<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1750-1172-2-49</ui>
   <ji>1750-1172</ji>
   <fm>
      <dochead>Case Report</dochead>
      <bibl>
         <title>
            <p>Alstrom syndrome (OMIM 203800): a case report and literature review</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Joy</snm>
               <fnm>Tisha</fnm>
               <insr iid="I1"/>
               <email>tjoy@uwo.ca</email>
            </au>
            <au id="A2">
               <snm>Cao</snm>
               <fnm>Henian</fnm>
               <insr iid="I1"/>
               <email>hcao@robarts.ca</email>
            </au>
            <au id="A3">
               <snm>Black</snm>
               <fnm>Graeme</fnm>
               <insr iid="I2"/>
               <email>graeme.black@manchester.ac.uk</email>
            </au>
            <au id="A4">
               <snm>Malik</snm>
               <fnm>Rayaz</fnm>
               <insr iid="I3"/>
               <email>rayaz.a.malik@manchester.ac.uk</email>
            </au>
            <au id="A5">
               <snm>Charlton-Menys</snm>
               <fnm>Valentine</fnm>
               <insr iid="I3"/>
               <email>valentine.menys@manchester.ac.uk</email>
            </au>
            <au id="A6" ca="yes">
               <snm>Hegele</snm>
               <mi>A</mi>
               <fnm>Robert</fnm>
               <insr iid="I1"/>
               <email>hegele@robarts.ca</email>
            </au>
            <au id="A7">
               <snm>Durrington</snm>
               <mi>N</mi>
               <fnm>Paul</fnm>
               <insr iid="I3"/>
               <email>Pdurrington@manchester.ac.uk</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Vascular Biology and Medicine, Robarts Research Institute and Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada</p>
            </ins>
            <ins id="I2">
               <p>Clinical and Laboratory Sciences, Medical Genetics, Eye Hospital, Manchester, UK</p>
            </ins>
            <ins id="I3">
               <p>Cardiovascular Research Group, School of Clinical &amp; Laboratory Sciences, Core Technology Facility (3<sup>rd </sup>Floor), Manchester, UK</p>
            </ins>
         </insg>
         <source>Orphanet Journal of Rare Diseases</source>
         <issn>1750-1172</issn>
         <pubdate>2007</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>49</fpage>
         <url>http://www.OJRD.com/content/2/1/49</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18154657</pubid>
               <pubid idtype="doi">10.1186/1750-1172-2-49</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>04</day>
               <month>10</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>21</day>
               <month>12</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>21</day>
               <month>12</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Joy et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Alstrom syndrome (AS) is a rare autosomal recessive disease characterized by multiorgan dysfunction. The key features are childhood obesity, blindness due to congenital retinal dystrophy, and sensorineural hearing loss. Associated endocrinologic features include hyperinsulinemia, early-onset type 2 diabetes, and hypertriglyceridemia. Thus, AS shares several features with the common metabolic syndrome, namely obesity, hyperinsulinemia, and hypertriglyceridemia. Mutations in the <it>ALMS1 </it>gene have been found to be causative for AS with a total of 79 disease-causing mutations having been described.</p>
            </sec>
            <sec>
               <st>
                  <p>Case presentation</p>
               </st>
               <p>We describe the case of a 27-year old female from an English (Caucasian) kindred. She had been initially referred for hypertriglyceridemia, but demonstrated other features suggestive of AS, including blindness, obesity, type 2 diabetes, renal dysfunction, and hypertension. DNA analysis revealed that she is a compound heterozygote with two novel mutations in the <it>ALMS1 </it>gene &#8211; H3882Y and V424I. Examination of her family revealed that her phenotypically unaffected mother and younger sister also had heterozygous mutations in the <it>ALMS1 </it>gene. In addition to presenting these novel molecular findings for AS, we review the clinical and genetic features of AS in the context of our case.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Two novel mutations in the <it>ALMS1 </it>gene causative for AS have been reported here, thereby increasing the number of reported mutations to 81 and providing a wider basis for mutational screening among affected individuals.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Alstrom syndrome (AS; OMIM 203800) was first described in 1959 and has an estimated prevalence of &lt;1:100 000 <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. AS is an autosomal recessive multiorgan disorder, characterized by childhood obesity, adult short stature with initial accelerated childhood linear growth, progressive cone-rod dystrophy leading to blindness, and sensorineural hearing loss <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Endocrinologic complications include early-onset diabetes mellitus (typically in the 2<sup>nd </sup>or 3<sup>rd </sup>decades), hyperinsulinemia (with associated acanthosis nigricans), hypertriglyceridemia, infertility (hypergonadotrophic hypogonadism), and hypothyroidism <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Systemic fibrosis is commonly observed <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The primary cause of mortality among young affected patients is cardiac involvement from dilated cardiomyopathy whereas renal failure is the major cause of death among the older subgroup <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>.</p>
         <p>Mutations in the <it>ALMS1 </it>gene were independently identified as causative for AS by two research groups <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. <it>ALMS1 </it>encodes a protein of 4169 amino acids, which includes a large tandem-repeat domain consisting of 47 amino acids (aa); the exact function of the ALMS1 protein still remains unknown <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. However, the ALMS1 protein has been shown to be ubiquitously expressed and to localize subcellularly <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. It has been proposed that ALMS1 is involved in the functioning of centrosomes or basal bodies <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Although initial data revealed normal ciliary structure in fibroblasts from affected individuals with <it>ALMS1 </it>mutations, <it>ALMS1 </it>knockout mice demonstrated abnormal ciliary structure that could be rescued with a prematurely truncated fragment of ALMS1 containing the N-terminus <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>. Thus, the N-terminus of ALMS1 seems to be crucial to normal ciliary structure <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. To date, a total of 79 disease-causing <it>ALMS1 </it>mutations have been reported <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. We report here the clinical and novel molecular findings in a Caucasian kindred with Alstrom syndrome from the United Kingdom and review the current clinical and molecular genetic aspects of this condition.</p>
      </sec>
      <sec>
         <st>
            <p>Case presentation</p>
         </st>
         <p>In 2002, the 27-year old proband was referred to the lipid clinic of a tertiary health care centre for evaluation of an elevated triglyceride (TG) level of 59.1 mmol/L. Her prior history included poor vision since birth, commencing with the development of night blindness, eventually resulting in legal blindness by the age of 17. She had undergone a left nephrectomy at the age of 24 for a perinephric abscess due to chronic pyelonephritis. Ultrasound evaluation revealed a normal-sized right kidney with evidence of cortical scarring. Hypertension and diabetes subsequently developed at the ages of 25 and 26 years, respectively. She experienced learning difficulties in school, but did not have sensorineural deafness. On physical examination, there was evidence of central obesity with her body mass index (BMI) being 34.9 kg/m<sup>2</sup>. Her blood pressure on antihypertensive treatment was 132/86 with a regular pulse of 80 beats per minute. There was no evidence of poly- or syndactyly suggestive of Bardet-Biedl syndrome. Hirsutism was present on the face, abdomen, and arms. Ophthalmologic examination was notable for retinitis pigmentosa and cataracts bilaterally.</p>
         <p>Her family consisted of non-consanguineous parents, both alive and well, as well as four siblings &#8211; three sisters (aged 18, 26, 29 years) and one brother (aged 29 years), who were also healthy. The family structure is outlined in Figure <figr fid="F1">1</figr>.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>DNA sequence analysis of Alstrom syndrome mutations</p>
            </caption>
            <text>
               <p><b>DNA sequence analysis of Alstrom syndrome mutations</b>. Proband is indicated by the solid circle and arrow. Smaller symbols represent individuals from whom DNA was unavailable. There is no known consanguinity between the parents of this kindred. Electrophoretic tracings for exons 6 and 17 of the <it>ALMS1 </it>gene from the proband and available immediate relatives are shown. The proband is a compound heterozygote for the V424I and H3882 Y mutations while the mother demonstrates heterozygosity only for the H3882Y mutation and the younger sister demonstrates heterozygosity only for the V424I mutation. The older sister has no mutations in the <it>ALMS1 </it>gene.</p>
            </text>
            <graphic file="1750-1172-2-49-1"/>
         </fig>
         <sec>
            <st>
               <p>Biochemical attributes and investigations</p>
            </st>
            <p>The proband's initial labwork at the time of consultation revealed a plasma TG level of 20.6 mmol/L with a high-density lipoprotein cholesterol (HDL-C) level of 0.56 mmol/L. Her fasting glucose and insulin levels on oral antidiabetic therapy but not insulin were 14.2 mmol/L and 68.1 mU/L (normal &lt;10 mU/L), respectively, with a HbA1C of 11.2%. Her creatinine was elevated at 255 <b>&#956;</b>mol/L with overt proteinuria of 2.68 g/24 hours. Her total alkaline phosphatase of 416 U/L (normal &lt; 330 U/L) demonstrated increases in both the liver and bone isoenzymes. Abdominal ultrasound revealed fatty infiltration of the liver and splenic enlargement (14 cm in length). Both her electrocardiogram and echocardiogram were normal.</p>
            <p>The results of lipoprotein analyses of the proband, proband's mother and two sisters are shown in Table <tblr tid="T1">1</tblr>. The proband demonstrated significant hypertriglyceridemia (TG = 20.6 mmol/L) and hypoalphalipoproteinemia (HDL-C = 0.56 mmol/L). Both the proband's mother and older sister displayed mildly elevated plasma TG whereas the younger sister tested had relatively normal plasma TG. Plasma low density lipoprotein-cholesterol (LDL-C) levels were higher among the mother and younger sister compared to the others. The proband demonstrated the lowest LDL-C and HDL-C levels of all four members of the kindred examined.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Clinical and biochemical characteristics of the pedigree</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Biochemical parameter</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Proband (II-2)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mother (I-1)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sister (II-1)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sister (II-3)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total cholesterol (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>7.40</p>
                     </c>
                     <c ca="center">
                        <p>7.70</p>
                     </c>
                     <c ca="center">
                        <p>5.78</p>
                     </c>
                     <c ca="center">
                        <p>6.79</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Triglyceride (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>20.6</p>
                     </c>
                     <c ca="center">
                        <p>2.61</p>
                     </c>
                     <c ca="center">
                        <p>3.80</p>
                     </c>
                     <c ca="center">
                        <p>1.78</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VLDL- C (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>4.62</p>
                     </c>
                     <c ca="center">
                        <p>0.92</p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>0.58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VLDL-TG (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>15.4</p>
                     </c>
                     <c ca="center">
                        <p>1.57</p>
                     </c>
                     <c ca="center">
                        <p>2.54</p>
                     </c>
                     <c ca="center">
                        <p>1.10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VLDL-TG/VLDL-C ratio</p>
                     </c>
                     <c ca="center">
                        <p>3.33</p>
                     </c>
                     <c ca="center">
                        <p>1.71</p>
                     </c>
                     <c ca="center">
                        <p>2.33</p>
                     </c>
                     <c ca="center">
                        <p>1.90</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HDL-C (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>0.56</p>
                     </c>
                     <c ca="center">
                        <p>0.94</p>
                     </c>
                     <c ca="center">
                        <p>1.04</p>
                     </c>
                     <c ca="center">
                        <p>1.72</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LDL-C (mmol/L)</p>
                     </c>
                     <c ca="center">
                        <p>0.83</p>
                     </c>
                     <c ca="center">
                        <p>5.32</p>
                     </c>
                     <c ca="center">
                        <p>3.29</p>
                     </c>
                     <c ca="center">
                        <p>4.19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Apo A-1 (g/L)</p>
                     </c>
                     <c ca="center">
                        <p>1.25</p>
                     </c>
                     <c ca="center">
                        <p>1.20</p>
                     </c>
                     <c ca="center">
                        <p>1.45</p>
                     </c>
                     <c ca="center">
                        <p>1.59</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Apo B (g/L)</p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>1.59</p>
                     </c>
                     <c ca="center">
                        <p>1.16</p>
                     </c>
                     <c ca="center">
                        <p>1.22</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: VLDL-C, very low density lipoprotein &#8211; cholesterol; VLDL-TG, very low density lipoprotein- triglyceride; HDL-C, high density lipoprotein &#8211; cholesterol; LDL-C, low density lipoprotein &#8211; cholesterol</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Treatment</p>
            </st>
            <p>Treatment of the proband's hypertriglyceridemia required the use of multiple therapies, including a low-fat diet (&lt; 20 g fat per day), insulin (glargine 14 units/day), pioglitazone (45 mg/day), atorvastatin (40 mg/day), and omega-3-acid ethylesters (Omacor) (2 g bid). As a result of therapy, TG levels decreased by ~84% to 3.30 mmol/L and HDL-C levels improved by ~252% to 1.41 mmol/L.</p>
         </sec>
         <sec>
            <st>
               <p>DNA isolation and sequence analysis</p>
            </st>
            <p>Informed consent was obtained from all available subjects or their guardians, and the study was approved by the institutional review board of the University of Western Ontario (#07920E). DNA and lipoprotein analyses were unavailable for the father, one sister (aged 18 years), and brother (aged 29 years). Genomic DNA from the four available study subjects was isolated from whole blood (Puregene, Gentra Systems, Minneapolis, MN). Exons 1 to 23 of <it>ALMS1 </it>were amplified using the primers in Table <tblr tid="T2">2</tblr>. The final volume of 50 <b>&#956;</b>L contained 32 pmol of each primer, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 1.5 mM MgCl<sub>2</sub>, 50 mM KCl, 20 mM Tris-HCl (pH 8.4), and 2.5 units of Taq platinum DNA polymerase (Life Technologies, Mississauga, Ontario, Canada). DNA amplifications were performed with denaturing at 94&#176;C for 5 minutes, followed by 30 cycles of a denaturing step at 94&#176;C, an annealing step at 60&#176;C, and an extension step at 72&#176;C, each for 30 seconds. A final extension step at 72&#176;C was performed for 10 min. Amplification products were electrophoresed on 1.5% agarose gels and purified with the QIAEX II gel extraction kit (Qiagen, Inc., Mississauga, Ontario, Canada). Purified DNA fragments were sequenced by the chain termination method using the ABI 3730 Automated DNA Sequencer and analyzed using Sequence Navigator Software (both from PE-Applied Biosystems, Mississauga, Ontario, Canada).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Oligonucleotides for genomic amplification and sequencing of <it>ALMS1</it></p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Exon</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Forward Primer</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Reverse Primer</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>GCACTGCGCCTAAGCTG</p>
                     </c>
                     <c ca="left">
                        <p>CAGCCTCCACCCCCAAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>ATGTGAAAGGGCTTTATAAACTGG</p>
                     </c>
                     <c ca="left">
                        <p>TTTTTCCATTCTTCATAGCTAAATCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>CAGTTAATGACTTAGCATGTTTTCCT</p>
                     </c>
                     <c ca="left">
                        <p>TCCTTAACTCAAAAAGGGGAAAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>ACGTAAGTAAATAATCAATTTTCAGCA</p>
                     </c>
                     <c ca="left">
                        <p>TCTAAGCCCCACCTCAAAGT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>TTTCAGTGACATATGTATTTTTGTGTT</p>
                     </c>
                     <c ca="left">
                        <p>TTCCCTTGGGAATTTTATTTTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>CTTCGTGTGTGGGAGCTGAG</p>
                     </c>
                     <c ca="left">
                        <p>CAATACTGAAAAAGGCCACGTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>TGGGCATTAATGAGTCTTTTTC</p>
                     </c>
                     <c ca="left">
                        <p>TTTTCACAAGGTATCCGTAAGTAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>GCTTTTTAAAGGCTCAAAGCTG</p>
                     </c>
                     <c ca="left">
                        <p>TCTCTCTATGTGAGTAGGAAGTAGAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TGACCAGACAACTGGCATGT</p>
                     </c>
                     <c ca="left">
                        <p>GACTGTCTGCTAAGTCCTGTGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TTCTTACTCACAAAGAGAAAAGCCTA</p>
                     </c>
                     <c ca="left">
                        <p>GGGCAGCCAATACAGAAACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TTTCCCTGAAGAAGCTCTGAA</p>
                     </c>
                     <c ca="left">
                        <p>TGGCAAGGTCTGTTGGTAGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TCACAAAGAGAGAAGCCTGGT</p>
                     </c>
                     <c ca="left">
                        <p>AGCTGGTGTGCCAGTTGTCT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TTCAGTTGCCTCTGAACCAG</p>
                     </c>
                     <c ca="left">
                        <p>TGTGGCAAGACCTGTTGGTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>CACACACAGAGAAGCCTGGT</p>
                     </c>
                     <c ca="left">
                        <p>AAAGGTCCTGCTGGTATGTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>TCCATTGTTTCTGGACCTACTG</p>
                     </c>
                     <c ca="left">
                        <p>ATCTGGCAACTCTTGCTGGT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>ACTGTAACTTCCTCTTTCTATTCACAT</p>
                     </c>
                     <c ca="left">
                        <p>TCTCAGTCTTCCGGTCACCT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>AGCAGGAGTTGCCAGATGTT</p>
                     </c>
                     <c ca="left">
                        <p>CTGGTTTTCCAGTATTCACATCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>AAAGATTTCAGCTGTCCCTGA</p>
                     </c>
                     <c ca="left">
                        <p>CTGCATCCTGGATTTCTTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGGCTGATGACAGAGTTG</p>
                     </c>
                     <c ca="left">
                        <p>CCCAATGGTTCCACTACACC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>GAGCAAAGTCAGTATGGCATTAGA</p>
                     </c>
                     <c ca="left">
                        <p>TGGCTAAGCTTCCTCAAAACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>TCTTCTGTGTTGCAATTGTTGA</p>
                     </c>
                     <c ca="left">
                        <p>TTCCATCACCCATTCTTTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>TTGGACTACTTCAAATAAGAACCTG</p>
                     </c>
                     <c ca="left">
                        <p>GACGGCATTTGTGATGAAGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>ACCTGCTTTTGTGCCACCTA</p>
                     </c>
                     <c ca="left">
                        <p>CTTGGTCTGCCCATGCTAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>CCAGTACCAGGGCAAATTGT</p>
                     </c>
                     <c ca="left">
                        <p>GGAAGGGGAAAATGGTGTTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>ACCTTCCGTCTCCCATTTCT</p>
                     </c>
                     <c ca="left">
                        <p>TCCTGTGCTACAGGTTTACTGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCTAAAGCGAGGATGAA</p>
                     </c>
                     <c ca="left">
                        <p>CCCCCAAGAACCGATATCTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>TTCCTTGAAACCACTTTTGGA</p>
                     </c>
                     <c ca="left">
                        <p>GAAAGACACAACCACAAATTTCTAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>GAAGGCATTCCATATTTGTTCA</p>
                     </c>
                     <c ca="left">
                        <p>GCACTGGACTTTTGTCACTCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>TCATAGAATTGGTCTAAGAGGCAAA</p>
                     </c>
                     <c ca="left">
                        <p>AAGATTGGATAGTAATCTCATTTAGGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>ATGGGTTTGGGGTTTTGTTT</p>
                     </c>
                     <c ca="left">
                        <p>GAGCTGAAGACAGCAAGAAGAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>AACAAAGCCTTTCACATAATACG</p>
                     </c>
                     <c ca="left">
                        <p>CACTGACCCTCACATACACAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>GCAGGCAGTGAATTTTCTGAT</p>
                     </c>
                     <c ca="left">
                        <p>TTTTGGATAATCTCTAACTTGACTTTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>CCAGAATAAAGAGCCTCAGCA</p>
                     </c>
                     <c ca="left">
                        <p>TTTTTAAGCTCGCCTGTATTTTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>GCGGTTTAAAAGCCTAGAGAAA</p>
                     </c>
                     <c ca="left">
                        <p>TTTTCACCTGTGTGCAAAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>TGAATTGGATTAGAAAGAGGACTTG</p>
                     </c>
                     <c ca="left">
                        <p>TCTTACATGTTTAAGAGCCATTTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>TCCCACACAAAGGGATTGTA</p>
                     </c>
                     <c ca="left">
                        <p>ATCGCAGGGGACTTGAAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>CTGGGTGGGGCTGTAAAAA</p>
                     </c>
                     <c ca="left">
                        <p>CCAAGTCACAGAGCCAGCTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>GCATATGGAGAGTAGATTGCATCA</p>
                     </c>
                     <c ca="left">
                        <p>TGGGCTGGCCTTTAGCAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p>GGTAGGGGCACCAAGTCCTA</p>
                     </c>
                     <c ca="left">
                        <p>CAGAGCTCCCGACCACTTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>GATGAGCTCCTGGAGAGTGG</p>
                     </c>
                     <c ca="left">
                        <p>GGCAACGTGTTTTCTCCATT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>GGCATCTGCCTCTGATGG</p>
                     </c>
                     <c ca="left">
                        <p>AAGGATTCTGCTTCTCTAGGTTCA</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Identification of novel disease-causing <it>ALMS1 </it>mutation</p>
            </st>
            <p>Sequencing of genomic DNA from the affected proband demonstrated no mutations in the coding regions of the <it>LPL </it>gene (data not shown), but did reveal 2 novel missense mutations in the <it>ALMS1 </it>gene &#8211; a G&#8594;A transversion at nucleotide 1381 of exon 6 and a C&#8594;T transversion at nucleotide 11755 in exon 17. These mutations resulted in the replacement of valine by isoleucine at codon 424 (V424I, exon 6) and histidine by tyrosine at codon 3882 (H3882Y, exon 17). The proband's mother was heterozygous for the H3882Y mutation while the proband's younger sister was heterozygous for the V424I mutation, proving that the mutations were on opposite chromosomes in the proband. The proband's older sister was unaffected both clinically and molecularly. See Figure <figr fid="F1">1</figr>.</p>
            <p>The missense mutation V424I was subsequently genotyped in 200 healthy unaffected Caucasian controls using the primer pair and PCR conditions for exon 6 amplification. The amplified product was digested with restriction enzyme <it>Aat</it>II (New England Biolabs Inc., Ipswich, MA, USA). All healthy controls were homozygous for G at nucleotide 1381. Similarly, the missense mutation H3882Y was genotyped in 200 healthy unaffected Caucasian controls using the primer pair and PCR conditions for exon 17 amplification. The amplified product was digested using the restriction enzyme <it>Rsa</it>I (New England Biolabs Inc., Ipswich, MA, USA). Among the 200 controls, only 1 control was found to be heterozygous at nucleotide 11755 C/T, giving an allele frequency of 0.9975 for the C allele and 0.0025 for the T allele at this position, based on the Hardy-Weinberg equation. This suggests that the second heterozygote mutation, 11755 C&#8594;T, is present in the general population, albeit at a very low frequency.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Literature review and case discussion</p>
         </st>
         <p>The distribution of AS is global without any gender predilection. With an estimated prevalence of &lt; 1:100 000, only ~500 cases of AS have been reported in the literature thus far <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B7">7</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp>. Yet, a greater proportion of kindreds of English descent have been noted in the literature. Whether this is due to selection bias from kindreds in the United Kingdom or North America having more readily available health care access compared to kindreds from developing nations is uncertain. Certainly, awareness of AS is lacking despite the complexity and potential lethality of this disorder. Moreover, in addition to childhood obesity, affected individuals may develop insulin resistance, type 2 diabetes, and hypertriglyceridemia. Thus, AS can be thought of as a rare genetic disorder with several features similar to the common metabolic syndrome.</p>
         <sec>
            <st>
               <p>General clinical features</p>
            </st>
            <p>Prior to the recent discovery of <it>ALMS1 </it>mutations causative for AS, the diagnosis of AS was made solely based on phenotype. However, AS exhibits a great degree of phenotypic variability, even within families, thereby creating difficulties for a universal definition of AS <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. Recently, Marshall et al defined AS using age-specific criteria <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. See Table <tblr tid="T3">3</tblr>.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Diagnostic criteria for Alstrom syndrome [38]</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Age (years)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Major Criteria</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Minor Criteria</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Other supportive evidence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Diagnosis</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>&#8804; 2*</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; <it>ALMS </it>1 mutation in 1 allele and/or family history of AS</p>
                        <p>&#8226; Vision (nystagmus, photophobia)</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Obesity</p>
                        <p>&#8226; DCM/CHF</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Recurrent pulmonary infections</p>
                        <p>&#8226; Normal digits</p>
                        <p>&#8226; Delayed developmental milestones</p>
                     </c>
                     <c ca="center">
                        <p>2 major criteria</p>
                        <p>OR</p>
                        <p>1 major + 2 minor criteria</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3&#8211;14</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; <it>ALMS </it>1 mutation in 1 allele and/or family history of AS</p>
                        <p>&#8226; Vision (nystagmus, photophobia, decreased acuity, cone dystrophy by ERG**)</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Obesity and/or insulin resistance</p>
                        <p>&#8226; (History of) DCM/CHF</p>
                        <p>&#8226; Hearing loss</p>
                        <p>&#8226; Advanced bone age</p>
                        <p>&#8226; Hepatic dysfunction</p>
                        <p>&#8226; Renal failure</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Recurrent pulmonary infections</p>
                        <p>&#8226; Normal digits</p>
                        <p>&#8226; Delayed developmental milestones</p>
                        <p>&#8226; Hyperlipidemia</p>
                        <p>&#8226; Scoliosis</p>
                        <p>&#8226; Flat wide feet</p>
                        <p>&#8226; Hypothyroidism</p>
                        <p>&#8226; Hypertension</p>
                        <p>&#8226; GH deficiency</p>
                        <p>&#8226; Recurrent UTI</p>
                     </c>
                     <c ca="center">
                        <p>2 major criteria</p>
                        <p>OR</p>
                        <p>1 major + 3 minor criteria</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>&#8805; 15</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; <it>ALMS </it>1 mutation in 1 allele and/or family history of AS</p>
                        <p>&#8226; Vision (legal blindness, history of nystagmus in infancy/childhood, cone and rod dystrophy by ERG)</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Obesity and/or insulin resistance and/or DM2</p>
                        <p>&#8226; (History of) DCM/CHF</p>
                        <p>&#8226; Hearing loss</p>
                        <p>&#8226; Hepatic dysfunction</p>
                        <p>&#8226; Renal failure</p>
                        <p>&#8226; Short stature</p>
                        <p>&#8226; Males &#8211; hypogonadism</p>
                        <p>&#8226; Females &#8211; irregular menses and/or hyperandrogenism</p>
                     </c>
                     <c ca="left">
                        <p>&#8226; Recurrent pulmonary infections</p>
                        <p>&#8226; Normal digits</p>
                        <p>&#8226; History of developmental delay</p>
                        <p>&#8226; Hyperlipidemia</p>
                        <p>&#8226; Scoliosis</p>
                        <p>&#8226; Flat wide feet</p>
                        <p>&#8226; Hypothyroidism</p>
                        <p>&#8226; Hypertension</p>
                        <p>&#8226; GH deficiency</p>
                        <p>&#8226; Alopecia</p>
                        <p>&#8226; Recurrent UTI or urinary dysfunction</p>
                     </c>
                     <c ca="center">
                        <p>2 major + 2 minor criteria</p>
                        <p>OR</p>
                        <p>1 major + 4 minor criteria</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*These diagnostic criteria should be re-evaluated when the patient becomes older</p>
                  <p>** ERG to be conducted only if the child is old enough for testing</p>
                  <p>Abbreviations: AS, Alstrom syndrome; DCM/CHF, dilated cardiomyopathy/congestive heart failure; ERG, electroretinogram; GH, growth hormone; UTI, urinary tract infections; DM2, type 2 diabetes.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Neurosensory and cognitive features</p>
            </st>
            <p>Sensorineural hearing loss and congenital retinal dystrophy are two cardinal features of AS. In fact, pendular or searching nystagmus and photodysphoria are often evident before the age of 1 yr. There is initial loss of cone function followed by rod disintegration, ultimately leading to early blindness. By the age of 16, ~90% of affected individuals are blind <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. In addition, development of subcapsular cataracts may contribute to vision loss <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B6">6</abbr></abbrgrp>. Exudative retinopathy has also been reported in AS <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Meanwhile, ~80 % of affected individuals will develop bilateral sensorineural hearing loss <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. This usually occurs at a later age in childhood and is characterized by the initial loss of high frequency sounds. Progressive deterioration in hearing occurs, and is sometimes accompanied by conductive hearing loss due to chronic otitis media or glue ear <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. These early changes in neurosensory capabilities have tremendous impact not only on the social development of the child but also on his/her adaptation to the external environment.</p>
            <p>Although delay of cognitive development is not a common feature of AS, delay in developmental milestones is seen in ~45% of AS-affected children. Other neurologic manifestations may include absence seizures and general sleep disturbances <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The frequency of mood and psychiatric disorders in AS-affected individuals has not been determined.</p>
         </sec>
         <sec>
            <st>
               <p>Anthropometric and growth measures</p>
            </st>
            <p>Individuals with AS often have distinctive facial features, such as round face, deep-set eyes, thick ears, dental anomalies, hyperostosis frontalis interna, and premature frontal balding. Their toes and fingers are typically short and stubby with no polydactyly or syndactyly while their feet are typically noted to be wide and thick <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>.</p>
            <p>Childhood obesity is present in over 95% of individuals with AS <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. However, both waist circumference and body fat percentage (as measured using dual-energy X-ray absorptiometry) negatively correlated with age, independent of BMI, indicating the possible recruitment of more metabolically active fat stores <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The presence of hyperphagia has been controversial <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Although childhood is often accompanied by rapid growth with height above the 50<sup>th </sup>percentile before puberty, most individuals demonstrate a decreased adult height <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. This height discrepancy is supported by evidence for advancement of the bone age by 1&#8211;3 years prior to puberty as described by Marshall et al <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. As well, abnormalities of the insulin growth factor (IGF) system of affected patients have been demonstrated <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Yet, the exact reasons for short stature remain to be determined.</p>
         </sec>
         <sec>
            <st>
               <p>Endocrinologic features</p>
            </st>
            <p>Similar to the features of the metabolic syndrome seen in the general population, patients with AS also demonstrate hypertriglyceridemia and type 2 diabetes. Type 2 diabetes is diagnosed in over 80% of individuals above the age of 16 while insulin resistance and hyperinsulinemia have been demonstrated in individuals as young as 1 year old, even prior to the onset of obesity <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B38">38</abbr></abbrgrp>. Meanwhile, hypertriglyceridemia is seen in ~50% of affected individuals, with acute pancreatitis secondary to hypertriglyceridemia occurring in ~5% <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Other endocrinologic manifestations of AS include hypothyroidism, hypogonadism (particularly among men), alterations in the onset of puberty, ovarian cysts and hirsutism (among females), and short stature with abnormalities in the IGF-growth hormone system <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B13">13</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Cardiorespiratory features</p>
            </st>
            <p>Dilated cardiomyopathy (DCM), affecting ~60% of individuals, can occur at any age, but most typically during infancy. Although DCM is the most common underlying cause of death in the infantile period, survival with infantile-onset of DCM tends to be better than that for adult-onset DCM. Marshall et al showed that while one-third of adult-onset DCM patients died, ~74% of infantile-onset DCM patients survived <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. However, children and adults who have survived infantile-onset DCM are still susceptible to sudden recurrences <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. In addition to cardiac problems, AS-affected patients can have a variety of respiratory problems, including chronic asthma, sinusitis/bronchitis, alveolar hypoventilation and recurrent pneumonia <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Gastrointestinal and genitourinary involvement</p>
            </st>
            <p>Hepatic involvement in AS was first described in 1991 <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Approximately 80% of patients affected with AS may have hepatic involvement, ranging from mild elevation in liver transaminases to hepatic steatosis to overt cirrhosis with portal hypertension <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. Other gastrointestinal effects include upper gastrointestinal pain, chronic diarrhea, constipation, and gastroesophageal reflux <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>.</p>
            <p>Renal insufficiency occurs in ~50% of AS-affected individuals. Whether hypertension is a consequence of renal insufficiency or contributes to renal insufficiency is uncertain, but it is present in ~30% of individuals <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Urologic dysfunction is common in both men and women and can be manifest as urge incontinence, poor flow, urinary retention, or difficulty initiating voiding <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Urologic anatomical abnormalities can also occur in AS, including calyceal deformities, narrowed ureteropelvic angles, dilated ureters, and misalignment of the kidneys <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Differential diagnosis</p>
            </st>
            <p>It remains important to distinguish AS from other disorders characterized by childhood obesity and retinal dystrophy, such as the Laurence-Moon and Bardet-Biedl syndromes. Normal mentation and lack of poly/syndactyly help to distinguish AS from Bardet-Biedl, while deafness and the absence of spastic paraparesis help to differentiate AS from Laurence-Moon. Refsum disease is a rare disorder characterized by hearing loss, visual loss, and hepatic involvement, but also includes several features not associated with AS <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. See Table <tblr tid="T4">4</tblr> for clinical features of these disorders.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Differential diagnosis for Alstrom syndrome [41, 42]</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Alstrom syndrome</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Laurence- Moon syndrome</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Bardet- Biedl syndrome</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Refsum disease</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Inheritance</p>
                     </c>
                     <c ca="center">
                        <p>AR</p>
                     </c>
                     <c ca="center">
                        <p>AR</p>
                     </c>
                     <c ca="center">
                        <p>AR</p>
                     </c>
                     <c ca="center">
                        <p>AR</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Childhood Obesity</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Visual Impairment</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Sensorineural Deafness</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Short Stature</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-/+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Diabetes Mellitus</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Renal Disease</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Polydactyly/syndactyly</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mental Delay</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c>
                        <p>+/-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Hypogonadism</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dilated Cardiomyopathy</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-/+</p>
                     </c>
                     <c ca="center">
                        <p>-/+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Other</p>
                     </c>
                     <c ca="center">
                        <p>Hepatic Involvement</p>
                     </c>
                     <c ca="center">
                        <p>Spastic paraplegia</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>Anosmia Dysmorphic features Cerebellar ataxia Polyneuropathy</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: AR, autosomal recessive</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Genetic features of AS</p>
            </st>
            <p>AS is an autosomal-recessive disease that demonstrates intrafamilial and interfamilial variation. To date, a total of 81 disease-causing <it>ALMS1 </it>mutations have been reported, including the 2 reported from our group <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. A schematic representation of the normal <it>ALMS1 </it>gene and the <it>ALMS1 </it>mutations causative of AS are shown in Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>, <figr fid="F4">4</figr>.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Normal <it>ALMS1 </it>gene structure*</p>
               </caption>
               <text>
                  <p><b>Normal <it>ALMS1 </it>gene structure*</b>. * Figure 2 is not drawn to scale.</p>
               </text>
               <graphic file="1750-1172-2-49-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Reported <it>ALMS1 </it>Mutations for Exon 16*</p>
               </caption>
               <text>
                  <p><b>Reported <it>ALMS1 </it>Mutations for Exon 16*</b>. * Figure 3 is not drawn to scale.</p>
               </text>
               <graphic file="1750-1172-2-49-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Reported <it>ALMS1 </it>Mutations for Exons 6, 8, 10, 12, 17, 18*</p>
               </caption>
               <text>
                  <p><b>Reported <it>ALMS1 </it>Mutations for Exons 6, 8, 10, 12, 17, 18*</b>. * Figure 4 is not drawn to scale. The two novel mutations found in this study are shaded in gray. Other mutations not included in the figure are AC074008.5:g.124455_125899del and 10483C>T.</p>
               </text>
               <graphic file="1750-1172-2-49-4"/>
            </fig>
            <p>Affected individuals of most kindreds demonstrate compound heterozygosity with the majority of <it>ALMS1 </it>mutations reported being nonsense. Approximately 40% of all known <it>ALMS1 </it>mutations occur in exon 16 while other <it>ALMS1 </it>mutational hotspots include exon 10 (23%) and exon 8 (21%) <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Mutations in exon 16 have correlated with a more severe disease phenotype, manifest as early onset of retinal degeneration before the age of 1 year (p = 0.02), presence of urologic dysfunction (p = 0.02), occurrence of dilated cardiomyopathy (p = 0.03), and development of diabetes (p = 0.03). Meanwhile, the severity of renal disease in AS has correlated with mutations in exon 8 <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>.</p>
            <p>Among 250 AS-affected individuals examined, 15 synonymous single nucleotide polymorphisms (SNPs), 51 nonsynonymous SNPs, and a deletion of 3 nucleotides in exon 8 have also been described. Using prediction modeling, Marshall et al have determined that 8 of these variants are disease-causing <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. The most common <it>ALMS1 </it>mutation is c.10775delC, which is observed in 50% of reported English kindreds. Similarly, haplotype sharing has been demonstrated amongst members of Turkish kindreds, indicating the possibility of separate founder effects in both the English and the Turkish kindreds <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Discussion of our case</p>
            </st>
            <p>Our results indicate that <it>ALMS1 </it>mutations of V424I and H3882Y are the molecular basis for the Alstrom phenotype in the proband presented here. The H3882Y mutation was present in only 1 of 200 normal healthy controls while the V424I mutation was absent in all 200 controls. These two disease-causing mutations have not been reported before and represent the first mutation reported for exon 6 and the second reported for exon 17 <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Interestingly, the predicted frequency of homozygotes for the H3882Y mutation would be 1 in 160 000, signifying that, if homozygotes are affected, AS may indeed be more prevalent than previously thought.</p>
            <p>To date, with the 2 missense mutations of our kindred, there are a total of 10 missense AS-causing mutations. Marshall et al showed that the majority of kindreds affected by AS, as in our kindred, demonstrate compound heterozygote mutations <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. The V424I mutation localizes to the N-terminus of the ALMS1 protein while the H3882Y mutation localizes to the C-terminus of the protein <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Since even fragments of the N-terminus have been shown to be able to normalize the abnormal ciliary structure of <it>ALMS1 </it>knockout mice, it would be expected that isolated heterozygous mutations still including the relatively intact N-terminus would not necessarily result in significant clinical findings, as evidenced in our proband's mother and younger sister <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. The functional importance of the C-terminus remains to be determined. Importantly, no correlations could be drawn between the presence of a single <it>ALMS1 </it>mutation, as seen in the mother and younger sister, and abnormalities in any of the lipid parameters examined.</p>
            <p>Hypertriglyceridemia was evident in our proband and is a common finding among individuals affected with AS. Our proband had no documented episodes of pancreatitis, but was at high risk for pancreatitis given her significant hypertriglyceridemia. There can be multiple factors contributing to hypertriglyceridemia among AS-affected patients, including insulin resistance or diabetes, liver dysfunction, renal dysfunction, dietary factors, and alcohol intake. However, examination of a group of AS-affected individuals demonstrated no significant correlations between hepatic or renal function, BMI, or degree of glucose intolerance and high TG levels. Instead, there was indeed a major correlation between hyperinsulinemia and hypertriglyceridemia in that study <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Our proband demonstrated significant hypertriglyceridemia, accompanied by insulin resistance (type 2 diabetes), elevated BMI, and renal dysfunction. A multifaceted treatment approach resulted in improvements in TG and HDL-C to 3.30 mmol/L and 1.41 mmol/L, respectively, demonstrating that it is possible to effectively treat lipid abnormalities among AS-affected individuals.</p>
            <p>The correlation of mutations in exons 6 or 17 to phenotype remains to be determined. Interestingly, our proband did not have sensorineural deafness, which typically occurs in ~84% of affected individuals <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. No genotype-phenotype correlations have been made for sensorineural deafness <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. However, it is possible that mutations in exon 6 or 17 may not be associated with sensorineural deafness although further kindreds with these mutations are required to substantiate this possibility. Yet, the mutations in this proband seem to have resulted in an "intermediate-severity" phenotype as judged by an early onset of retinal degeneration, severe renal dysfunction, and significant elevation of TG levels, but a later development of diabetes and a lack of dilated cardiomyopathy.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have reported here two novel missense mutations in the <it>ALMS1 </it>gene causative for Alstrom syndrome in an English kindred. These extend the mutational spectrum in AS and provide a resource for mutational screening. Furthermore, we hope that these mutations may eventually add insight into the function of the ALMS1 protein and contribute to the understanding of the phenotypic variety observed among AS-affected individuals.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>TJ wrote the manuscript. HC participated in the design of the study and carried out all the molecular genetic studies for the family. GB examined the proband and suggested the diagnosis of AS in the proband, which resulted in molecular genetic testing. RM played a crucial role in the management of the proband. VC-M and PND conducted the examination of the proband and her family, obtained consent for molecular genetic testing, and drafted the manuscript. RAH conceived the design of the study and provided critical revisions to the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Retinal degeneration combined with obesity, diabetes mellitus and neurogenous deafness: a specific syndrome (not hitherto described) distinct from the Laurence-Moon-Bardet-Biedl syndrome: a clinical, endocrinological and genetic examination based on a large pedigree</p>
            </title>
            <aug>
               <au>
                  <snm>Alstrom</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Hallgren</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nilsson</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Asander</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Acta psychiatrica et neurologica Scandinavica</source>
            <pubdate>1959</pubdate>
            <volume>129</volume>
            <fpage>1</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubid idtype="pmpid">13649370</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Syndromic obesity and diabetes: changes in body composition with age and mutation analysis of ALMS1 in 12 United Kingdom kindreds with Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Minton</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Owen</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Ricketts</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Crabtree</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Shaikh</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ehtisham</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Porter</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Carey</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hodge</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Paisey</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barrett</snm>
                  <fnm>TG</fnm>
               </au>
            </aug>
            <source>The Journal of clinical endocrinology and metabolism</source>
            <pubdate>2006</pubdate>
            <volume>91</volume>
            <issue>8</issue>
            <fpage>3110</fpage>
            <lpage>3116</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1210/jc.2005-2633</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>New Alstrom syndrome phenotypes based on the evaluation of 182 cases</p>
            </title>
            <aug>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Bronson</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Collin</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Nordstrom</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Paisey</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Carey</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Macdermott</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Russell-Eggitt</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Shea</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shatirishvili</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Mihai</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Hoeltzenbein</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pozzan</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Hopkinson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Sicolo</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Naggert</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Nishina</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Archives of internal medicine</source>
            <pubdate>2005</pubdate>
            <volume>165</volume>
            <issue>6</issue>
            <fpage>675</fpage>
            <lpage>683</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archinte.165.6.675</pubid>
                  <pubid idtype="pmpid" link="fulltext">15795345</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Genealogy, natural history, and phenotype of Alstrom syndrome in a large Acadian kindred and three additional families</p>
            </title>
            <aug>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Ludman</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Shea</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Salisbury</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Willi</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>LaRoche</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Nishina</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>American journal of medical genetics</source>
            <pubdate>1997</pubdate>
            <volume>73</volume>
            <issue>2</issue>
            <fpage>150</fpage>
            <lpage>161</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-8628(19971212)73:2&lt;150::AID-AJMG9>3.0.CO;2-Y</pubid>
                  <pubid idtype="pmpid" link="fulltext">9409865</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Hypertriglyceridaemia in Alstrom's syndrome: causes and associations in 37 cases</p>
            </title>
            <aug>
               <au>
                  <snm>Paisey</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Carey</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Bower</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mansell</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Clinical endocrinology</source>
            <pubdate>2004</pubdate>
            <volume>60</volume>
            <issue>2</issue>
            <fpage>228</fpage>
            <lpage>231</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2265.2004.01952.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14725685</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Evaluation of insulin resistant diabetes mellitus in Alstrom syndrome: a long-term prospective follow-up of three siblings</p>
            </title>
            <aug>
               <au>
                  <snm>Satman</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Yilmaz</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Gursoy</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Karsidag</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Dinccag</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ovali</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Karadeniz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Uysal</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bugra</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Okten</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Devrim</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Diabetes research and clinical practice</source>
            <pubdate>2002</pubdate>
            <volume>56</volume>
            <issue>3</issue>
            <fpage>189</fpage>
            <lpage>196</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0168-8227(02)00004-9</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Mutation of ALMS1, a large gene with a tandem repeat encoding 47 amino acids, causes Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Hearn</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Renforth</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Spalluto</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hanley</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Piper</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Brickwood</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Connolly</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Russell-Eggitt</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bonneau</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>DI</fnm>
               </au>
            </aug>
            <source>Nature genetics</source>
            <pubdate>2002</pubdate>
            <volume>31</volume>
            <issue>1</issue>
            <fpage>79</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11941370</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Mutations in ALMS1 cause obesity, type 2 diabetes and neurosensory degeneration in Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Collin</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Ikeda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>So</snm>
                  <fnm>WV</fnm>
               </au>
               <au>
                  <snm>Russell-Eggitt</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Boerkoel</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Sicolo</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nishina</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Naggert</snm>
                  <fnm>JK</fnm>
               </au>
            </aug>
            <source>Nature genetics</source>
            <pubdate>2002</pubdate>
            <volume>31</volume>
            <issue>1</issue>
            <fpage>74</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11941369</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Subcellular localization of ALMS1 supports involvement of centrosome and basal body dysfunction in the pathogenesis of obesity, insulin resistance, and type 2 diabetes</p>
            </title>
            <aug>
               <au>
                  <snm>Hearn</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Spalluto</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Phillips</snm>
                  <fnm>VJ</fnm>
               </au>
               <au>
                  <snm>Renforth</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Copin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hanley</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>DI</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <issue>5</issue>
            <fpage>1581</fpage>
            <lpage>1587</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2337/diabetes.54.5.1581</pubid>
                  <pubid idtype="pmpid" link="fulltext">15855349</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>A role for Alstrom syndrome protein, alms1, in kidney ciliogenesis and cellular quiescence</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Vega</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nelms</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Gekakis</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Goodnow</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>McNamara</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Glynne</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>PLoS genetics</source>
            <pubdate>2007</pubdate>
            <volume>3</volume>
            <issue>1</issue>
            <fpage>e8</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1761047</pubid>
                  <pubid idtype="pmpid" link="fulltext">17206865</pubid>
                  <pubid idtype="doi">10.1371/journal.pgen.0030008</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Spectrum of ALMS1 variants and evaluation of genotype-phenotype correlations in Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hinman</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Collin</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cerqueira</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Milan</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>Hearn</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tavares</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Vettor</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Veronese</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>So</snm>
                  <fnm>WV</fnm>
               </au>
               <au>
                  <snm>Nishina</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Naggert</snm>
                  <fnm>JK</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2007</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17594715</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Exudative retinopathy in a girl with Alstrom syndrome due to a novel mutation</p>
            </title>
            <aug>
               <au>
                  <snm>Gogi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bond</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Long</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sheridan</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Woods</snm>
                  <fnm>CG</fnm>
               </au>
            </aug>
            <source>The British journal of ophthalmology</source>
            <pubdate>2007</pubdate>
            <volume>91</volume>
            <issue>7</issue>
            <fpage>983</fpage>
            <lpage>984</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/bjo.2005.088781</pubid>
                  <pubid idtype="pmpid" link="fulltext">17576719</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Characterization of the IGF system in 15 patients with Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Boschetti</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Paisey</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Resmini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Collin</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Naggert</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Milan</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Vettor</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Minuto</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sicolo</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Barreca</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Clinical endocrinology</source>
            <pubdate>2007</pubdate>
            <volume>66</volume>
            <issue>2</issue>
            <fpage>269</fpage>
            <lpage>275</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2265.2007.02721.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17223998</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Alstrom syndrome: progressive deafness and blindness</p>
            </title>
            <aug>
               <au>
                  <snm>Welsh</snm>
                  <fnm>LW</fnm>
               </au>
            </aug>
            <source>The Annals of otology, rhinology, and laryngology</source>
            <pubdate>2007</pubdate>
            <volume>116</volume>
            <issue>4</issue>
            <fpage>281</fpage>
            <lpage>285</lpage>
            <xrefbib>
               <pubid idtype="pmpid">17491528</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Alstrom syndrome in four sibs from northern Jordan</p>
            </title>
            <aug>
               <au>
                  <snm>Hamamy</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Barham</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Alkhawaldeh</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Cockburn</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Snowden</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ajlouni</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Annals of Saudi medicine</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <issue>6</issue>
            <fpage>480</fpage>
            <lpage>483</lpage>
            <xrefbib>
               <pubid idtype="pmpid">17146208</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Rare case of Alstrom syndrome without obesity and with short stature, diagnosed in adulthood</p>
            </title>
            <aug>
               <au>
                  <snm>Koc</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bayrak</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Suher</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ensari</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Aktas</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ensari</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nephrology (Carlton, Vic)</source>
            <pubdate>2006</pubdate>
            <volume>11</volume>
            <issue>2</issue>
            <fpage>81</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1440-1797.2006.00443.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16669965</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Familial variable expression of dilated cardiomyopathy in Alstrom syndrome: a report of four sibs</p>
            </title>
            <aug>
               <au>
                  <snm>Hoffman</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Jacobson</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Am J Med Genet A</source>
            <pubdate>2005</pubdate>
            <volume>135</volume>
            <issue>1</issue>
            <fpage>96</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15809999</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Alstrom syndrome: intrafamilial phenotypic variability in sibs with a novel nonsense mutation of the ALMS1 gene</p>
            </title>
            <aug>
               <au>
                  <snm>Titomanlio</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>De Brasi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Buoninconti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sperandeo</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Pepe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Andria</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sebastio</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Clinical genetics</source>
            <pubdate>2004</pubdate>
            <volume>65</volume>
            <issue>2</issue>
            <fpage>156</fpage>
            <lpage>157</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.0009-9163.2004.00204.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14984477</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>A rare case of Alstrom syndrome presenting with rapidly progressive severe dilated cardiomyopathy diagnosed by echocardiography</p>
            </title>
            <aug>
               <au>
                  <snm>Makaryus</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Popowski</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kort</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Paris</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Mangion</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Am Soc Echocardiogr</source>
            <pubdate>2003</pubdate>
            <volume>16</volume>
            <issue>2</issue>
            <fpage>194</fpage>
            <lpage>196</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mje.2003.1</pubid>
                  <pubid idtype="pmpid" link="fulltext">12574750</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Alstrom syndrome with acute pancreatitis: a case report</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Dia</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Hsieh</snm>
                  <fnm>MY</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>ZY</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>LY</fnm>
               </au>
               <au>
                  <snm>Tsai</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Chuang</snm>
                  <fnm>WL</fnm>
               </au>
            </aug>
            <source>The Kaohsiung journal of medical sciences</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <issue>7</issue>
            <fpage>358</fpage>
            <lpage>361</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12926522</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Three new cases of Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Benso</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hadjadj</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Conrath</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Denis</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie</source>
            <pubdate>2002</pubdate>
            <volume>240</volume>
            <issue>8</issue>
            <fpage>622</fpage>
            <lpage>627</lpage>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Alstrom syndrome: a case report</p>
            </title>
            <aug>
               <au>
                  <snm>Koray</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Dorter</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Benderli</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Satman</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Yilmaz</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Dinccag</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Karsidag</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Journal of oral science</source>
            <pubdate>2001</pubdate>
            <volume>43</volume>
            <issue>3</issue>
            <fpage>221</fpage>
            <lpage>224</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11732744</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Ophthalmologic and systemic features of the Alstrom syndrome: report of 9 cases</p>
            </title>
            <aug>
               <au>
                  <snm>Van den Abeele</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Craen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schuil</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Meire</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Bulletin de la Societe belge d'ophtalmologie</source>
            <pubdate>2001</pubdate>
            <issue>281</issue>
            <fpage>67</fpage>
            <lpage>72</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11702646</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Case of Alstrom syndrome with late presentation dilated cardiomyopathy</p>
            </title>
            <aug>
               <au>
                  <snm>Worthley</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Zeitz</snm>
                  <fnm>CJ</fnm>
               </au>
            </aug>
            <source>Internal medicine journal</source>
            <pubdate>2001</pubdate>
            <volume>31</volume>
            <issue>9</issue>
            <fpage>569</fpage>
            <lpage>570</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1445-5994.2001.00140.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11767878</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Alstrom syndrome with hepatic dysfunction: report of one case</p>
            </title>
            <aug>
               <au>
                  <snm>Chang</snm>
                  <fnm>KW</fnm>
               </au>
               <au>
                  <snm>Hou</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Kong</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Acta paediatrica Taiwanica = Taiwan er ke yi xue hui za zhi</source>
            <pubdate>2000</pubdate>
            <volume>41</volume>
            <issue>5</issue>
            <fpage>270</fpage>
            <lpage>272</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11100527</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Acute lymphoblastic leukemia in one of two siblings with Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>BH</fnm>
               </au>
               <au>
                  <snm>Chiou</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Tsai</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>YF</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Journal of the Formosan Medical Association = Taiwan yi zhi</source>
            <pubdate>2000</pubdate>
            <volume>99</volume>
            <issue>10</issue>
            <fpage>792</fpage>
            <lpage>795</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11061078</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Alstrom syndrome in two siblings</p>
            </title>
            <aug>
               <au>
                  <snm>Hung</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Jeng</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pei</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chou</snm>
                  <fnm>PI</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Journal of the Formosan Medical Association = Taiwan yi zhi</source>
            <pubdate>2001</pubdate>
            <volume>100</volume>
            <issue>1</issue>
            <fpage>45</fpage>
            <lpage>49</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11265260</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Early-onset liver disease complicated with acute liver failure in Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Quiros-Tejeira</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Vargas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ament</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>American journal of medical genetics</source>
            <pubdate>2001</pubdate>
            <volume>101</volume>
            <issue>1</issue>
            <fpage>9</fpage>
            <lpage>11</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajmg.1292</pubid>
                  <pubid idtype="pmpid" link="fulltext">11343329</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Alstrom syndrome. Report of 22 cases and literature review</p>
            </title>
            <aug>
               <au>
                  <snm>Russell-Eggitt</snm>
                  <fnm>IM</fnm>
               </au>
               <au>
                  <snm>Clayton</snm>
                  <fnm>PT</fnm>
               </au>
               <au>
                  <snm>Coffey</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kriss</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>1998</pubdate>
            <volume>105</volume>
            <issue>7</issue>
            <fpage>1274</fpage>
            <lpage>1280</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0161-6420(98)97033-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">9663233</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Hepatic dysfunction in two sibs with Alstrom syndrome: case report and review of the literature</p>
            </title>
            <aug>
               <au>
                  <snm>Awazu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sato</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Anzo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Higuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Matsuo</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>American journal of medical genetics</source>
            <pubdate>1997</pubdate>
            <volume>69</volume>
            <issue>1</issue>
            <fpage>13</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-8628(19970303)69:1&lt;13::AID-AJMG3>3.0.CO;2-U</pubid>
                  <pubid idtype="pmpid" link="fulltext">9066877</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>A 27-year-old woman with Alstrom syndrome who had liver cirrhosis</p>
            </title>
            <aug>
               <au>
                  <snm>Awazu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Higuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Matsuo</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>The Keio journal of medicine</source>
            <pubdate>1995</pubdate>
            <volume>44</volume>
            <issue>2</issue>
            <fpage>67</fpage>
            <lpage>73</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7658647</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>A case of Alstrom syndrome associated with diabetes insipidus</p>
            </title>
            <aug>
               <au>
                  <snm>Aynaci</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Okten</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mocan</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gedik</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sarpkaya</snm>
                  <fnm>AO</fnm>
               </au>
            </aug>
            <source>Clinical genetics</source>
            <pubdate>1995</pubdate>
            <volume>48</volume>
            <issue>3</issue>
            <fpage>164</fpage>
            <lpage>166</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8556827</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Alstrom syndrome: a case misdiagnosed as Bardet-Biedl syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Dyer</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Small</snm>
                  <fnm>KW</fnm>
               </au>
               <au>
                  <snm>Pai</snm>
                  <fnm>GS</fnm>
               </au>
            </aug>
            <source>Journal of pediatric ophthalmology and strabismus</source>
            <pubdate>1994</pubdate>
            <volume>31</volume>
            <issue>4</issue>
            <fpage>272</fpage>
            <lpage>274</lpage>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Impaired glucose tolerance leads to delayed diagnosis of Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Holder</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hecker</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gilli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Diabetes care</source>
            <pubdate>1995</pubdate>
            <volume>18</volume>
            <issue>5</issue>
            <fpage>698</fpage>
            <lpage>700</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2337/diacare.18.5.698</pubid>
                  <pubid idtype="pmpid">8586011</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Natural history of Alstrom syndrome in early childhood: onset with dilated cardiomyopathy</p>
            </title>
            <aug>
               <au>
                  <snm>Michaud</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Heon</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Guilbert</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Weill</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Puech</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Benson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Smallhorn</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Shuman</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Buncic</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Levin</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Weksberg</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Breviere</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>The Journal of pediatrics</source>
            <pubdate>1996</pubdate>
            <volume>128</volume>
            <issue>2</issue>
            <fpage>225</fpage>
            <lpage>229</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-3476(96)70394-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">8636816</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Growth hormone deficiency in two siblings with Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Alter</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Moshang</snm>
                  <fnm>T</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>American journal of diseases of children (1960)</source>
            <pubdate>1993</pubdate>
            <volume>147</volume>
            <issue>1</issue>
            <fpage>97</fpage>
            <lpage>99</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8418611</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>The Alstrom syndrome. Report of three cases with further delineation of the clinical, pathophysiological, and genetic aspects of the disorder</p>
            </title>
            <aug>
               <au>
                  <snm>Goldstein</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Fialkow</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>Medicine</source>
            <pubdate>1973</pubdate>
            <volume>52</volume>
            <issue>1</issue>
            <fpage>53</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00005792-197301000-00003</pubid>
                  <pubid idtype="pmpid">4689172</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Alstrom syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Marshall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maffei</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Naggert</snm>
                  <fnm>JK</fnm>
               </au>
            </aug>
            <source>Eur J Hum Genet</source>
            <pubdate>2007</pubdate>
            <volume>15</volume>
            <issue>12</issue>
            <fpage>1193</fpage>
            <lpage>1202</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.ejhg.5201933</pubid>
                  <pubid idtype="pmpid" link="fulltext">17940554</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Hepatic dysfunction in Alstrom disease</p>
            </title>
            <aug>
               <au>
                  <snm>Connolly</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Jan</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Couch</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>LT</fnm>
               </au>
               <au>
                  <snm>Dimmick</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Rigg</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>American journal of medical genetics</source>
            <pubdate>1991</pubdate>
            <volume>40</volume>
            <issue>4</issue>
            <fpage>421</fpage>
            <lpage>424</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajmg.1320400408</pubid>
                  <pubid idtype="pmpid">1746604</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Dysmorphic syndrome with phytanic acid oxidase deficiency, abnormal very long chain fatty acids, and pipecolic acidemia: studies in four children</p>
            </title>
            <aug>
               <au>
                  <snm>Budden</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Kennaway</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Buist</snm>
                  <fnm>NR</fnm>
               </au>
               <au>
                  <snm>Poulos</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Weleber</snm>
                  <fnm>RG</fnm>
               </au>
            </aug>
            <source>The Journal of pediatrics</source>
            <pubdate>1986</pubdate>
            <volume>108</volume>
            <issue>1</issue>
            <fpage>33</fpage>
            <lpage>39</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-3476(86)80765-X</pubid>
                  <pubid idtype="pmpid">2418187</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>A review of the literature of Bardet-Biedl disease and report of three cases associated with metabolic syndrome and diagnosed after the age of fifty</p>
            </title>
            <aug>
               <au>
                  <snm>Iannello</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bosco</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cavaleri</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Camuto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Milazzo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Belfiore</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Obes Rev</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <issue>2</issue>
            <fpage>123</fpage>
            <lpage>135</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1467-789X.2002.00055.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12120419</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Refsum disease, peroxisomes and phytanic acid oxidation: a review</p>
            </title>
            <aug>
               <au>
                  <snm>Wanders</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Jansen</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Skjeldal</snm>
                  <fnm>OH</fnm>
               </au>
            </aug>
            <source>J Neuropathol Exp Neurol.</source>
            <pubdate>2001</pubdate>
            <volume>60</volume>
            <issue>11</issue>
            <fpage>1021</fpage>
            <lpage>1031</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid>11706932</pubid>
                  <pubid idtype="pmpid" link="fulltext">11706932</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
