Does Na_v1.3 play a role in neuronal hyperexcitabtility following nerve injury? Voltage-gated sodium currents in injured neurons recover from inactivation fourfold faster than that in naive neurons possibly as a result of up-regulation of Na_v1.3 1318. Rapid recovery from inactivation could allow damaged nerves to fire at higher frequencies 11. The ectopic activity associated with nerve injury, which has been shown to be sensitive to TTX, is an important trigger for neuropathic pain behaviour 827. We therefore measured ectopic discharges from teased fibres of the damaged (L5) and spared (L4) 24 hours after surgery in Na_v1.3 KO and WT mice. L5 spinal nerve ligation induces spontaneous activity in L4 as well as L5 myelinated fibres, though the percentage of active neurons in mouse appears to be less than that in rat 19. The percentage of spontaneously active fibres from L5 DRG was three fold higher than that from L4 DRG, (Figure 4b), which is similar to earlier results in rats 19. Importantly, the percentage of spontaneously active fibres was not different between the Na_v1.3 KO and WT, (Figure 4a). In addition, other characteristics of the spontaneous activity such as the number of bursts per minute, (Figure 4b), mean number of spikes per burst, (Figure 4c), and the mean burst length, (Figure 4c), were also not different. These findings suggest that Na_v1.3 does not play an essential role in the ectopic hyperexcitability of damaged nerves.

GDNF reverses the up-regulation of Na_v1.3 and neuropathic pain behaviour 19, and antisense oligonucleotides against Na_v1.3 sequence reverse neuropathic pain behaviour 2021. Therefore, we measured mechanical pain thresholds in Na_v1.3 KO mice following tight ligation of spinal nerve L5 (Chung model). Surprisingly, a robust mechanical allodynia developed in both Na_v1.3 KO and WT mice from day 3 post-surgery and persisted throughout the experiment, (Figure 5a). Sodium currents in cultured sensory neurons were unaffected by Na_v1.3 gene deletion, (Figure 2c), suggesting a lack of compensatory changes.

In order to rule out the possibility that genetic compensation had confounded the behavioural phenotype in the Na_v1.3 KO, we generated two conditional knockout strains; we mated the floxed Na_v1.3 mouse to the Na_v1.8 Cre line 28 to delete Na_v1.3 in nociceptors from E14, and with the NFH-Cre mouse line 29 to delete Na_v1.3 in CNS and PNS from the 10^th postnatal week. Mice in both conditional knockout strains developed a profound mechanical allodynia soon after surgery that was not different from that of littermate controls (floxed Na_v1.3), (Figure 5b and 5c), confirming our results using the conventional global KO. We conclude that Na_v1.3 does not play a critical role in either the induction or maintenance of neuropathic pain behaviour.

Our results can be explained as follows; the level of Na_v1.3 expression in sensory neurons following injury is estimated to increase by about 1.4–2 fold 515 which is still very small considering the almost undetectable level of Na_v1.3 in adult sensory neurons. Thus the increase in sodium currents due to the up-regulated Na_v1.3 is unlikely to be significant in comparison to the total sodium current before injury. The reported fast kinetics of the Na_v1.3 current 18 suggests that the qualitative aspect of the Na_v1.3 up-regulation may be more important than the quantitative one. Our results using the global Na_v1.3 KO rule out this in stimulus-evoked neuropathic pain. This is because Na_v1.3 is deleted in all cell types regardless of the extent to which they up-regulate Na_v1.3, the type of cells involved (small vs large sensory neurons and DRG vs central neurons) and the sub-cellular localization of Na_v1.3 (somata vs terminals). Furthermore, although some antisense studies suggest a causal role for Na_v1.3 in neuropathic pain 2021, the specificity of the oligonucleotides used is not absolute (of 21 bases 15 are identical to Na_v1.1, 17 to Na_v1.2 and 14 to Na_v1.6), and another antisense study using different specific oligonucleotides has failed to confirm these findings 23.

The role of VGSCs in the pathogenesis of neuropathic pain has recently come under increasing scrutiny. Changes in neuronal hyperexcitability have not been found to correlate with changes in sodium currents 30. Nevertheless, the effectiveness of non-subtype selective sodium channel blockers in treating neuropathic pain 1 has stimulated the search for a specific underlying sodium channel subunit against which, more potent and selective analgesics can be developed. It seems likely, however, that no single sodium channel is specifically associated with neuronal hyperexcitability in damaged nerves, but that aberrant expression of high densities of sodium channels at the damaged terminals of sensory neurons may result in hyperexcitability 31. In support of this we have recently shown that neither Na_v1.7 nor 1.8 is necessary for the development of neuropathic pain 32. Na_v1.9 null mutants have also been shown to develop neuropathic pain normally 33. By contrast, it is clear that Na_v1.7 plays a major role in the development of inflammatory pain and subtype specific channel blockers directed against this channel may be desirable for the treatment of inflammatory pain.

The role in neuropathic pain pathogenesis of the other major VGSC subunits in DRG, Na_v1.1, Na_v1.2 and Na_v1.6, remains to be investigated. Because of their relative abundance it is expected that deletion of these subunits may not have a specific effect on neuropathic pain. Almost certainly the usefulness of Na_v1.1, Na_v1.2 or Na_v1.6 blockers in treating neuropathic pain will be greatly undermined by their broad expression in the CNS 10.

An RCPI-22 129S6/SvEvTac mouse BAC library was screened using a probe representing exons 4–12. DNA from positive BAC clones was prepared and subcloned into pBluescript (BS-SKII-). Three subclones were obtained that covered Na_v1.3 sequences from exon 2–8. The construct was prepared in three steps. Firstly, the 3' arm, Neomycin cassette and one LoxP site were cloned together as follows; two oligonucleotides were cloned in BS-SKII- to form new cloning sites. One LoxP site was cloned as an EcoRI-PstI fragment from PLneo vector 26. The 3' arm was cloned as ClaI-BamHI 7 Kb fragment. Neomycin cassette was cloned as BamHI-SalL fragment from Py6.0 plasmid 26. Secondly, the 5' arm, one LoxP and the floxed exons were cloned together as follows; 7 kb fragment ClaI-SacI was cloned in BS-SKII-. A LoxP site was inserted into the BsmBI site of the genomic fragment through blunt ligation. Finally, the two halves above were cloned into a vector containing the Thymidine-Kinase (TK) cassette as follows; the 3' side was prepared as Not-ClaI fragment, the 5' side was prepared as ClaI-SacII fragment and the TK containing vector was prepared as Not-SacII fragment. All were ligated together in the same tube. Positive clones were confirmed by restriction digests and sequencing. Blastocyst injection was performed by Monica Mendelson (Colombia University). Chimeras were crossed to C57BL/6 and germ line transmission tested using Southern blotting of tail DNA derived from F1 offspring. F1 heterozygotes were crossed to FLPe deletor animals 34 to excise the positive selection marker.

All tests were approved by the United Kingdom Home Office Animals (Scientific Procedures) Act 1986. They were performed in a Home Office designated room at 22 ± 2°C. Tests were carried out as previously descried 28. Formalin test: 20 μl of 5% formalin (37% formaldehyde (BDH) diluted with 0.9% saline (Sigma)) was injected subcutaneously into the plantar aspect of a hind-paw using a Hamilton syringe and 27 g needle and animals were placed in a 20 × 20 × 20 cm Plexiform chamber. The amount of time spent licking or biting the injected paw was then recorded in 5 minute periods over the next hour. Animals were habituated to the test environment for at least 1 hr before experiments were started. Activity during the first phase, from 0–10 mins, and the second phase, from 10–60 mins, was then calculated for each animal.

Neuropathic pain was induced according to the Chung Model (ligation of spinal nerve L5). Baseline mechanical thresholds for one paw were measured from mice using von Frey hairs (using the up-down method) respectively. Animals were anaesthetised using Halothane. A midline incision was made in the skin of the back at the L₂-S₂ levels and the left paraspinal muscles separated from the spinal processes, facet joints and transverse processes at the L₄-S₁ levels. The L₅ transverse process was removed and the L₅ spinal nerve tightly ligated using 8-0 silk thread.

DNA was precipitated from DRG and brain after overnight incubation in lysis-buffer (100 mM Tric-Cl, 5 mM EDTA, 0.2% SDS, 200 mM NaCl and 0.1 mg/ml Proteinase K). DNA pellet was resuspended in 200 μl TE and 1 μl was used for each 25 μl PCR reaction. Nav1.3 Primers used are (GAGAGAAAGACACTTAAATGCAGACATC), (GCTTTTTGTTCAAGTCTATCATATTCAAAG) and (AAG GAT GGC ATC ACC CAC AAG).

Deletion of exons 4 and 5 was confirmed by reverse transcription PCR (RT-PCR). RNA isolation was performed using TRIzol Reagent (Invitrogen, Paisley, UK), according to manufacturer's protocol. The reverse transcription reaction was also performed according to an Invitrogen protocol, using random primers. Primers used were (CACTAAACCCCGTTAGGAAAATTGCT) and (TCCAAGTGCTCCCTCTGTCTCCTC). The same primers were used for sequencing the RT-PCR bands.

Animals were terminally anaesthetised with 150 mg/kg sodium pentobarbitone (Rhône Mérieux), and then intracardially perfused with ice cold PBS (0.14 M NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.7 mMKH₂PO₄) followed by ice cold 4% paraformaldehyde/PBS. The tissues were removed and placed in O.C.T compound. 10 μm sections were prepared and mounted on Superfrost Plus slides (BDH). Sections were fixed in 4% paraformaldehyde for 5 mins and washed 3 × 10 mins in PBS + 0.1% Triton-X. They were blocked and permeabilised in 10% goat serum (GibcoBRL)/PBS + 0.1% Triton-X for at least 3 hrs at room temperature. Sections were then incubated in the following antisera in 10% goat serum/PBS + 0.3% Triton-X overnight at 4°C: rabbit anti-beta-galactosidase (5'-3') (1:500), mouse anti-peripherin (Chemicon) (1:1000) or mouse anti-neurofilament (Sigma N-52) (1:1000). They were then washed 3 × 10 mins in PBS + 0.1% Triton-X. The primary antisera were localised by immunofluorescence with Alexa Fluor 594 (Molecular Probes) (1:1000) and Alexa Fluor 488 (Molecular Probes) (1:1000). The slides were finally washed 3 × 30 mins at 4°C and mounted using Aqueous Mounting Solution (Sigma).

Cultures of dorsal root ganglion (DRG) neurons were prepared from adult Na_v1.3 null and WT littermate mice. The animals were killed by cervical dislocation, and dorsal root ganglia (DRG) were removed and enzymatically dissociated (Dispase/collagenase; Sigma, Poole, Dorset, UK). The isolated and pooled DRG neurons were plated onto poly-L-lysine coated glass coverslips and maintained in culture for 1–2 days.

Conventional voltage-clamp recordings in the whole-cell patch-clamp configuration were made from neurones of varying sizes (corresponding to small and medium sized neurons with a maximum apparent diameter of 43 μm) using an Axopatch 200B amplifier (Axon Instruments, Union City, California, USA) driven from a PC generating pulse protocols (Pclamp 9, Axon Instruments). The neuronal capacitance was estimated through the procedure of capacity transient cancellation, soon after attaining the whole-cell configuration. Electrodes were made from thin-walled glass (Harvard Apparatus, Edenbridge, Kent, UK) and had an initial resistance of between 1.5 and 2 MΩ when filled with intracellular solution. Series-resistance compensation was set near 70% with a nominal feed-back lag of 12 ms. Recordings were filtered at 5 KHz (4-pole Bessel filter) and sampled at 10 KHz. Recordings were made at room temperature.

TTX-s and TTX-r Na⁺ currents were recorded in relative isolation by including pharmacological blockers of both K⁺ and Ca²⁺ currents in both extracellular and intracellular media. In order to distinguish TTX-s and TTX-r currents, recordings were made before and after the addition of 250 nM TTX to the extracellular solution, where the TTX-s component was subsequently derived by off-line analysis using digital subtraction. The extracellular solution contained (in mM): NaCl 43.3, Tetraethylammonium Chloride 96.7, HEPES 10, CaCl₂ 2.1, MgCl₂ 2.12, 4-Aminopyridine 0.5, CsCl 10, KCl 7.5, CdCl₂ 0.1. The intracellular solution contained (in mM): CsCl 130, CsF 13, EGTA (Na) 3, Tetraethylammonium Chloride 10, HEPES 10, CaCl₂ 1.21, ATP(Mg) 3 mM, GTP (Li) 500 μM. External and internal solutions were buffered to pH 7.2–7.3 with the addition of CsOH. Tetrodotoxin (TTX, 250 nM) was locally applied and removed by gravity fed superfusion. The reagents, with the exception of TTX, were obtained from Sigma-Aldrich (Poole, Dorset, UK). TTX was purchased from Alomone Labs (TCS Biologicals, Botolph Claydon, Bucks, UK).

In order to derive current density measurements, peak Na⁺ currents were recorded in response to a family of incrementing, depolarizing clamp-steps, filtered at 5 KHz (4-pole Bessel filter) and normally sampled at 20 KHz. The holding potential was -80 mV, and the clamp-steps were preceded by a 20 ms pre-pulse. These values of membrane potential, coupled with the presence of internal F^-, were not optimal for recording TTX-r persistent Na⁺ current, and the TTX-r currents analysed always exhibited the voltage-dependent and kinetic characteristics of Na_v1.8. Current density estimates were found by dividing the peak-current values by the value estimated for membrane capacitance. TTX-s current amplitudes were found by off-line digital subtraction.

At defined time points after L5 spinal nerve ligation mice were anaesthetised via a brief induction with isofluorane gas followed by an i.p. injection of pentobarbitone (100 mg/kg). A lumbar laminectomy was performed and the L4 and L5 dorsal roots were identified and cut close to the spinal cord. Both the ventral roots and the L4 spinal nerve were cut as far distally as possible and then the dorsal roots, ventral roots, DRGs and spinal nerves (in continuity) from L4 and L5 were carefully and quickly removed. Throughout the process of dissection the tissue was kept hydrated by regularly applying oxygenated (95% O₂, 5% CO₂) aCSF solution (in millimolar: NaCl 118; KCl 4.7; MgSO₄ 1.2; KH₂PO₄ 1.2; NaHCO₃ 25; CaCl 2.5 and glucose 11) to the preparation. The tissue was then kept in oxygenated aCSF at room temperature for 30 minutes before the start of electrophysiological recording. The peripheral nerve preparations were mounted in a two chamber recording bath with the spinal nerve and DRG on one side continuously perfused with oxygenated aCSF at a rate of 10 ml/min. This solution was kept at 35 ± 1°C by running the perfusion tube through a jacket containing water heated and circulated by a thermostatically controlled water bath. The dorsal and ventral roots were sealed in the other chamber and covered in mineral oil which had been previously oxygenated with an air tube. Oil in this chamber was periodically replaced to maintain hydration and oxygenation of the dorsal root. A leak-proof partition barrier of perspex and high-vacuum grease ensured electrical isolation from the other compartment. For the purposes of electrical stimulation the end of the spinal nerve was taken up into a suction electrode with bipolar silver/silver chloride wires. Fine filaments were teased from the dorsal root using sharpened watchmakers forceps. These strands were placed over electrodes made of sliver wire coated with teflon that had been stripped away from the tip. A crushed strand from the ventral root was placed across another silver wire electrode to act as an indifferent recording. Signals from the electrodes were passed through a head-stage which was also connected to earth. From here the signal was amplified and filtered (low pass 500 Hz, high pass 5 KHz) using Neurolog equipment (Digitimer, UK). Residual 50 Hz noise was removed with a Humbug noise eliminator (Quest Scientific, Canada). The signal was viewed on a digital oscilloscope (Tektronix, USA) and also recorded for off-line analysis (Powerlab and Chart 5 software, ADI instruments, UK).

Spontaneously active units were recorded in both the L5 and L4 dorsal roots. In strands with multiple ectopically firing units separation was achieved on the basis of differing amplitude, action potential shape and interspike interval. The number of conducting fibres in each strand was determined by incremental electrical stimulation of the spinal nerve whilst observing the recruitment of units on a storage oscilloscope (Gould, UK). Strands that were studied typically contained a total of 8 to 12 conducting units and around 50 to 60 units were sampled from each dorsal root. The proportion of spontaneously active units in each preparation was calculated as a percentage and then a mean obtained for all data in a group with n representing a single L4 or L5 root taken from one animal. A large proportion of units observed firing spontaneously did so in a bursting manner and so further analysis of these patterns was undertaken using specialised software (Spike 2, Cambridge Electronic Design, UK).

Unpaired t-test was used to compare data unless otherwise indicated.