<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1746-1448-3-4</ui>
   <ji>1746-1448</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Inter- and intraspecific genetic and morphological variation in a sibling pair of carabid species</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Dhuyvetter</snm>
               <fnm>Hilde</fnm>
               <insr iid="I1"/>
               <email>hilde.dhuyvetter@naturalsciences.be</email>
            </au>
            <au id="A2">
               <snm>Maelfait</snm>
               <fnm>Jean-Pierre</fnm>
               <insr iid="I2"/>
               <email>jeanpierre.maelfait@inbo.be</email>
            </au>
            <au id="A3">
               <snm>Desender</snm>
               <fnm>Konjev</fnm>
               <insr iid="I1"/>
               <email>konjev.desender@naturalsciences.be</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Entomology Department, Royal Belgian Institute of Natural Sciences, Vautierstreet 29, Brussels, Belgium</p>
            </ins>
            <ins id="I2">
               <p>Instituut voor natuur- en bosonderzoek, Brussels, Belgium</p>
            </ins>
         </insg>
         <source>Saline Systems</source>
         <issn>1746-1448</issn>
         <pubdate>2007</pubdate>
         <volume>3</volume>
         <issue>1</issue>
         <fpage>4</fpage>
         <url>http://www.salinesystems.org/content/3/1/4</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17456232</pubid>
               <pubid idtype="doi">10.1186/1746-1448-3-4</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>24</day>
               <month>1</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>24</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>24</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Dhuyvetter et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p><it>Pogonus littoralis </it>and <it>Pogonus chalceus </it>are very close related species with quite different ecological preferences within salt marshes. We study the evolutionary processes in and between these presumably young species. Therefore, we compare the variation in ecologically relevant characters and the genetic variation within one of the species (intraspecific differentiation) with the variation of the two types of characters between the two species (interspecific variation). Data are compared between two independent sets of populations, one set at a small geographical scale (the ecologically diverse Gu&#233;rande area in France) and the other set at a Atlantic-Mediterranean scale.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Body and relative wing size and <it>IDH1 </it>allozyme data show that the intraspecific variation in <it>P. chalceus </it>is high and in the same range as the interspecific variation (<it>P. chalceus </it>versus <it>P. littoralis</it>). Based on neutral markers (other allozymes and mitochondrial DNA) on the other hand, the intraspecific variation in <it>P. chalceus </it>is much lower in comparison to the interspecific variation.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The different ecotypes in the highly polytypic species <it>P. chalceus </it>are as highly differentiated in ecological characters as true species, but are not recognised as such by screening neutral DNA polymorphisms. This can be interpreted as a case of ongoing speciation driven by natural selection adapting each ecotype to its respective ecological niche. The same ecological process can be recognised in the differentiation between the two sister species, where en plus reproductive isolation between the two gene pools occurred, allowing independent drift and mutation accumulation in neutral genetic characters.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Pogonus chalceus </it>is a wing polymorphic beetle with extremely variable wing size from short to completely developed wings, with all possible intermediates <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. A recent study presented population genetic results on <it>P. chalceus </it>(Marsham, 1802) beetles from the Gu&#233;rande salt-fields on the French Atlantic coast, based on allozymes and microsatellites, as well as results on wing and body size <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In the unique man made Gu&#233;rande salt-fields, two contrasting habitat types are found mixed on a microscale in hundreds of replicates (sea canal versus salt extraction ponds). Body, relative wing size and <it>IDH1 </it>allozyme alleles are strongly divergent between these two contrasting microhabitats; divergent selection led to two clearly distinguishable ecotypes, respectively adapted to canal and pond habitat. Comparisons between the Gu&#233;rande region (microscale) and populations along the Atlantic coast (macroscale) confirmed the generality of the hypothesis regarding ecological processes responsible for this differentiation: habitat stability <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The Gu&#233;rande ecotypes are also slightly differentiated based on neutral molecular markers (microsatellites and allozymes), suggesting that partial barriers to gene flow between the two ecotypes are present. Previous work on a wide range of taxa has demonstrated that strong natural selection can lead to divergence in spite of gene flow <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Our Gu&#233;rande results can therefore be interpreted as a case of ongoing speciation driven by natural selection adapting each ecotype to its respective ecological niche, i.e. species in <it>status nascenti </it>(see also <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>).</p>
         <p>In the same Gu&#233;rande region and along the European Atlantic and Mediterranean coast, another <it>Pogonus </it>species, <it>P. littoralis </it>(Duftschmid, 1812) lives in a third kind of microhabitat: unvegetated, temporary dry salt marsh ponds or creeks, where it lives between cracks in humid sea clay. This species is, in contrast to <it>P. chalceus</it>, constantly macropterous, always with maximally developed wings and functional flight musculature <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. The beetle is highly mobile because it regularly has to move between temporarily dry salt marsh ponds and creeks during its life cycle. Both species can be hardly distinguished by external morphology (for example large individuals of <it>P</it>. <it>chalceus </it>versus small <it>P. littoralis</it>) but have clearly distinguishable genitalia.</p>
         <p>The data in this article are to some extent compiled from previous works <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Nevertheless, the novelty of this study lies in the fact for the first time the two carabid sister species are analyzed jointly allowing for valuable comparisons to be made. In this study, we will first compare the two ecotypes of <it>Pogonus chalceus </it>with the closely related species, <it>Pogonus littoralis </it>at a microscale (Gu&#233;rande region). Therefore, we will use population data on wing and body size, <it>IDH1 </it>allozyme polymorphism as well as apparently neutral markers (other allozymes and mtDNA). We will also test if the microscale results are valid at a larger scale across Europe by means of an independent data set of different populations of both <it>Pogonus </it>species. In all of these cases, we will evaluate the contribution of intra population, inter population, inter ecotype and interspecific variation to the total variance.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Body size</p>
            </st>
            <p>Fig. <figr fid="F1">1</figr> shows male body size for both <it>P. chalceus </it>ecotypes and for the <it>P. littoralis </it>populations in the Gu&#233;rande region [see also additional file <supplr sid="S1">1</supplr>]. Mean body size for the pond populations is small (3.56; range: 2.9&#8211;4.2), intermediate for the canal populations (4.08; 3.4&#8211;4.6) and high for the <it>P. littoralis </it>populations (4.69; range: 3.9&#8211;5.1). Body size values for the females show a similar pattern but are always larger than male body sizes. Mean female body size is 3.91 for the canal populations (range: 3.4&#8211;4.3), 4.52 for the pond populations (range: 3.4&#8211;5.0) and 4.89 for the <it>P. littoralis </it>populations (range: 4.3&#8211;5.3).</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>Number of males and females for which body size and wing size is measured and number of individuals used for <it>IDH1 </it>allozyme electrophoresis in the Gu&#233;rande populations.</p>
               </text>
               <file name="1746-1448-3-4-S1.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Male (part A) and female (part B) body size frequency distributions</p>
               </caption>
               <text>
                  <p><b>Male (part A) and female (part B) body size frequency distributions</b>. In the upper part of A and B: Gu&#233;rande canal populations (black solid line; <it>Pogonus chalceus</it>), pond populations (black dotted line; <it>Pogonus chalceus</it>) and <it>Pogonus littoralis </it>populations (gray dashed line). In the lower part of A and B: European stable populations (<it>P. chalceus</it>; black solid line), intermediate populations (<it>P. chalceus</it>; black dotted line), temporary Atlantic and Mediterranean populations (gray filled; <it>P. chalceus</it>) and <it>Pogonus littoralis </it>populations (gray dashed line). Figure legend text.</p>
               </text>
               <graphic file="1746-1448-3-4-1"/>
            </fig>
            <p>Fig. <figr fid="F1">1</figr> also shows male and female body sizes for the <it>P. chalceus </it>ecological groups and for the <it>P. littoralis </it>populations on a European scale [see also additional file <supplr sid="S2">2</supplr>]. Mean male body size is small for the stable (3.68; range: 3.2&#8211;4.3) and intermediate <it>P. chalceus </it>populations (3.68; range 3&#8211;4.3), somewhat higher for the temporary populations (mean: 3.92; range: 3.4&#8211;4.6) and high for the <it>P. littoralis </it>(mean: 4.32; range: 3.6&#8211;4.8) ones. Body size values of females show again a similar pattern and are always larger than male body sizes. Mean female body size is 4.04 for the stable <it>P. chalceus </it>populations (range: 3.2 to 4.6) compared to 4.11 for the intermediate populations (range: 3.1 to 4.7) and 4.3 for the temporary <it>P. chalceus </it>populations (range: 3.4 to 4.8) and 4.6 for the <it>P. littoralis </it>populations (4.1&#8211;5.2).</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>Number of males and females for which body size and wing size is measured and number of individuals used for <it>IDH1 </it>allozyme electrophoresis in the different populations on a European scale.</p>
               </text>
               <file name="1746-1448-3-4-S2.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>In the Gu&#233;rande region and considering the two species (nested design ANOVA; six <it>P. chalceus </it>populations (canals and ponds pooled) versus three <it>P. littoralis </it>populations, the major part of variance (based on body size) is found among species (Table <tblr tid="T1">1</tblr>; 74.24% for males and 51.96% for females). If we consider three groups (three canal populations (<it>P. chalceus</it>), three pond populations (<it>P. chalceus</it>) and three <it>P. littoralis </it>populations, the major part of variance is even more pronouncedly found among groups (84.96% for males and 72.08% for females). Variance among populations within groups considering three groups instead of two drops from 17.5 to 2.35% for males and from 29.57 to 4.28% for females. This indicates that this variance was almost completely due to the differences in body size between populations of <it>P. chalceus </it>from different microhabitats. All variance components are statistically significant.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Analysis of variance (nested design ANOVA) based on male or female body size in two regions: Gu&#233;rande microscale and Europe macroscale</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>region</p>
                     </c>
                     <c ca="left">
                        <p>groups</p>
                     </c>
                     <c ca="left">
                        <p>source of variation</p>
                     </c>
                     <c ca="left">
                        <p>% var male</p>
                     </c>
                     <c ca="left">
                        <p>% var female</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gu&#233;rande</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>74.24</p>
                     </c>
                     <c ca="left">
                        <p>51.96</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>17.50</p>
                     </c>
                     <c ca="left">
                        <p>29.57</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>8.26</p>
                     </c>
                     <c ca="left">
                        <p>18.47</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ponds/canals/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>84.96</p>
                     </c>
                     <c ca="left">
                        <p>72.08</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>2.35</p>
                     </c>
                     <c ca="left">
                        <p>4.28</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>12.69</p>
                     </c>
                     <c ca="left">
                        <p>23.63</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Europe</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>68.37</p>
                     </c>
                     <c ca="left">
                        <p>48.37</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>10.13</p>
                     </c>
                     <c ca="left">
                        <p>12.29</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>21.51</p>
                     </c>
                     <c ca="left">
                        <p>39.35</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>stable/intermediate/temporary/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>49.39</p>
                     </c>
                     <c ca="left">
                        <p>33.87</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>5.00</p>
                     </c>
                     <c ca="left">
                        <p>7.61</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>45.62</p>
                     </c>
                     <c ca="left">
                        <p>58.53</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>On a European scale and considering the two species (25 <it>P. chalceus </it>populations versus six <it>P. littoralis</it>), the major part of variance (based on body size) is found among species (Table <tblr tid="T1">1</tblr>; 68.37% for males and 48.37% for females). If we consider four ecological groups (14 temporary (<it>P. chalceus</it>), five intermediate (<it>P. chalceus</it>), six stable (<it>P. chalceus</it>) and five <it>P. littoralis</it>), the variance among groups drops (49.39% for males and 33.87% for females) and the variance within populations augments (45.62% for males and 58.53% for females). Variance among populations within groups considering four groups instead of two drops a little from 10.13 to 5% for males and from 12.29 to 7.61% for females. All variance components are statistically significant.</p>
         </sec>
         <sec>
            <st>
               <p>Relative wing size</p>
            </st>
            <p>Fig. <figr fid="F2">2</figr> shows male and female relative wing sizes for both <it>P. chalceus </it>microhabitats and for the <it>P. littoralis </it>populations in the Gu&#233;rande region [see also additional file <supplr sid="S1">1</supplr>]. Mean male relative wing size for the canal populations is small (28.19; range: 20&#8211;35%), intermediate for the ponds (mean: 64.24; range: 25&#8211;82.5%) and high for the <it>P. littoralis </it>populations (mean: 103.59; range: 92.5&#8211;112.5%). Relative wing size values of females show a similar pattern and are not larger than male relative wing sizes. Mean female relative wing size for the canals is 26.93 (range: 17.5&#8211;32.5%), 62.31 for the ponds (range: 25&#8211;80%) and 103.04 for the <it>P. littoralis </it>populations (range: 92.5&#8211;110%).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Male (part A) and female (part B) relative wing size frequency distributions</p>
               </caption>
               <text>
                  <p><b>Male (part A) and female (part B) relative wing size frequency distributions</b>. In the upper part of A and B: Gu&#233;rande canal populations (black solid line; <it>Pogonus chalceus</it>), pond populations (black dotted line; <it>Pogonus chalceus</it>) and <it>Pogonus littoralis </it>populations (gray dashed line). In the lower part of A and B: European stable populations (<it>P. chalceus</it>; black solid line), intermediate populations (<it>P. chalceus</it>; black dotted line), temporary Atlantic and Mediterranean populations (gray filled; <it>P. chalceus</it>) and <it>Pogonus littoralis </it>populations (gray dashed line).</p>
               </text>
               <graphic file="1746-1448-3-4-2"/>
            </fig>
            <p>Fig. <figr fid="F2">2</figr> also shows male and female relative wing size in ecological groups of <it>P. chalceus </it>and of <it>P. littoralis </it>populations on a European scale [see also additional file <supplr sid="S2">2</supplr>]. Mean male relative wing size is small for the populations of the old, highly stable salt marsh areas (35.28; range: 22.5&#8211;62.5%), some higher for the populations of the salt marshes of intermediate stability (mean: 51.07; range: 25&#8211;85%), higher for the populations of the small, unstable areas (mean: 82.23, range: 27.5&#8211;105%) and very high for the <it>P. littoralis </it>populations (mean: 106.16; range: 90&#8211;112.5%). Relative wing size values of females show a similar pattern and are not larger or smaller than male relative wing sizes. Mean female relative wing size for the stable populations is 33.43 (range: 20&#8211;82.5%) compared to 49.91 for the populations of intermediate stability situations (range: 25&#8211;85%), 80.41 for the temporary populations of the highly unstable salt marshes (range: 40&#8211;97.5%) and 107 for the <it>P. littoralis </it>populations (range: 92.5&#8211;115%).</p>
            <p>In the Gu&#233;rande region and considering the two species (nested design ANOVA; six <it>P. chalceus </it>populations (canals and ponds pooled) and three <it>P. littoralis </it>populations), the major part of variance (based on relative wing size) is found among species (Table <tblr tid="T2">2</tblr>; 78.84% for males and 80.37% for females). If we consider three groups (three canal populations (<it>P. chalceus</it>), three pond populations (<it>P. chalceus</it>) and three <it>P. littoralis </it>populations), the major part of variance is even more clearly found among groups (95.48% for males and 93.92% for females). Variance among populations within groups considering three groups instead of two drops from 18.64 to 0.64% for males and from 16.21 to 0.8% for females. This indicates that this variance is almost completely due to the differences in relative wing size between populations of <it>P. chalceus </it>from different microhabitats. All variance components are statistically significant.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Analysis of variance (nested design ANOVA) based on male or female relative wing size in two regions: Gu&#233;rande microscale and Europe macroscale</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>groups</p>
                     </c>
                     <c ca="left">
                        <p>source of variation</p>
                     </c>
                     <c ca="left">
                        <p>% var male</p>
                     </c>
                     <c ca="left">
                        <p>% var female</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gu&#233;rande</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>78.84</p>
                     </c>
                     <c ca="left">
                        <p>80.37</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>18.64</p>
                     </c>
                     <c ca="left">
                        <p>16.21</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>2.52</p>
                     </c>
                     <c ca="left">
                        <p>3.43</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ponds/canals/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>95.48</p>
                     </c>
                     <c ca="left">
                        <p>93.92</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>0.64</p>
                     </c>
                     <c ca="left">
                        <p>0.80</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>3.88</p>
                     </c>
                     <c ca="left">
                        <p>5.58</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Europe</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>57.61</p>
                     </c>
                     <c ca="left">
                        <p>60.16</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>36.11</p>
                     </c>
                     <c ca="left">
                        <p>32.80</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>6.28</p>
                     </c>
                     <c ca="left">
                        <p>7.05</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>stable/intermediate/temporary/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>82.22</p>
                     </c>
                     <c ca="left">
                        <p>82.58</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>6.34</p>
                     </c>
                     <c ca="left">
                        <p>6.89</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>11.45</p>
                     </c>
                     <c ca="left">
                        <p>10.54</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>On a European scale and considering the two species (25 <it>P. chalceus </it>populations versus six <it>P. littoralis </it>populations), the major part of variance (based on relative wing size) is found among species (Table <tblr tid="T2">2</tblr>; 57.61% for males and 60.16% for females). If we consider four ecological groups (14 temporary (<it>P. chalceus</it>), five intermediate (<it>P. chalceus</it>), six stable (<it>P. chalceus</it>) and six <it>P. littoralis </it>populations), the major part of variance is again even more pronounced among groups (82.22% for males and 82.58% for females). Variance among populations within groups considering four groups instead of two drops from 36.11 to 6.34% for males and from 32.8 to 6.89% for females. This indicates that this variance is again almost completely due to the differences in relative wing size between populations of <it>P. chalceus </it>from different ecological or salt marsh area stability groups. All variance components are statistically significant.</p>
         </sec>
         <sec>
            <st>
               <p>IDH1 allozyme marker</p>
            </st>
            <p>In Gu&#233;rande, both <it>Idh1-2 </it>and <it>Idh1-4 </it>alleles are frequent in ponds, whereas canals are nearly fixed at <it>Idh1-4 </it>(Fig. <figr fid="F3">3A</figr>) [see also additional file <supplr sid="S1">1</supplr>]. <it>P. littoralis </it>populations are fixed at the <it>Idh1-6 </it>allele. Allele <it>Idh1-1</it>, <it>Idh1-3</it>, and <it>Idh1-5 </it>are very rare in <it>P. chalceus </it>and therefore not shown in Figure <figr fid="F4">4</figr>. Considering the two species (AMOVA; six <it>P. chalceus </it>populations (canals and ponds pooled) and three <it>P. littoralis</it>), the major part of variance (based on <it>IDH1</it>) is found among groups (Table <tblr tid="T3">3</tblr>; 61.93%). If we consider three groups (three canal populations (<it>P. chalceus</it>), three pond populations (<it>P. chalceus</it>) and three <it>P. littoralis </it>populations, the major part of variance is still found among groups (64.25%). Variance among populations within groups considering three groups instead of two drops from 11.49 to 0.1%. This indicates that this variance is almost completely due to differences in <it>IDH1 </it>between populations of <it>P. chalceus </it>from different microhabitats. All variance components are statistically significant.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Analysis of molecular variance (AMOVA) based on <it>IDH1 </it>allozyme or 4 neutral allozymes in two regions: Gu&#233;rande microscale and Europe macroscale</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>groups</p>
                     </c>
                     <c ca="left">
                        <p>source of variation</p>
                     </c>
                     <c ca="left">
                        <p>% var <it>IDH1</it></p>
                     </c>
                     <c ca="left">
                        <p>% var allo</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gu&#233;rande</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>61.93</p>
                     </c>
                     <c ca="left">
                        <p>58.43</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>11.49</p>
                     </c>
                     <c ca="left">
                        <p>3.39</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>26.57</p>
                     </c>
                     <c ca="left">
                        <p>39.18</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ponds/canals/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>64.25</p>
                     </c>
                     <c ca="left">
                        <p>41.99</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>0.1</p>
                     </c>
                     <c ca="left">
                        <p>4.98</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>35.65</p>
                     </c>
                     <c ca="left">
                        <p>53.02</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Europe</p>
                     </c>
                     <c ca="left">
                        <p><it>P. chalceus</it>/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>62.29</p>
                     </c>
                     <c ca="left">
                        <p>36.49</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>12.26</p>
                     </c>
                     <c ca="left">
                        <p>13.70</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>25.44</p>
                     </c>
                     <c ca="left">
                        <p>49.81</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>stable/intermediate/temporary/<it>P. littoralis</it></p>
                     </c>
                     <c ca="left">
                        <p>among groups</p>
                     </c>
                     <c ca="left">
                        <p>53.26</p>
                     </c>
                     <c ca="left">
                        <p>19.05</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>among populations within groups</p>
                     </c>
                     <c ca="left">
                        <p>2.07</p>
                     </c>
                     <c ca="left">
                        <p>15.71</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>within populations</p>
                     </c>
                     <c ca="left">
                        <p>44.67</p>
                     </c>
                     <c ca="left">
                        <p>65.24</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Allele frequencies for <it>IDH1 </it>in the Gu&#233;rande region (part A; cnals (P. chalceus) and ponds (<it>P. chalceus</it>) and <it>P. littoralis</it>)</p>
               </caption>
               <text>
                  <p><b>Allele frequencies for <it>IDH1 </it>in the Gu&#233;rande region (part A; cnals (P. chalceus) and ponds (<it>P. chalceus</it>) and <it>P. littoralis</it>)</b>. Allele frequencies for <it>IDH1 </it>on a European scale (part B; stable (<it>P</it>. <it>chalceus</it>) and intermediate (<it>P. chalceus</it>), temporary and <it>P. littoralis</it>). <it>Idh1-2</it>: black, <it>Idh1-4</it>: light gray; <it>Idh1-6</it>: dark gray.</p>
               </text>
               <graphic file="1746-1448-3-4-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Neighbour joining tree based on COI haplotypes described in Table 2</p>
               </caption>
               <text>
                  <p><b>Neighbour joining tree based on COI haplotypes described in Table 2</b>. Haplotype 1&#8211;4 are found in <it>P. chalceus </it>and haplotype 5&#8211;9 in <it>P. littoralis</it>. Bootstrap values are indicated (1000 replicates).</p>
               </text>
               <graphic file="1746-1448-3-4-4"/>
            </fig>
            <p>At a European scale, both <it>Idh1-2 </it>and <it>Idh1-4 </it>alleles are frequent in the intermediate stability populations, whereas the temporary populations are nearly fixed at the <it>Idh1-2 </it>allele and the stable populations at the <it>Idh1-4 </it>allele (Fig. <figr fid="F3">3B</figr>) [see also additional file <supplr sid="S2">2</supplr>]. <it>P. littoralis </it>populations are fixed at the <it>Idh1-6 </it>allele. Considering two groups (25 <it>P. chalceus </it>populations versus six <it>P. littoralis </it>populations, the major part of variance (based on <it>IDH1</it>) is found among groups (Table <tblr tid="T3">3</tblr>; 62.29%). If we consider four ecological groups (14 temporary (<it>P. chalceus</it>), five intermediately stable (<it>P. chalceus</it>), six highly stable (<it>P. chalceus</it>) and six <it>P. littoralis </it>populations, the major part of variance is somewhat lower but is still found among groups (53.26%). Variance among populations within groups, considering four groups instead of two, drops from 12.26 to 2.07%. This indicates that this variance is almost completely due to differences in <it>IDH1 </it>between populations of <it>P. chalceus </it>from different ecological groups, as <it>P. littoralis </it>is fixed in a different allele. All variance components are statistically significant.</p>
         </sec>
         <sec>
            <st>
               <p>Other allozymes</p>
            </st>
            <p>The number of studied individuals and allozyme allele frequencies for each population in the Gu&#233;rande region is given in additional file <supplr sid="S3">3</supplr>. In the Gu&#233;rande and considering two groups (AMOVA; six <it>P. chalceus </it>populations (canals and ponds) versus three <it>P. littoralis </it>populations), the major part of variance (based on four neutral allozymes) is found between species (Table <tblr tid="T3">3</tblr>; 58.43%). If we consider three groups (three canal populations (<it>P. chalceus</it>), three pond populations (<it>P. chalceus</it>) and three <it>P. littoralis </it>populations, the variance among groups drops to 41.99% and the major part of variance is now found within populations (53.02%). Variance among populations within groups considering three groups instead of two remains in the same range (3.39% for two groups compared to 4.98% for three groups).</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p>Allele frequencies from four allozymes (<it>AO</it>, <it>IDH2</it>, <it>PGI</it>, <it>PGM</it>) studied in the Gu&#233;rande populations. <it>N</it>: number of studied individuals.</p>
               </text>
               <file name="1746-1448-3-4-S3.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>The number of studied individuals and allozyme allele frequencies for each population at a European scale is given in additional file <supplr sid="S4">4</supplr>. At a European scale and considering two groups (AMOVA; 25 <it>P. chalceus </it>populations and six <it>P. littoralis </it>populations), the major part of variance (based on four neutral allozymes) is found within populations (Table <tblr tid="T3">3</tblr>; 49.81%) and among groups (36.49%). If we consider four ecological groups (14 temporary (<it>P. chalceus</it>), five intermediately stable (<it>P. chalceus</it>), six highly stable (<it>P. chalceus</it>) and six <it>P. littoralis </it>populations, the variance among groups drops to 19.05% and the major part of variance is still found within populations (65.24%). Variance among populations within groups considering four groups instead of two remains in the same range (13.70% for two groups compared to 15.71% for four groups). All variance components are statistically significant.</p>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p>Allele frequencies from four allozymes (<it>AO</it>, <it>IDH2</it>, <it>PGI</it>, <it>PGM</it>) studied in the European populations. <it>N</it>: number of studied individuals.</p>
               </text>
               <file name="1746-1448-3-4-S4.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Mitochondrial DNA</p>
            </st>
            <p>The 459-bp COI mitochondrial sequences revealed two haplotypes in the Gu&#233;rande region. Haplotype one was shared by individuals of both canal and pond ecotype. Haplotype two was exclusive to the canal ecotype (Table <tblr tid="T4">4</tblr>). The 497-bp 16S sequences revealed only one haplotype in the Gu&#233;rande region (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>459 bp of COI sequenced for 90 individuals of <it>P. chalceus </it>and 22 of <it>P. littoralis </it></p>
               </caption>
               <tblbdy cols="33">
                  <r>
                     <c cspan="33" ca="left">
                        <p>GATTAGTTCCTTTAATATT<b>x</b>AGCACC<b>x</b>GATATAGC<b>x</b>TTTCCTCGAATAAATAATATAAGTTTTTGA<b>x</b>TATTACCTCCTTC<b>x</b>TTAACACTACTTTTAATAAG<b>x</b>AG<b>x</b></p>
                        <p>. . . . . . . . . . . . . . . . .1. . . . . . .2. . . . . . . .3 . . . . . . . . . . . . . . . . . . . . . . . . . . 4 . . . . . . . . . . . 5. . . . . . . . . . . . . . . . . . 6. . 7</p>
                        <p>ATGGTAGAAAGAGG<b>x</b>GCTGGTACAGGATGAACTGT<b>x</b>TA<b>x</b>CCTCC<b>xx</b>TATC<b>x</b>TCTG<b>x</b>TATTGCACATAGAG<b>x</b>GGCTTCAGTAGATTTAGC<b>x</b>ATTTTTAGTCTTCATT</p>
                        <p>. . . . . . . . . . . . . . . 8. . . . . . . . . . . . . . . . . . 9 . .10 . . . 1112 . . 13 . . 14 . . . . . . . . . . . .15 . . . . . . . . . . . . . . . 16 . . . . . . . . . . . . .</p>
                        <p>TAGCAGG<b>x</b>GT<b>x</b>TCTTCAATTTT<b>x</b>GGAGCTGT<b>x</b>AATTTTATTACAACTATTATTAATATACGATCA<b>x</b>TTGGAATAACATTTGA<b>c</b>CGAATACCTTTATTTGT<b>x</b>TGATC</p>
                        <p>. . . . . . 17 . 18 . . . . . . . . 19 . . . . . . 20 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 . . . . . . . . . . . . . . 22 . . . . . . . . . . . . . . .23 . . .</p>
                        <p>TGTAGGAATTACTGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGAGCAATTAC<b>x</b>ATACTTTTAAC<b>x</b>GATCGAAATTTAAATAC<b>x</b>TC<b>x</b>TTTTTTGACCC<b>x</b></p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .24 . . . . . . . . .25 . . . . . . . . . . . . . . 26 . 27. . . . . . . . 28 .</p>
                        <p>GC<b>x</b>GGAGGAGGAGA<b>x</b>CC<b>x</b>ATTTTATA<b>x</b>CAACA</p>
                        <p>. .29 . . . . . . . . . 30 . .31 . . . . . . 32 . . . .</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="33">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="32" ca="left">
                        <p>Haplotype sequence information</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="33">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Haplotype No.</p>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="left">
                        <p>15</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>21</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>23</p>
                     </c>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>26</p>
                     </c>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>28</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>30</p>
                     </c>
                     <c ca="left">
                        <p>31</p>
                     </c>
                     <c ca="left">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="33">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="33">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="32" ca="left">
                        <p>FREQUENCY OF HAPLOTYPES</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="32">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="14" ca="left">
                        <p>
                           <it>POGONUS CHALCEUS</it>
                        </p>
                     </c>
                     <c cspan="3" ca="left">
                        <p>
                           <it>POGONUS LITTORALIS</it>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="14">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Haplotype No.</p>
                     </c>
                     <c ca="left">
                        <p>CANAL1</p>
                     </c>
                     <c ca="left">
                        <p>POND1</p>
                     </c>
                     <c ca="left">
                        <p>MOK</p>
                     </c>
                     <c ca="left">
                        <p>ZWC</p>
                     </c>
                     <c ca="left">
                        <p>HEI</p>
                     </c>
                     <c ca="left">
                        <p>OOS</p>
                     </c>
                     <c ca="left">
                        <p>NIE</p>
                     </c>
                     <c ca="left">
                        <p>CAN</p>
                     </c>
                     <c ca="left">
                        <p>SOM</p>
                     </c>
                     <c ca="left">
                        <p>MSM</p>
                     </c>
                     <c ca="left">
                        <p>GAC</p>
                     </c>
                     <c ca="left">
                        <p>GIR</p>
                     </c>
                     <c ca="left">
                        <p>CAMA</p>
                     </c>
                     <c ca="left">
                        <p>ALB</p>
                     </c>
                     <c ca="left">
                        <p>GUE1</p>
                     </c>
                     <c ca="left">
                        <p>ZWC</p>
                     </c>
                     <c ca="left">
                        <p>ROU</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="33">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Bold lower case letters show variable positions numbered from 1 to 32 which are not position numbers in the gene. Dots indicate invariable positions. The table shows the variable sites of the haplotypes. The table below shows the haplotype frequency in each population.</p>
               </tblfn>
            </tbl>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>497 bp of 16S sequenced for 62 individuals of <it>P. chalceus </it>and 15 of <it>P. littoralis</it>. </p>
               </caption>
               <tblbdy cols="15">
                  <r>
                     <c cspan="15" ca="left">
                        <p>TTTATCAAAAACATGTCTTTTTGAGTTTAATATAAAGTCTA<b>x</b>CCTGCCCACTGAAA<b>x</b>TTTTAAATGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCT</p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 . . . . . . . . . . . . .2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .</p>
                        <p>TAGTTTTTTAATTGAAAGCTTGTATGAAAGGTTGGACGAGGTAAAATCTGTCTCTATTTAATTTA<b>x</b>ATTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTT</p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .</p>
                        <p>TTTAAAAGACGAGAAGACCCTATAGAGCTTTATAATTTATTTAATATAATTAATTTAGATTTATTTATATTTTATT<b>x</b>TT<b>x</b>AAATTATTTTATTGGGGTAATAGA</p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 . 5 . . . . . . . . . . . . . . . . . . . . . . .</p>
                        <p>AGATTAAAAAAATTCTTTTTTTTTATTTATATT<b>xx</b>TTTAT<b>x</b>TTTT<b>x</b>AATGATCCA<b>x</b>TTTTATTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTT</p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .67 . . . .8 9 . . . 10 . . . . . . . .11. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .</p>
                        <p>TGGAGAGTTCAT ATCGATAAAAAAGTTTGCGACCTCGATGTTGGATTAAAGATTAGTTTAGGTGTAGAAGTTTAAA</p>
                        <p>. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="14" ca="left">
                        <p>Haplotype sequence information</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Haplotype No.</p>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c ca="left">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="14" ca="left">
                        <p>Frequency of haplotypes</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="14">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="11" ca="left">
                        <p>
                           <it>POGONUS CHALCEUS</it>
                        </p>
                     </c>
                     <c cspan="3" ca="left">
                        <p>
                           <it>POGONUS LITTORALIS</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Haplotype No.</p>
                     </c>
                     <c ca="left">
                        <p>CANAL1</p>
                     </c>
                     <c ca="left">
                        <p>POND1</p>
                     </c>
                     <c ca="left">
                        <p>MOK</p>
                     </c>
                     <c ca="left">
                        <p>ZWC</p>
                     </c>
                     <c ca="left">
                        <p>HEI</p>
                     </c>
                     <c ca="left">
                        <p>OOS</p>
                     </c>
                     <c ca="left">
                        <p>NIE</p>
                     </c>
                     <c ca="left">
                        <p>SOM</p>
                     </c>
                     <c ca="left">
                        <p>MSM</p>
                     </c>
                     <c ca="left">
                        <p>CAMA</p>
                     </c>
                     <c ca="left">
                        <p>ALB</p>
                     </c>
                     <c ca="left">
                        <p>GUE1</p>
                     </c>
                     <c ca="left">
                        <p>ZWC</p>
                     </c>
                     <c ca="left">
                        <p>ROU</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>4</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Bold lower case letters indicate variable positions numbered from 1 to 11 which are not position numbers in the gene. Dots indicate invariable positions. The table shows the variable sites 1&#8211;11 of the haplotypes. The table below shows the haplotype frequency in each population.</p>
               </tblfn>
            </tbl>
            <p>The 459-bp COI sequences included 32 variable sites on a European scale (29 parsimony informative) and revealed nine unique haplotypes (four for <it>P. chalceus </it>and five for <it>P. littoralis</it>, with no haplotype shared by the two species). Most haplotypes were exclusive to a particular sampling site, with the exception of haplotype one and three which appeared in eight different localities, and haplotype five, which was found in three localities (Table <tblr tid="T4">4</tblr>). Selective neutrality was confirmed for this gene (<it>P </it>> 0.1 for all test statistics with <it>D* </it>and <it>F*</it>).</p>
            <p>The neighbour joining tree in Figure <figr fid="F5">5</figr> shows that both species form clearly separated entities (high bootstrap values). Differences are found in 28 positions between haplotypes 5,6,8,9 (<it>P</it>. <it>littoralis</it>) and haplotypes 1 and 2 (<it>P. chalceus</it>; Table <tblr tid="T4">4</tblr>). 27 base differences are found between haplotypes 5,6,8,9 and haplotypes 3 and 4 (<it>P. chalceus</it>). 27 base differences are found between haplotype 7 (<it>P</it>. <it>littoralis</it>) and haplotypes 1,2 (<it>P. chalceus</it>) and 26 base differences with haplotypes 3,4 <it>(P. chalceus</it>). Intrapopulation differences in both <it>P. chalceus </it>and <it>P. littoralis </it>are very small (only a limited number of individuals studied) and between each haplotype there are only one to at most two bases different.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Geographical distribution of the studied populations of <it>Pogonus chalceus </it>and <it>Pogonus littoralis</it></p>
               </caption>
               <text>
                  <p><b>Geographical distribution of the studied populations of <it>Pogonus chalceus </it>and <it>Pogonus littoralis</it></b>. The following population codes were used: 1:FRI; 2:BRA; 3:WAT; 4:MOK; 5:ZWC; 6:HEI; 7:LIS; 8:OOS; 9:NIE; 10:MOE; 11:SEA; 12:CAN; 13:AUT 14:SOM; 15: MSM; 16:VEY; 17:GAC; 18:GIR; 19:TOU; 20: CAM; 21:ROU; 22:IBI; 23:ALB; 24:MUR: 25:ALM. <it>P. chalceus </it>populations were sampled from all indicated numbers (1&#8211;25). <it>P. littoralis </it>were sampled in the populations with number 5, 13, 15, 19, 20 and 21. The detailed map is the Gu&#233;rande region containing three studied <it>P. chalceus </it>pond populations (POND1, POND2, POND3), three <it>P. chalceus </it>canal populations (CANAL1, CANAL2, CANAL3) and three <it>P. littoralis </it>populations (GUE1, GUE2, GUE3).</p>
               </text>
               <graphic file="1746-1448-3-4-5"/>
            </fig>
            <p>The 497-bp 16S sequences included 11 variable sites (9 parsimony informative) and revealed three unique haplotypes (Table <tblr tid="T5">5</tblr>; two for <it>P. chalceus </it>and one for <it>P. littoralis</it>, with no haplotype shared by the two species). Only one haplotype was exclusive to a particular sampling site (haplotype two). Haplotype one appeared in all 11 <it>P. chalceus </it>localities, and haplotype three appeared in all three <it>P. littoralis </it>sites. Selective neutrality was confirmed for this gene (<it>P </it>> 0.1 for all test statistics with <it>D* </it>and <it>F*</it>). Both species form, as in the case for COI, clearly separated entities (Table <tblr tid="T5">5</tblr>). 10 base differences are found between haplotype 3 (<it>P</it>. <it>littoralis</it>) and haplotypes 1 and 2 (<it>P. chalceus</it>). Interpopulation differences in both <it>P. chalceus </it>are very small (between the two haplotypes there is only one base different). There were no interpopulation differences found in <it>P. littoralis</it>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p><it>Pogonus littoralis </it>and <it>Pogonus chalceus </it>are closely related species, sometimes relatively hard to identify without dissection of the genitalia. We are interested to study the evolutionary processes in and between these presumably young species. We therefore compare the degree of intraspecific variation (in ecological groups of <it>P. chalceus</it>) and the degree of interspecific variation (<it>P. chalceus </it>versus <it>P. littoralis</it>) between a variety of morphological characteristics and molecular markers. In all of these cases, we did this with an ANOVA splitting up the total variance among groups, among populations within groups and within populations (Table <tblr tid="T6">6</tblr>).</p>
         <tbl id="T6">
            <title>
               <p>Table 6</p>
            </title>
            <caption>
               <p>Summary of analysis of variance for body size, wing size, <it>IDH1 </it>and allozymes</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c ca="left">
                     <p>region</p>
                  </c>
                  <c ca="left">
                     <p>source of variation</p>
                  </c>
                  <c ca="left">
                     <p>% var body size male</p>
                  </c>
                  <c ca="left">
                     <p>% var wing size male</p>
                  </c>
                  <c ca="left">
                     <p>% var <it>IDH1</it></p>
                  </c>
                  <c ca="left">
                     <p>% var allo</p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Gu&#233;rande</p>
                  </c>
                  <c ca="left">
                     <p>among groups (<it>P. chalceus </it>vs <it>P. littoralis</it>)</p>
                  </c>
                  <c ca="left">
                     <p>74.24</p>
                  </c>
                  <c ca="left">
                     <p>78.84</p>
                  </c>
                  <c ca="left">
                     <p>61.93</p>
                  </c>
                  <c ca="left">
                     <p>58.43</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>among populations within groups</p>
                  </c>
                  <c ca="left">
                     <p>17.50</p>
                  </c>
                  <c ca="left">
                     <p>18.64</p>
                  </c>
                  <c ca="left">
                     <p>11.49</p>
                  </c>
                  <c ca="left">
                     <p>3.39</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>within populations</p>
                  </c>
                  <c ca="left">
                     <p>8.26</p>
                  </c>
                  <c ca="left">
                     <p>2.52</p>
                  </c>
                  <c ca="left">
                     <p>26.57</p>
                  </c>
                  <c ca="left">
                     <p>39.18</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Europe</p>
                  </c>
                  <c ca="left">
                     <p>among groups (<it>P. chalceus </it>vs <it>P. littoralis</it>)</p>
                  </c>
                  <c ca="left">
                     <p>68.37</p>
                  </c>
                  <c ca="left">
                     <p>57.61</p>
                  </c>
                  <c ca="left">
                     <p>62.29</p>
                  </c>
                  <c ca="left">
                     <p>36.49</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>among populations within groups</p>
                  </c>
                  <c ca="left">
                     <p>10.13</p>
                  </c>
                  <c ca="left">
                     <p>36.11</p>
                  </c>
                  <c ca="left">
                     <p>12.26</p>
                  </c>
                  <c ca="left">
                     <p>13.70</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>within populations</p>
                  </c>
                  <c ca="left">
                     <p>21.51</p>
                  </c>
                  <c ca="left">
                     <p>6.28</p>
                  </c>
                  <c ca="left">
                     <p>25.44</p>
                  </c>
                  <c ca="left">
                     <p>49.81</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Gu&#233;rande</p>
                  </c>
                  <c ca="left">
                     <p>among groups (2 ecotypes vs <it>P. littoralis</it>)</p>
                  </c>
                  <c ca="left">
                     <p>84.96</p>
                  </c>
                  <c ca="left">
                     <p>95.48</p>
                  </c>
                  <c ca="left">
                     <p>64.25</p>
                  </c>
                  <c ca="left">
                     <p>41.99</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>among populations within groups</p>
                  </c>
                  <c ca="left">
                     <p>2.35</p>
                  </c>
                  <c ca="left">
                     <p>0.64</p>
                  </c>
                  <c ca="left">
                     <p>0.1</p>
                  </c>
                  <c ca="left">
                     <p>4.98</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>within populations</p>
                  </c>
                  <c ca="left">
                     <p>12.69</p>
                  </c>
                  <c ca="left">
                     <p>3.88</p>
                  </c>
                  <c ca="left">
                     <p>35.65</p>
                  </c>
                  <c ca="left">
                     <p>53.02</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Europe</p>
                  </c>
                  <c ca="left">
                     <p>among groups (3 ecolog groups vs <it>P. littoralis</it>)</p>
                  </c>
                  <c ca="left">
                     <p>49.39</p>
                  </c>
                  <c ca="left">
                     <p>82.22</p>
                  </c>
                  <c ca="left">
                     <p>53.26</p>
                  </c>
                  <c ca="left">
                     <p>19.05</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>among populations within groups</p>
                  </c>
                  <c ca="left">
                     <p>5</p>
                  </c>
                  <c ca="left">
                     <p>6.34</p>
                  </c>
                  <c ca="left">
                     <p>2.07</p>
                  </c>
                  <c ca="left">
                     <p>15.71</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>within populations</p>
                  </c>
                  <c ca="left">
                     <p>45.62</p>
                  </c>
                  <c ca="left">
                     <p>11.45</p>
                  </c>
                  <c ca="left">
                     <p>44.67</p>
                  </c>
                  <c ca="left">
                     <p>65.24</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>At both geographical scales and considering two groups (<it>P. chalceus </it>populations versus <it>P. littoralis </it>populations), a very large part of the total variance (based on body size, relative wing size, <it>IDH1 </it>and four neutral allozymes) is found between species (summary in Table <tblr tid="T6">6</tblr>). The study of the two mitochondrial genes also shows that both species form clearly separated entities. It is clear that relative wing size differences as well as genetic differences between the sister species <it>P. chalceus </it>and <it>P. littoralis </it>(interspecific) in this study are very marked and allow an easy species recognition.</p>
         <p>Body size, relative wing size and <it>IDH1 </it>allozyme data in the beetle <it>P. chalceus </it>are also strongly divergent between contrasting microhabitats (intraspecific: two ecotypes in Gu&#233;rande) as well as between three ecological groups at macroscale (highly stable versus intermediately stable and temporary populations; <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> and this study). If we consider four groups on a macroscale (3 groups in <it>P. chalceus </it>+ 1 group of <it>P. littoralis</it>) or three groups on a microscale (2 ecotypes in <it>P. chalceus </it>+ 1 group of <it>P. littoralis</it>), the variance among populations within groups drops drastically as compared to the analysis of two groups (all <it>P. chalceus </it>populations versus <it>P. littoralis</it>; based again on body size, relative wing size and <it>IDH1</it>; summary in Table <tblr tid="T6">6</tblr>). This study clearly shows that the intraspecific variation based on those three characteristics in <it>P. chalceus </it>is very high and in the same order of magnitude as the degree of interspecific variation (<it>P. chalceus </it>versus <it>P. littoralis</it>). We have suggested earlier that this huge phenotypic and <it>IDH1 </it>divergence in <it>P. chalceus </it>has been driven by divergent natural selection <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. As relative wing size is to a large extent genetically determined <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, this indeed suggests divergent selection between populations. And the observation that the <it>IDH1 </it>locus screened within our samples shows alelic differences between habitats strongly suggests a locus undergoing evolution through natural selection. Moreover, the canal and pond microhabitats differ from each other with respect to temperature, salinity and water level fluctuations <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Numerous studies based on allozymes have revealed patterns of allelic distribution associated with environmental factors, such as temperature and salinity <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Regarding the function of <it>IDH1</it>, the enzyme catalyses the rate-limiting step of the tricarboxylate cycle. Possible links with growth, however, are not direct and could be associated with the energy that is produced from the reaction. Divergent selection can lead to reproductive isolation and assortative mating and ultimately to speciation <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B15">15</abbr></abbrgrp>.</p>
         <p>On the other hand, in a previously study was shown that <it>P. chalceus </it>ecotypes in the Gu&#233;rande region were only slightly differentiated (based on allozyme and microsatellite markers) compared to the results based on adaptive characteristics <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The smaller degree of intraspecific divergence is also reflected in the mitochondrial data from this study. Moreover, allozyme and mtDNA data from this study show that the populations of <it>P. chalceus </it>are much more related to each other than to their sister species <it>P. littoralis </it>both on a micro- and macroscale. Often, little or no genetic divergence is found in neutral markers between ecologically and morphologically differentiated populations <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B7">7</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. Our results can be interpreted as a case of ongoing speciation in <it>P. chalceus </it>where divergence reflects a balance between selection and gene flow (see also <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>). Several studies suggest that tital marshes may be an appropriate ecotone in which to search for instances of ecological speciation. The studied species show, as is the case in our study, distinct morphological differences despite little divergence in molecular markers <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>In view of the above shown analogy between intra- and interspecific variation, it seems reasonable to assume that the same ecological adaptive bifurcation was also the first step in the speciation process of <it>P. chalceus </it>and <it>P. littoralis</it>. The speciation process was here fully accomplished by the reproductive isolation between the two groups, allowing independent drift and mutation accumulation in neutral genetic characters.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Sampling</p>
            </st>
            <p><it>P. chalceus </it>populations from three different sites in the Gu&#233;rande region are analysed (microscale; Fig. <figr fid="F5">5</figr>; see also <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>). Each site consists of two drastically differing microhabitats, situated only 10&#8211;20 metres from each other and separated by one or two dikes. We compare <it>P. chalceus </it>populations from three canals (CANAL1; CANAL2; CANAL3: Fig. <figr fid="F5">5</figr>) to three adjacent pond populations (POND1; POND2, POND3; see also <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>). Furthermore, we analyse Gu&#233;rande <it>P. littoralis </it>populations from three different sites (GUE1, GUE2, GUE3; Fig. <figr fid="F5">5</figr>; see also <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>) nearby the aforementioned <it>P. chalceus </it>population couples.</p>
            <p>The two related species are also studied on a macroscale with completely independent population samples (Gu&#233;rande populations not included). Data on <it>P. chalceus </it>populations from the Netherlands (FRI), Belgium (BRA, WAT, MOK, ZWC, HEI, LIS, OOS, NIE, MOE), England (SEA), France (CAN, AUT, SOM, MSM, VEY, GAC, GIR, TOU, CAM, ROU), and Spain (IBI, ALB, MUR, ALM; Fig. <figr fid="F5">5</figr>; see also <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B22">22</abbr></abbrgrp>. For <it>P. littoralis</it>, six populations are analysed here, five of them from France (AUT, MSM, TOU, CAM, ROU; <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>). From these sites in France, we also sampled <it>P. chalceus </it>populations (see above). In Belgium, <it>P. littoralis </it>is critically endangered and the previous record went back to 1956 and was from Ostend <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Recently, a supposed new <it>P. littoralis </it>population has been discovered in Belgium and is also included here (Fig. <figr fid="F5">5</figr>; ZWC). Populations of <it>P. chalceus </it>on a European scale were assigned to belong to one of three different salt marsh area stability types: temporary (BRA, WAT, MOK, HEI, LIS, OOS, MOE, TOU, CAM, ROU, IBI, ALB, MUR, ALM), intermediate (ZWC, NIE, MSM, FRI, AUT) and stable (SEA, CAN, SOM, VEY, GAC, GIR; see also <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B11">11</abbr></abbrgrp>. Temporary populations of <it>P. chalceus </it>are situated in the Mediterranean part of Europe or occur in small (&lt;4 ha) and young (&lt;400 years) Atlantic salt marshes. Stable and intermediate populations live in larger marshes situated along the Atlantic coast. The only difference between both salt marsh areas is their estimated age (Stable: >1000 years; Intermediate: between 400&#8211;1000 years). The age of salt marshes was estimated using historical information <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Morphological analysis</p>
            </st>
            <p>Body size (elytral length) and wing size were measured by means of a calibrated ocular under a binocular microscope. Generally, carabid wing size follows an allometric relationship with body size. <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> developed an index that corrects for this allometry, i.e. percentage of maximal realisable relative wing size. Relative wing size is wing length &#215; width divided by elytral length &#215; width. Relative wing size is then expressed as a percentage of the maximal wing size for a beetle of a given size. This index was shown to be an unbiased estimator for comparing different individuals, populations and species of carabid beetles <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. In ground beetles, females are generally larger than males. Therefore, we analyse male and female body sizes separately. To be complete, we analyse female and male relative wing size also separately. Body size and relative wing size are compared between species and populations with ANOVA's. Total variance is partitioned among groups (species or species and ecotypes), among populations within groups, and within populations by carrying out a nested design ANOVA using STATISTICA (version 7.1; StatSoft Inc., Tulsa, UK) on both a micro- and macroscale.</p>
         </sec>
         <sec>
            <st>
               <p>Genetic divergence</p>
            </st>
            <p>Data are used from five polymorphic enzymes: aldehyde oxidase (<it>AO</it>, E.C. 1.2.3.1), glucose-6-phosphate isomerase (<it>GPI</it>, E.C. 5.3.1.9), isocitrate dehydrogenase 1 and 2 (<it>IDH1</it>, <it>IDH2</it>, E.C. 1.1.1.42), phosphoglucomutase (<it>PGM</it>, E.C. 2.7.5.1.). Protocols of electrophoresis are provided by <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Earlier work showed that one locus (<it>IDH1</it>) was non-neutral and we will always analyse it separately <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>.</p>
            <p>Departures from Hardy-Weinberg equilibrium expectation were tested with an exact test using the GENEPOP software (Version 3.2; <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>). Significance levels were adjusted by using sequential Bonferroni correction. Similarly as in the analyses for body and wing size, total genetic variance is partitioned among groups (species, ecotypes), among populations within groups, and within populations by carrying out a hierarchical analysis of molecular variance (AMOVA) using ARLEQUIN (version 3.000; <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>) on both a micro- and macroscale.</p>
            <p>PCRs for nucleotide sequencing of COI utilized primers C1-J-1718 and C1-N-2191 and for 16S we utilized primers LR-J-1307 and LR-N-13398 <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. DNA amplification reactions were performed in a 25 &#956;L final volume. Each reaction mix contained 5 &#956;L of extract, 1&#215; buffer (Sigma), 1.5 mM MgCl<sub>2</sub>, 200 &#956;M of each dNTP, 0.4 &#956;M of each primer and 0.6 U <it>RedTaq </it>DNA polymerase (Sigma). Initial denaturation was for 2 min at 95&#176;C, followed by 35 cycles of 1 min at 95&#176;C, 1 min 30 s at 48&#176;C (and 46&#176;C for 16S), and 2 min at 72&#176;C; 9 min at 72&#176;C completed the program. The reaction was purified with columns following manufacturer's recommendations. Sequencing was done by BigDye Terminator version 3.1 kits on an ABI 3130 sequencer (Applied Biosystems). Sequences were aligned using BioEdit version 5.0.6 <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. We tested for neutrality of mutations following Fu &amp; Li's method with <it>D* </it>and <it>F* </it>test statistics using DNASP 4.0 <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. A phylogeny of unique haplotypes was constructed from the calculated Kimura two-parameter distances using the neighbour-joining approach within MEGA (<abbrgrp><abbr bid="B36">36</abbr></abbrgrp>; 1000 bootstrap replicates).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>HD collected the majority of the data, and carried out most of the calculations and drafted the text. Y-PM assisted the field work, advised regarding ANOVA's and final edited the text. KD supplied historical information, assisted the field work and advised on all used methods and final edited the text. All three authors read and approved the final text.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by the Entomology Department of the Royal Belgian Institute of Natural Sciences and OSTC project MO 36/006. It is carried out within the framework of the Flemish Research Network (FWO.017.02N, 'Ecological genetics: a new approach'). A. Drumont assisted with part of the laboratory work.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Heritability and wing development and body size in a carabid beetle, <it>Pogonus chalceus </it>MARSHAM, and its evolutionary significance</p>
            </title>
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Oecologia</source>
            <pubdate>1989</pubdate>
            <volume>78</volume>
            <fpage>513</fpage>
            <lpage>520</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00378743</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Differentiation between two salt marsh beetle ecotypes: evidence for ongoing speciation</p>
            </title>
            <aug>
               <au>
                  <snm>Dhuyvetter</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hendrickx</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gaublomme</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2007</pubdate>
            <volume>61</volume>
            <fpage>184</fpage>
            <lpage>193</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1558-5646.2007.00015.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17300437</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>A test of alternative models of diversification in tropical rainforests: ecological gradients vs. rainforest refugia</p>
            </title>
            <aug>
               <au>
                  <snm>Schneider</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Larison</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Moritz</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>PNAS</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>13869</fpage>
            <lpage>13873</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">24157</pubid>
                  <pubid idtype="pmpid" link="fulltext">10570165</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.24.13869</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Molecular evidence for ecological speciation in tropical habitats</p>
            </title>
            <aug>
               <au>
                  <snm>Ogden</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Thorpe</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>PNAS</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>13612</fpage>
            <lpage>13615</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">129722</pubid>
                  <pubid idtype="pmpid" link="fulltext">12370440</pubid>
                  <pubid idtype="doi">10.1073/pnas.212248499</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Divergent selection maintains adaptive differentiation despite high gene flow between sympatric rainbow smelt ecotypes (<it>Osmerus mordax </it>Mitchill)</p>
            </title>
            <aug>
               <au>
                  <snm>Saint-Laurent</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Legault</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bernatchez</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2003</pubdate>
            <volume>12</volume>
            <fpage>315</fpage>
            <lpage>330</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294X.2003.01735.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12535084</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Does gene flow constrain adaptive divergence or vice versa? A test using ecomorphology and sexual isolation in <it>Timema cristinae </it>walking-sticks</p>
            </title>
            <aug>
               <au>
                  <snm>Nosil</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Crespi</snm>
                  <fnm>BJ</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2004</pubdate>
            <volume>58</volume>
            <fpage>102</fpage>
            <lpage>112</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1554/03-231</pubid>
                  <pubid idtype="pmpid">15058723</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A biogeographic pattern in sparrow bill morphology: parallel adaptation to tidal marshes</p>
            </title>
            <aug>
               <au>
                  <snm>Grenier</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Greenberg</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2005</pubdate>
            <volume>59</volume>
            <fpage>1588</fpage>
            <lpage>1595</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1554/04-502</pubid>
                  <pubid idtype="pmpid">16153044</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Ecology and the origen of species</p>
            </title>
            <aug>
               <au>
                  <snm>Schluter</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>TREE</source>
            <pubdate>2001</pubdate>
            <volume>16</volume>
            <fpage>372</fpage>
            <lpage>380</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11403870</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <aug>
               <au>
                  <snm>Coyne</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Orr</snm>
                  <fnm>HA</fnm>
               </au>
            </aug>
            <source>Speciation</source>
            <publisher>Sinauer Associates, Inc., Sunderland, MA</publisher>
            <pubdate>2004</pubdate>
         </bibl>
         <bibl id="B10">
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Dispersievermogen en ecologie van loopkevers (Coleoptera, Carabidae) in Belgi&#235;: een evolutionaire benadering</source>
            <publisher>Studiedocumenten van het KBIN, Brussels</publisher>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Genetic differentiation and local adaptation in the salt-marsh beetle <it>Pogonus chalceus</it>: a comparison between allozyme and microsatellite loci</p>
            </title>
            <aug>
               <au>
                  <snm>Dhuyvetter</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gaublomme</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2004</pubdate>
            <volume>13</volume>
            <fpage>1065</fpage>
            <lpage>1074</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-294X.2004.02134.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15078445</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Genetic differentiation among populations of the salt marsh beetle <it>Pogonus littoralis </it>(Coleoptera: Carabidae): A comparison between Atlantic and Mediterranean populations</p>
            </title>
            <aug>
               <au>
                  <snm>Dhuyvetter</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gaublomme</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Verdyck</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Heredity</source>
            <pubdate>2005</pubdate>
            <volume>96</volume>
            <fpage>381</fpage>
            <lpage>387</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/jhered/esi040</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Selection in natural populations</p>
            </title>
            <aug>
               <au>
                  <snm>Mitton</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <publisher>Oxford Univ. Press, New York</publisher>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Analysis of selection on enzyme polymorphism</p>
            </title>
            <aug>
               <au>
                  <snm>Eanes</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>Annu Rev Ecol Syst</source>
            <pubdate>1999</pubdate>
            <volume>30</volume>
            <fpage>301</fpage>
            <lpage>326</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1146/annurev.ecolsys.30.1.301</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Ecological speciation</p>
            </title>
            <aug>
               <au>
                  <snm>Rundle</snm>
                  <fnm>HD</fnm>
               </au>
               <au>
                  <snm>Nosil</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Ecology letters</source>
            <pubdate>2005</pubdate>
            <volume>8</volume>
            <fpage>336</fpage>
            <lpage>353</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1461-0248.2004.00715.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Ecology and speciation</p>
            </title>
            <aug>
               <au>
                  <snm>Orr</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
            </aug>
            <source>Trends Ecol Evol</source>
            <pubdate>1998</pubdate>
            <volume>13</volume>
            <fpage>502</fpage>
            <lpage>506</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0169-5347(98)01511-0</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Microsatellite and mitochondrial DNA homogeneity among phenotypically diverse crossbill taxa in the UK</p>
            </title>
            <aug>
               <au>
                  <snm>Piertney</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Summers</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Marquiss</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Proc R Soc Lond B</source>
            <pubdate>2001</pubdate>
            <volume>268</volume>
            <fpage>1511</fpage>
            <lpage>1517</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1098/rspb.2001.1015</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Phenotypic divergence despite high levels of gene flow in Gal&#225;pagos lava lizards (<it>Microlophus albemarlensis</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>Jordan</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Snell</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Snell</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Jordan</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>859</fpage>
            <lpage>867</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-294X.2005.02452.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15723677</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Fine-scale genetic structure, estuarine colonization incipient speciation in the marine silverside fish <it>Odontesthes argentinensis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Beheregaray</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Sunnucks</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2001</pubdate>
            <volume>10</volume>
            <fpage>2849</fpage>
            <lpage>2866</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294X.2001.t01-1-01406.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11903897</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Gene flow versus local adaptation in the northern acorn barnacle, Semibalanus balanoides: insights from mitochondrial DNA variation</p>
            </title>
            <aug>
               <au>
                  <snm>Brown</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Kann</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Rand</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2001</pubdate>
            <volume>55</volume>
            <fpage>1972</fpage>
            <lpage>1979</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1554/0014-3820(2001)055[1972:GFVLAI]2.0.CO;2</pubid>
                  <pubid idtype="pmpid">11761058</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Subspecific differentiation and conservation of song sparrows (<it>Melospiza melodia</it>) in San Francisco Bay region inferred by microsatellite loci analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Chan</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Arcrese</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Auk</source>
            <pubdate>2003</pubdate>
            <volume>119</volume>
            <fpage>641</fpage>
            <lpage>657</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1642/0004-8038(2002)119[0641:SDACOS]2.0.CO;2</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Bottlenecks, drift and differentiation: the fragmented population structure of the saltmarsh beetle <it>Pogonus chalceus</it></p>
            </title>
            <aug>
               <au>
                  <snm>Dhuyvetter</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gaublomme</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Genetica</source>
            <pubdate>2005</pubdate>
            <volume>124</volume>
            <fpage>167</fpage>
            <lpage>177</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10709-005-1157-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">16134330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Maes</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Maelfait</snm>
                  <fnm>J-P</fnm>
               </au>
               <au>
                  <snm>Van Kerckvoorde</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Een gedocumenteerde Rode lijst van de zandloopkevers en loopkevers van Vlaanderen</source>
            <publisher>Mededelingen van het instituut voor natuurbehoud, Brussels</publisher>
            <pubdate>1995</pubdate>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Wing polymorphism and reproductive biology in the halobiont carabid beetle <it>Pogonus chalceus </it>(Marsham) (Coleoptera, Carabidae)</p>
            </title>
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Biol Jb Dodonaea</source>
            <pubdate>1985</pubdate>
            <volume>53</volume>
            <fpage>89</fpage>
            <lpage>100</lpage>
         </bibl>
         <bibl id="B25">
            <title>
               <p>De vegetatie van de slikken en de schorren langs de Ijzermonding te Nieuwpoort (Prov. West-Vlaandere, Belgi&#235;) van 1900 tot heden</p>
            </title>
            <aug>
               <au>
                  <snm>Goetghebeur</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Biol Jb Dodonaea</source>
            <pubdate>1976</pubdate>
            <volume>44</volume>
            <fpage>163</fpage>
            <lpage>177</lpage>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The vegetation of the Westgeul (Terneuzen, Netherlands)</p>
            </title>
            <aug>
               <au>
                  <snm>Hoffmann</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biol Jb Dodonaea</source>
            <pubdate>1986</pubdate>
            <volume>54</volume>
            <fpage>161</fpage>
            <lpage>173</lpage>
         </bibl>
         <bibl id="B27">
            <title>
               <p>The shaping of the French-Belgian North Sea coast throughout recent geology and history</p>
            </title>
            <aug>
               <au>
                  <snm>Houthuys</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>De Moor</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Somm&#233;</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Coastlines of the South North Sea</source>
            <publisher>American Society of Civil Engineers</publisher>
            <editor>Hillen R, Verhagen HJ</editor>
            <pubdate>1993</pubdate>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Allometry and evolution of hind wing development in macropterous carabid beetles</p>
            </title>
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Maelfait</snm>
                  <fnm>J-P</fnm>
               </au>
               <au>
                  <snm>Vaneechoutte</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Carabid beetles: Their adaptations and dynamics</source>
            <publisher>Stuttgart, Gustav Fisher</publisher>
            <editor>Den Boer PJ, Luff M, Mossakowski D, Weber F</editor>
            <pubdate>1986</pubdate>
            <fpage>101</fpage>
            <lpage>112</lpage>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Age and size of European saltmarshes and the population genetic consequences for ground beetles</p>
            </title>
            <aug>
               <au>
                  <snm>Desender</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Backeljau</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Delahaye</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>De Meester</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Oecologia</source>
            <pubdate>1998</pubdate>
            <volume>114</volume>
            <fpage>503</fpage>
            <lpage>513</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s004420050474</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>GENEPOP (Version 1.2): population genetics software for exact tests and ecumenicism</p>
            </title>
            <aug>
               <au>
                  <snm>Raymond</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rousset</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>J Hered</source>
            <pubdate>1995</pubdate>
            <volume>86</volume>
            <fpage>248</fpage>
            <lpage>249</lpage>
         </bibl>
         <bibl id="B31">
            <title>
               <p>ARLEQUIN version 3.000: a software for population genetics data analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Schneider</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Roessli</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Excoffier</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <publisher>Anthropology: University of Gen&#232;ve</publisher>
            <pubdate>2000</pubdate>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers</p>
            </title>
            <aug>
               <au>
                  <snm>Simon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Frati</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Beckenbach</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Crespi</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Flook</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Ann Entomol Soc Amer</source>
            <pubdate>1994</pubdate>
            <volume>87</volume>
            <fpage>651</fpage>
            <lpage>701</lpage>
         </bibl>
         <bibl id="B33">
            <title>
               <p>BioEdit: a user-friendly biological sequence alignment, editor and analysis program for Windows 95/98/NT</p>
            </title>
            <aug>
               <au>
                  <snm>Hall</snm>
                  <fnm>AT</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Symposium Series</source>
            <pubdate>1999</pubdate>
            <volume>41</volume>
            <fpage>95</fpage>
            <lpage>98</lpage>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Statistical tests of neutrality of mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Fu</snm>
                  <fnm>YX</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1993</pubdate>
            <volume>133</volume>
            <fpage>693</fpage>
            <lpage>709</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1205353</pubid>
                  <pubid idtype="pmpid" link="fulltext">8454210</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>DNASP, DNA polymorphism analyses by the coalescent and ohter methods</p>
            </title>
            <aug>
               <au>
                  <snm>Rozas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sanchez-De</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Barrio</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Messeguer</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Rozas</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>2496</fpage>
            <lpage>2497</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg359</pubid>
                  <pubid idtype="pmpid" link="fulltext">14668244</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>MEGA: molecular evolutionary genetic analysis, v. 1.01</p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <publisher>University Parkt, PA 16802: The Pennsylvania State University</publisher>
         </bibl>
      </refgrp>
   </bm>
</art>
