
                     <c ca="left">
                        <p>Global score statistics</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CD</p>
                     </c>
                     <c ca="left">
                        <p>Three SNPs NOD1gregion</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>(rs2075818, rs2075822, rs2907748)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CCA</p>
                     </c>
                     <c ca="left">
                        <p>20.6</p>
                     </c>
                     <c ca="left">
                        <p>22.2</p>
                     </c>
                     <c ca="left">
                        <p>0.53</p>
                     </c>
                     <c ca="left">
                        <p>0.90 (0.67&#8211;1.21)</p>
                     </c>
                     <c ca="left">
                        <p>&#967;<sup>2 </sup>= 9.55,</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>CTG</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>55.8</p>
                     </c>
                     <c ca="left">
                        <p>46.9</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>0.004</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>1.44 (1.12&#8211;1.85)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>df = 3,</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GTA</p>
                     </c>
                     <c ca="left">
                        <p>3.3</p>
                     </c>
                     <c ca="left">
                        <p>4.2</p>
                     </c>
                     <c ca="left">
                        <p>0.25</p>
                     </c>
                     <c ca="left">
                        <p>0.77 (0.41&#8211;1.45)</p>
                     </c>
                     <c ca="left">
                        <p>p = 0.02</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GTG</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>16.0</p>
                     </c>
                     <c ca="left">
                        <p>21.7</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>0.02</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>0.68 (0.50&#8211;0.92)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>UC</p>
                     </c>
                     <c ca="left">
                        <p>Three SNPs NOD1gregion</p>
                        <p>(rs2075818, rs2075822, rs2907748)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CCA</p>
                     </c>
                     <c ca="left">
                        <p>19.5</p>
                     </c>
                     <c ca="left">
                        <p>22.2</p>
                     </c>
                     <c ca="left">
                        <p>0.23</p>
                     </c>
                     <c ca="left">
                        <p>0.83 (0.62&#8211;1.11)</p>
                     </c>
                     <c ca="left">
                        <p>&#967;<sup>2 </sup>= 2.30,</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CTG</p>
                     </c>
                     <c ca="left">
                        <p>51.9</p>
                     </c>
                     <c ca="left">
                        <p>46.9</p>
                     </c>
                     <c ca="left">
                        <p>0.14</p>
                     </c>
                     <c ca="left">
                        <p>1.19 (0.93&#8211;1.52)</p>
                     </c>
                     <c ca="left">
                        <p>df = 3,</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GTA</p>
                     </c>
                     <c ca="left">
                        <p>3.8</p>
                     </c>
                     <c ca="left">
                        <p>4.2</p>
                     </c>
                     <c ca="left">
                        <p>0.79</p>
                     </c>
                     <c ca="left">
                        <p>0.89 (0.48&#8211;1.63)</p>
                     </c>
                     <c ca="left">
                        <p>p = 0.51</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GTG</p>
                     </c>
                     <c ca="left">
                        <p>21.5</p>
                     </c>
                     <c ca="left">
                        <p>21.7</p>
                     </c>
                     <c ca="left">
                        <p>0.95</p>
                     </c>
                     <c ca="left">
                        <p>0.97 (0.72&#8211;1.30)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>These haplotypes differed significantly between CD patients and control subjects (&#967;<sup>2 </sup>= 9.55, df = 3, p = 0.02) (Table <tblr tid="T5">5</tblr>). Haplotype CTG frequencies in cases was 55.8% and in controls 46.9% (p = 0.004). The frequencies of haplotype GTG were 16.0% and 21.7% for CD case and control subjects respectively (p = 0.02). Haplotypes CCG, CTA, GCA, and GCG were the most uncommon in CD cases and control subjects, and occurred at equal frequencies in the two groups (p > 0.05). There were no significant associations between these haplotypes for UC cases as compared with control subjects (&#967;<sup>2 </sup>= 2.30, df = 3, p = 0.51). Haplotype CTG was the most common in UC cases but occurred at equal frequencies between UC case and control subjects (p > 0.05).</p>
         </sec>
         <sec>
            <st>
               <p>Crohn's disease-associated <it>Escherichia coli </it>LF82 leads to the transcriptional activation of Nod1</p>
            </st>
            <p>The gastrointestinal colon cell line Caco2 was infected with LF82 for 6 h and 9 h, respectively. Infection with this bacterial strain leads to increased Nod1 m RNA levels for the 6 h time point (4.3 fold increase as measured using quantitative real time PCR), whereas after 9 h infection the Nod1 expression levels were similar to the uninfected state (Figure <figr fid="F1">1</figr>). As Nod1 signalling leads to the activation of NF-&#954;B, we also tested the mRNA expression for this gene. Infection of Caco2 cells with the <it>E. coli </it>strain LF82 results in an upregulation for NF-&#954;B for 6 h (3.2 fold increase) and 9 h (2.4 fold increase).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Infection with <it>E. coli </it>LF82 alters m RNA levels for Nod1 and NF-&#954;B</p>
               </caption>
               <text>
                  <p><b>Infection with <it>E. coli </it>LF82 alters m RNA levels for Nod1 and NF-&#954;B</b>. Total RNA was isolated and cDNA synthesized by reverse transcription. Nod1 and NF-&#954;B mRNA levels were assayed by real-time quantitative PCR using specific primers for these genes. cDNA levels were normalized using primers for Actin. Quantitative real time PCR reactions were performed in triplicate, and means and standard error plotted.</p>
               </text>
               <graphic file="1756-0500-2-52-1"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The present study adds to a growing database supporting a role for pattern recognition receptors ininflammatory bowel diseases <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Previous data associating <it>NOD1 </it>polymorphisms with IBD risk showed variable results. Zouali, et al., <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>, with European subjects, and Ozen et al., <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> with Turkish patients, concluded that <it>NOD1 </it>was not involved in IBD. However, subject numbers in both studies were small. Molnar et al., <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> reported that the E266K (c.796G>A) <it>NOD1</it> polymorphism was associated with disease susceptibility but not with disease phenotype or <it>NOD</it>2 or <it>TLR4 </it>polymorphisms in Hungarian patients with CD.</p>
         <p>Following the very strongly positive associations reported by McGovern et al., <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, most of the more recent publications have focussed on the complex (ND(1)+32656*) <it>NOD1 </it>deletion mutation. Canto et al, <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> reported that the distribution of the <it>NOD1 </it>polymorphism in patients was different from controls, and not altered by the existence of NOD2 mutations in their Spanish population. However, Van Limbergen et al, <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B17">17</abbr></abbrgrp> showed no statistically significant differences in frequency of this variant between cases and controls in large Scottish or Swedish populations. Similar results were reported by Franke et al., <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> (German subjects) and Tremelling et al., <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> (East Anglian subjects).</p>
         <p>We are not certain of the functionality of the SNPs in the present study. We note that the insertion-deletion polymorphism (ND(1)+32656) that has given such variable results in IBD population studies accounted for approximately 7% of the variation in IgE in two panels of families (P &lt; 0.0005 in each)<abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. That is, there is <it>in vivo </it>evidence for functionality. According to our data the infection of Caco2 cells with the adherent-invasive <it>Escherichia coli </it>(AIEC) strain LF82 leads to the transcriptional activation of Nod1. AIEC strains have been specifically associated with CD ileal mucosa with a prevalence of 36.4% <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         <p>Taken together, these data may suggest that <it>NOD1 </it>plays a variable role in different populations that could depend upon environmental and dietary factors. The gene may be especially important in Caucasian groups within New Zealand</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Participants and genotyping</p>
            </st>
            <p>Cases for this study were provided through the Canterbury Inflammatory Bowel Disease Project, and controls randomly selected from a population-based cohort, both of which are described more fully elsewhere <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. Both CD and UC were defined using standard diagnostic criteria, and cases phenotyped according to the Montreal Classification systems <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>.</p>
            <p>This study had ethical approval from the Canterbury Ethics Committee and the Southern Regional Health Authority's Ethics Committee in Canterbury, New Zealand, and all participants gave their written informed consent.</p>
            <p>Genotyping was performed using the Sequenom MassArray<sup>&#174; </sup>platform (Sequenom, San Diego, CA, USA) <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> using a chip-based matrix-assisted laser desorption ionisation-time-of-flight (MALDI-TOF) mass spectrometer <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>, as previously described <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Multiplex SNP assays were designed using SpectroDesigner software and realSNP.com online tools (Sequenom, San Diego, CA, USA). Primers, sequences and assay conditions are shown in Table <tblr tid="T6">6</tblr>.</p>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Primer and probe sequences for custom made Sequenom SNP genotyping assay for NOD1</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Primer</p>
                     </c>
                     <c ca="left">
                        <p>SNP_ID</p>
                     </c>
                     <c ca="left">
                        <p>Probe Sequences</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Forward primer</p>
                     </c>
                     <c ca="left">
                        <p>rs2075818</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGCACTCACATCCGCAATACTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2075822</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGAAGGGGAGCAACAGGTGGGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2907748</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGAGGGTGGGCTCCTCTACAG</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Reverse primer</p>
                     </c>
                     <c ca="left">
                        <p>rs2075818</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGGGCAGGCACACACAATCTCC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2075822</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGAAGGGCCATGGTCATGAGTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2907748</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTGGATGACAGAAGGTCAATGGGACTC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Extend primer</p>
                     </c>
                     <c ca="left">
                        <p>rs2075818</p>
                     </c>
                     <c ca="left">
                        <p>TAAGAATGACTACTTCTCGGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2075822</p>
                     </c>
                     <c ca="left">
                        <p>GGGCATCGGGAATGGCA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2907748</p>
                     </c>
                     <c ca="left">
                        <p>GTGGGCTCCTCTACAGGTAGCT</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>To estimate genotype accuracy, approximately 12% of the samples were genotyped in duplicate or triplicate. We estimated the error rate to be &lt;1%.</p>
         </sec>
         <sec>
            <st>
               <p>Bacterial strain and culture conditions for functional assays</p>
            </st>
            <p><it>E. coli </it>strain LF82, isolated from a chronic ileal lesion of a French patient with CD, was a kind gift of A. Darfeuille-Michaud, Universit&#233; Clermont I, Pathog&#233;nie Bact&#233;rienne Intestinale, Clermont-Ferrand, France. Bacteria were grown routinely in Luria-Bertani (LB) broth or on LB agar plates overnight at 37&#176;C.</p>
         </sec>
         <sec>
            <st>
               <p>Cell culture and infection protocol</p>
            </st>
            <p>The human colorectal cancer cell line Caco-2 was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle medium (DMEM) with L-glutamine supplemented with 10% heat-inactivated fetal calf serum (Moregate, Hamilton, New Zealand), 1 mM sodium pyruvate and 1 mM non essential amino acids. All reagents were supplied from Invitrogen, Auckland, New Zealand. Cultures were maintained at 37&#176;C in a humidified 5% CO<sub>2 </sub>atmosphere. Monolayers were seeded in 24-well tissue culture plates (BD, Bioscience, Auckland, New Zealand) with 2 &#215; 10<sup>5 </sup>cells/well and incubated for 14 days. During this time the cell medium was constantly replenished.</p>
            <p>For infection experiments, bacteria were grown overnight in LB broth at 37&#176;C. Before starting the infection the cell monolayers were washed twice with phosphate-buffered saline (PBS, pH 7.2). Each monolayer was infected in 1 ml of the cell culture medium without FCS at a multiplicity of infection (MOI) of 10 bacteria per epithelial cell. After a 6-h and 9-h incubation period at 37&#176;C with 10% CO<sub>2</sub>, infected monolayers were washed three times with PBS and the cells were trypsinated with 10% Trypsin-EDTA (Invitrogen, Auckland, New Zealand). To remove the trypsin cells were centrifuged for 1 min at 1500 rpm and the cell pellets were stored at -80&#176;C.</p>
         </sec>
         <sec>
            <st>
               <p>RNA isolation and RT-PCR</p>
            </st>
            <p>Total RNA was extracted from non-infected and infected Caco2 cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following manufacturer's protocols. The RNA was quantified spectrophotometrically and then stored at -80&#176;C. Reverse transcription of 1.5 &#956;g of total RNA to complementary DNA (cDNA) was carried out using the SuperScript&#8482;III First-strand Synthesis &#8211; Super Mix Kit (Invitrogen, Auckland, New Zealand) and oligo(dT)<sub>20 </sub>primers, according to the standard protocol. The primers used for PCR had the following sequences: NF-&#954;B, 5'-ACAAATGGGCTACACCGAAG-3', 5'-GGACAACGCAGTGGAATTTT-3'; Nod1, 5'-AGCTGAAGATGAATTTGGGAAA-3', 5'-GCCGAGAAGTAGTCATTCTTCAG-3' and Actin 5'-CATTGCCGACAGGATGCA-3', 5'-CCGATCCACACGGAGTACTTG-3'. These sets of primers yield to PCR products that were 198 bp (Nod1), 341 bp (NF-&#954;B) and 102 bp (Actin) long, respectively. Results are expressed as the relative mRNA accumulation corrected using Actin mRNA as an internal standard.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>The allelic trend test <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> and Fisher's exact genotypic test were used to compare case and control allele frequencies. An exact test was used to test for departures from Hardy-Weinberg equilibrium (HWE) in the case and the control samples <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Allelic odds ratios were calculated and confidence intervals for the allelic odds ratio were also calculated under the assumption of HWE in the cases and the control groups. Logistic regression analysis was used for subgroup analysis. Other analyses were carried out using R <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, SHEsis <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> (available from <url>http://analysis.bio-x.cn/myAnalysis.php</url>), and SAS (V9.1 SAS Institute., Cary, NC, USA).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CARD: caspase-activated recruitment domain; CD: Crohn's disease; IC: Indeterminate colitis; NOD: nucleotide oligomerisation domain; OR: Odds ratio; PRRs: pattern recognition receptors; SNP: Single Nucleotide Polymorphism; UC: ulcerative colitis.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>CH helped with the genetic analyses and performed the functional analyses on <it>NOD1</it>. LRF managed the study and drafted the manuscript. DYH and BLB carried out the statistical analyses. MP helped design the primers for the genotyping experiments. MLB and RLG recruited participants and participated in the design of the database. AMC and PSB coordinated the database. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Rebecca Roberts for help preparing the DNA plates, Ivonne Petermann for help with designing the primers, and the Canterbury participants in our study. Other funding sources for the case and control DNA collection are the Canterbury Medical Research Foundation and Canterbury Liver and Digestive Diseases Trust. Nutrigenomics New Zealand is a collaboration between AgResearch Ltd., Crop &amp; Food Research, HortResearch and The University of Auckland, with funding through the Foundation for Research Science and Technology.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Caspase recruitment domain-containing sensors and adaptors in intestinal innate immunity</p>
            </title>
            <aug>
               <au>
                  <snm>Hruz</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Eckmann</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Curr</source>
            <pubdate>2008</pubdate>
            <volume>24</volume>
            <issue>2</issue>
            <fpage>108</fpage>
            <lpage>114</lpage>
         </bibl>
         <bibl id="B2">
            <title>
               <p>A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. [see comment]</p>
            </title>
            <aug>
               <au>
                  <snm>Ogura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Bonen</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Inohara</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nicolae</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Ramos</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Britton</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Moran</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Karaliuskas</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Duerr</snm>
                  <fnm>RH</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>2001</pubdate>
            <volume>411</volume>
            <issue>6837</issue>
            <fpage>603</fpage>
            <lpage>606</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35079114</pubid>
                  <pubid idtype="pmpid" link="fulltext">11385577</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. [see comment]</p>
            </title>
            <aug>
               <au>
                  <snm>Hugot</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Chamaillard</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zouali</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lesage</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cezard</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Belaiche</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Almer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tysk</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>O'Morain</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Gassull</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>2001</pubdate>
            <volume>411</volume>
            <issue>6837</issue>
            <fpage>599</fpage>
            <lpage>603</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35079107</pubid>
                  <pubid idtype="pmpid" link="fulltext">11385576</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Barrett</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Hansoul</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nicolae</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Cho</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Duerr</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Rioux</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Brant</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Silverberg</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Barmada</snm>
                  <fnm>MM</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2008</pubdate>
            <volume>40</volume>
            <issue>8</issue>
            <fpage>955</fpage>
            <lpage>962</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng.175</pubid>
                  <pubid idtype="pmpid" link="fulltext">18587394</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>CARD4/NOD1 is not involved in inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Zouali</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lesage</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Merlin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Cezard</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Colombel</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Belaiche</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Almer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tysk</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>O'Morain</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gassull</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Gut</source>
            <pubdate>2003</pubdate>
            <volume>52</volume>
            <issue>1</issue>
            <fpage>71</fpage>
            <lpage>74</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1773516</pubid>
                  <pubid idtype="pmpid" link="fulltext">12477763</pubid>
                  <pubid idtype="doi">10.1136/gut.52.1.71</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Association between a complex insertion/deletion polymorphism in NOD1 (CARD4) and susceptibility to inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>McGovern</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Hysi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ahmad</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>van Heel</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Moffatt</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Carey</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cookson</snm>
                  <fnm>WO</fnm>
               </au>
               <au>
                  <snm>Jewell</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <issue>10</issue>
            <fpage>1245</fpage>
            <lpage>1250</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi135</pubid>
                  <pubid idtype="pmpid" link="fulltext">15790594</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Influence of a nucleotide oligomerization domain 1 (NOD1) polymorphism and NOD2 mutant alleles on Crohn's disease phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Canto</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ricart</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Busquets</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Monfort</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Garcia-Planella</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Balanzo</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rodriguez-Sanchez</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Vidal</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>World J Gastroenterol</source>
            <pubdate>2007</pubdate>
            <volume>13</volume>
            <issue>41</issue>
            <fpage>5446</fpage>
            <lpage>5453</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17907287</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>No association between the functional CARD4 insertion/deletion polymorphism and inflammatory bowel diseases in the German population</p>
            </title>
            <aug>
               <au>
                  <snm>Franke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ruether</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wedemeyer</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Karlsen</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Nebel</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Schreiber</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Gut</source>
            <pubdate>2006</pubdate>
            <volume>55</volume>
            <issue>11</issue>
            <fpage>1679</fpage>
            <lpage>1680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/gut.2006.104646</pubid>
                  <pubid idtype="pmpid" link="fulltext">17047129</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Complex insertion/deletion polymorphism in NOD1 (CARD4) is not associated with inflammatory bowel disease susceptibility in East Anglia panel</p>
            </title>
            <aug>
               <au>
                  <snm>Tremelling</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hancock</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bredin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sharpstone</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bingham</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Parkes</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2006</pubdate>
            <volume>12</volume>
            <issue>10</issue>
            <fpage>967</fpage>
            <lpage>971</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/01.mib.0000234131.89971.e5</pubid>
                  <pubid idtype="pmpid" link="fulltext">17012967</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Investigation of NOD1/CARD4 variation in inflammatory bowel disease using a haplotype-tagging strategy</p>
            </title>
            <aug>
               <au>
                  <snm>Van Limbergen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nimmo</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Drummond</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Arnott</snm>
                  <fnm>ID</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Satsangi</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2007</pubdate>
            <volume>16</volume>
            <issue>18</issue>
            <fpage>2175</fpage>
            <lpage>2186</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddm169</pubid>
                  <pubid idtype="pmpid" link="fulltext">17613538</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Effect of inflammatory bowel disease classification changes on NOD2 genotype-phenotype associations in a population-based cohort</p>
            </title>
            <aug>
               <au>
                  <snm>Gearry</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Roberts</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Burt</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Frampton</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Collett</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Shirley</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Allington</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Kennedy</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Barclay</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2007</pubdate>
            <volume>13</volume>
            <issue>10</issue>
            <fpage>1220</fpage>
            <lpage>1227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ibd.20190</pubid>
                  <pubid idtype="pmpid" link="fulltext">17538984</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Association of DLG5 variants with inflammatory bowel disease in the New Zealand Caucasian population and meta-analysis of the DLG5 R30Q variant</p>
            </title>
            <aug>
               <au>
                  <snm>Browning</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Huebner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Petermann</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Demmers</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>McCulloch</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gearry</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Barclay</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Shelling</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Ferguson</snm>
                  <fnm>LR</fnm>
               </au>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2007</pubdate>
            <volume>13</volume>
            <issue>9</issue>
            <fpage>1069</fpage>
            <lpage>1076</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ibd.20157</pubid>
                  <pubid idtype="pmpid" link="fulltext">17455201</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Has toll-like receptor 4 been prematurely dismissed as an inflammatory bowel disease gene? Association study combined with meta-analysis shows strong evidence for association</p>
            </title>
            <aug>
               <au>
                  <snm>Browning</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Huebner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Petermann</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Gearry</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Barclay</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Shelling</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Ferguson</snm>
                  <fnm>LR</fnm>
               </au>
            </aug>
            <source>Am J Gastroenterol</source>
            <pubdate>2007</pubdate>
            <volume>102</volume>
            <issue>11</issue>
            <fpage>2504</fpage>
            <lpage>2512</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1572-0241.2007.01463.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17850411</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Invasive ability of an Escherichia coli strain isolated from the ileal mucosa of a patient with Crohn's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Boudeau</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Glasser</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Masseret</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Joly</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Darfeuille-Michaud</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1999</pubdate>
            <volume>67</volume>
            <issue>9</issue>
            <fpage>4499</fpage>
            <lpage>4509</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">96770</pubid>
                  <pubid idtype="pmpid" link="fulltext">10456892</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>NOD2/CARD15, NOD1/CARD4, and ICAM-1 gene polymorphisms in Turkish patients with inflammatory bowel disease.</p>
            </title>
            <aug>
               <au>
                  <snm>Ozen</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Dagli</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Kilic</snm>
                  <fnm>MY</fnm>
               </au>
               <au>
                  <snm>Toruner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Celik</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ozkan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Soykan</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Cetinkaya</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ulker</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ozden</snm>
                  <fnm>A</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Gastroenterol</source>
            <pubdate>2006</pubdate>
            <volume>41</volume>
            <issue>4</issue>
            <fpage>304</fpage>
            <lpage>310</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00535-005-1780-z</pubid>
                  <pubid idtype="pmpid" link="fulltext">16741608</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>NOD1 gene E266K polymorphism is associated with disease susceptibility but not with disease phenotype or NOD2/CARD15 in Hungarian patients with Crohn's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Molnar</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hofner</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Nagy</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lakatos</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lakatos</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kovacs</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Altorjay</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Papp</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Palatka</snm>
                  <fnm>K</fnm>
               </au>
               <etal/>
            </aug>
            <source>Dig Liver Dis</source>
            <pubdate>2007</pubdate>
            <volume>39</volume>
            <issue>12</issue>
            <fpage>1064</fpage>
            <lpage>1070</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.dld.2007.09.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">17964870</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Contribution of the NOD1/CARD4 insertion/deletion polymorphism +32656 to inflammatory bowel disease in Northern Europe</p>
            </title>
            <aug>
               <au>
                  <snm>Van Limbergen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Nimmo</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Torkvist</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lees</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Drummond</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Gillett</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>McGrogan</snm>
                  <fnm>P</fnm>
               </au>
               <etal/>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2007</pubdate>
            <volume>13</volume>
            <issue>7</issue>
            <fpage>882</fpage>
            <lpage>889</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ibd.20124</pubid>
                  <pubid idtype="pmpid" link="fulltext">17285593</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>NOD1 variation, immunoglobulin E and asthma</p>
            </title>
            <aug>
               <au>
                  <snm>Hysi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kabesch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Moffatt</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Schedel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Carr</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Boardman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>von Mutius</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Weiland</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Leupold</snm>
                  <fnm>W</fnm>
               </au>
               <etal/>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <issue>7</issue>
            <fpage>935</fpage>
            <lpage>941</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi087</pubid>
                  <pubid idtype="pmpid" link="fulltext">15718249</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Darfeuille-Michaud</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Boudeau</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bulois</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Neut</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Glasser</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Barnich</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bringer</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Swidsinski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Beaugerie</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Colombel</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Gastroenterology</source>
            <pubdate>2004</pubdate>
            <volume>127</volume>
            <issue>2</issue>
            <fpage>412</fpage>
            <lpage>421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/j.gastro.2004.04.061</pubid>
                  <pubid idtype="pmpid" link="fulltext">15300573</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>High incidence of Crohn's disease in Canterbury, New Zealand: results of an epidemiologic study</p>
            </title>
            <aug>
               <au>
                  <snm>Gearry</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Frampton</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Collett</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Burt</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Barclay</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2006</pubdate>
            <volume>12</volume>
            <issue>10</issue>
            <fpage>936</fpage>
            <lpage>943</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/01.mib.0000231572.88806.b9</pubid>
                  <pubid idtype="pmpid" link="fulltext">17012964</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>The significance of haemochromatosis gene mutations in the general population: implications for screening</p>
            </title>
            <aug>
               <au>
                  <snm>Burt</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>George</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Upton</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Collett</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Frampton</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Walmsley</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Chapman</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Gut</source>
            <pubdate>1998</pubdate>
            <volume>43</volume>
            <issue>6</issue>
            <fpage>830</fpage>
            <lpage>836</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1727339</pubid>
                  <pubid idtype="pmpid" link="fulltext">9824612</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: Report of a Working Party of the 2005 Montreal World Congress of Gastroenterology</p>
            </title>
            <aug>
               <au>
                  <snm>Silverberg</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Satsangi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ahmad</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Arnott</snm>
                  <fnm>ID</fnm>
               </au>
               <au>
                  <snm>Bernstein</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Brant</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Caprilli</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Colombel</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Gasche</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Geboes</snm>
                  <fnm>K</fnm>
               </au>
               <etal/>
            </aug>
            <source>Can J Gastroenterol</source>
            <pubdate>2005</pubdate>
            <volume>19</volume>
            <issue>Suppl A</issue>
            <fpage>5</fpage>
            <lpage>36</lpage>
            <xrefbib>
               <pubid idtype="pmpid">16151544</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Automated mass spectrometry: a revolutionary technology for clinical diagnostics</p>
            </title>
            <aug>
               <au>
                  <snm>Leushner</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chiu</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>Mol Diagn</source>
            <pubdate>2000</pubdate>
            <volume>5</volume>
            <issue>4</issue>
            <fpage>341</fpage>
            <lpage>348</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11172498</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>High-throughput multiplex SNP genotyping with MALDI-TOF mass spectrometry: practice, problems and promise</p>
            </title>
            <aug>
               <au>
                  <snm>Bray</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Boerwinkle</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Doris</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2001</pubdate>
            <volume>17</volume>
            <issue>4</issue>
            <fpage>296</fpage>
            <lpage>304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.27</pubid>
                  <pubid idtype="pmpid" link="fulltext">11295828</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>From genotypes to genes: doubling the sample size</p>
            </title>
            <aug>
               <au>
                  <snm>Sasieni</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Biometrics</source>
            <pubdate>1997</pubdate>
            <volume>53</volume>
            <issue>4</issue>
            <fpage>1253</fpage>
            <lpage>1261</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2307/2533494</pubid>
                  <pubid idtype="pmpid">9423247</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A note on exact tests of Hardy-Weinberg equilibrium</p>
            </title>
            <aug>
               <au>
                  <snm>Wigginton</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Cutler</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Abecasis</snm>
                  <fnm>GR</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <issue>5</issue>
            <fpage>887</fpage>
            <lpage>893</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1199378</pubid>
                  <pubid idtype="pmpid" link="fulltext">15789306</pubid>
                  <pubid idtype="doi">10.1086/429864</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>R: A language for data analysis and graphics</p>
            </title>
            <aug>
               <au>
                  <snm>Ihaka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gentleman</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Journal of Computational and Graphical Statistics</source>
            <pubdate>1996</pubdate>
            <volume>5</volume>
            <issue>3</issue>
            <fpage>299</fpage>
            <lpage>314</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/1390807</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci</p>
            </title>
            <aug>
               <au>
                  <snm>Shi</snm>
                  <fnm>YY</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Cell Res</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <issue>2</issue>
            <fpage>97</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.cr.7290272</pubid>
                  <pubid idtype="pmpid" link="fulltext">15740637</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
