<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1743-7075-5-4</ui>
   <ji>1743-7075</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Physiogenomic comparison of human fat loss in response to diets restrictive of carbohydrate or fat</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Seip</snm>
               <mi>L</mi>
               <fnm>Richard</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>rseip@harthosp.org</email>
            </au>
            <au id="A2">
               <snm>Volek</snm>
               <mi>S</mi>
               <fnm>Jeff</fnm>
               <insr iid="I3"/>
               <email>jeff.volek@uconn.edu</email>
            </au>
            <au id="A3">
               <snm>Windemuth</snm>
               <fnm>Andreas</fnm>
               <insr iid="I1"/>
               <email>a.windemuth@genomas.net</email>
            </au>
            <au id="A4">
               <snm>Kocherla</snm>
               <fnm>Mohan</fnm>
               <insr iid="I1"/>
               <email>m.kocherla@genomas.net</email>
            </au>
            <au id="A5">
               <snm>Fernandez</snm>
               <fnm>Maria Luz</fnm>
               <insr iid="I4"/>
               <email>maria-luz.fernandez@uconn.edu</email>
            </au>
            <au id="A6">
               <snm>Kraemer</snm>
               <mi>J</mi>
               <fnm>William</fnm>
               <insr iid="I3"/>
               <email>william.kraemer@uconn.edu</email>
            </au>
            <au id="A7">
               <snm>Rua&#241;o</snm>
               <fnm>Gualberto</fnm>
               <insr iid="I1"/>
               <email>g.ruano@genomas.net</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Genomas, Inc., 67 Jefferson St, Hartford, Connecticut, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Cardiology, Hartford Hospital, Hartford, Connecticut, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Kinesiology, University of Connecticut, Storrs, Connecticut, USA</p>
            </ins>
            <ins id="I4">
               <p>Department of Nutritional Sciences, University of Connecticut, Storrs, Connecticut, USA</p>
            </ins>
         </insg>
         <source>Nutrition &amp; Metabolism</source>
         <issn>1743-7075</issn>
         <pubdate>2008</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>4</fpage>
         <url>http://www.nutritionandmetabolism.com/content/5/1/4</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18254975</pubid>
               <pubid idtype="doi">10.1186/1743-7075-5-4</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>12</day>
               <month>8</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>06</day>
               <month>2</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>06</day>
               <month>2</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Seip et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Genetic factors that predict responses to diet may ultimately be used to individualize dietary recommendations. We used physiogenomics to explore associations among polymorphisms in candidate genes and changes in relative body fat (&#916;%BF) to low fat and low carbohydrate diets.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>We assessed &#916;%BF using dual energy X-ray absorptiometry (DXA) in 93 healthy adults who consumed a low carbohydrate diet (carbohydrate ~12% total energy) (LC diet) and in 70, a low fat diet (fat ~25% total energy) (LF diet). Fifty-three single nucleotide polymorphisms (SNPs) selected from 28 candidate genes involved in food intake, energy homeostasis, and adipocyte regulation were ranked according to probability of association with the change in %BF using multiple linear regression.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Dieting reduced %BF by 3.0 &#177; 2.6% (absolute units) for LC and 1.9 &#177; 1.6% for LF (p &lt; 0.01). SNPs in nine genes were significantly associated with &#916;%BF, with four significant after correction for multiple statistical testing: rs322695 near the retinoic acid receptor beta (<it>RARB</it>) (p &lt; 0.005), rs2838549 in the hepatic phosphofructokinase (<it>PFKL</it>), and rs3100722 in the histamine N-methyl transferase (<it>HNMT</it>) genes (both p &lt; 0.041) due to LF; and the rs5950584 SNP in the angiotensin receptor Type II (<it>AGTR2</it>) gene due to LC (p &lt; 0.021).</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Fat loss under LC and LF diet regimes appears to have distinct mechanisms, with <it>PFKL </it>and <it>HNMT </it>and <it>RARB </it>involved in fat restriction; and <it>AGTR2 </it>involved in carbohydrate restriction. These discoveries could provide clues to important physiologic mechanisms underlying the &#916;%BF to low carbohydrate and low fat diets.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="refman"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>Dietary modification remains a logical and fundamental approach to the treatment of obesity. Achieving success may depend on the diet chosen <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp> and on innate and genetically inherited metabolic characteristics <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Ideally, a weight loss diet regimen should decrease excess adipose tissue mass, including the more important visceral fat, and preserve lean tissue. While weight loss occurs with any dietary strategy that restricts energy intake, it is clear that macronutrient composition has a role in determining adipose tissue and lean body mass responses <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. In particular, changes in dietary carbohydrate affect substrate metabolism through responses of hormones such as insulin <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> that clearly induce macronutrient-dependent expression of genes <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Further, there are interindividual differences in metabolic processing of both carbohydrate <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> and fat <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp> that have been implicated in obesity. In the present study, we compared the genetic variability associated with relative fat loss induced by energy restricted diets that varied in carbohydrate content. Such knowledge may ultimately lead to the development of DNA guided dietary recommendations.</p>
         <p>The genes that influence the adipose tissue and lean body (skeletal muscle + bone) mass compartments alone or in response to dietary intervention remain uncharacterized <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Sorenson et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> examined 42 SNPs in 26 candidate genes hypothesized to modulate obesity but found none to be predictive of the change in body mass index (BMI) induced by dietary restriction of either carbohydrate or fat. Although commonly used, BMI is not a precise surrogate index of adiposity. Its use as a phenotype may make genetic associations with a change in adiposity, difficult to discern.</p>
         <p>In order to simultaneously assess relationships between many gene variants and the phenotype of relative body fat, the present study employed physiogenomics <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, a medical application of sensitivity analysis and systems engineering. Sensitivity analysis is the study of the relationship between input and output from a system as determined by system components. Physiogenomics utilizes the genes as the components of the system. The gene variability, measured by single nucleotide polymorphisms (SNPs), is correlated to physiological responses, the output, of a diversely responsive human population. Physiogenomics determines how the SNP frequency varies among individuals similarly responding to the input over the entire range of the response distribution. We have previously utilized physiogenomics to identify genes relevant to dietary weight reduction <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and drug-induced side effects <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>.</p>
         <p>The present study succeeds a previous physiogenomic study which found that the total body weight loss response to carbohydrate restriction was associated with variants in gastric lipase (<it>LIPF</it>), hepatic glycogen synthase (<it>GYS2</it>), cholesteryl ester transfer protein (<it>CETP</it>) and galanin (<it>GAL</it>) genes <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Here we extend that study to compare carbohydrate restriction to fat restriction, using the change in relative fat measured by dual energy X ray absorptiometry (DXA), an accurate method to assess percent fat <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>, as a phenotype. We hypothesized that genes representative of food intake, energy homeostasis, and adipocyte regulation may explain the variability in the change in percent body fat accomplished through restriction of fat or carbohydrate.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Subjects and study design</p>
            </st>
            <p>The subjects included 93 adults who participated in very low carbohydrate (LC) <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp> and 70 who participated in low fat (LF) dietary studies <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B22">22</abbr></abbrgrp> designed to examine the effects on weight loss, body composition, and other metabolic responses related to cardiovascular disease in the Human Performance Laboratory at the University of Connecticut (Table <tblr tid="T1">1</tblr>). The subjects were free of diabetes, cardiovascular, respiratory, gastrointestinal, thyroid and other metabolic disease. They were weight stable (&#177; 2 kg) the month prior to starting the study. Subjects were not allowed to use nutritional supplements (except a daily multi-vitamin/mineral), or take medications to control blood lipids or glucose. The majority of subjects were sedentary and all were instructed to maintain the same level of physical activity throughout the study. The LC diet intervention was 12 weeks for the majority of subjects, but in some cases the duration was shorter (4&#8211;6 wk). Before and after LC and LF, body mass was determined in the morning after an overnight fast on a calibrated digital scale with subjects in light clothing and not wearing shoes. All subjects signed an informed consent document approved by the University of Connecticut Institutional Review Board.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Demographic characteristics of the subjects in the low fat (LF) and low carbohydrate (LC) diet groups.</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>
                           <b>
                              <it>Low Fat</it>
                           </b>
                        </p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>
                           <b>
                              <it>Low Carbohydrate</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Variable</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Value</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Subjects</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Baseline % Body fat</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mean change, % Body Fat [absolute %]</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Subjects</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Baseline % Body fat</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mean change, % Body Fat [absolute %]</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>All</p>
                     </c>
                     <c ca="center">
                        <p>All</p>
                     </c>
                     <c ca="center">
                        <p>70</p>
                     </c>
                     <c ca="center">
                        <p>35.5</p>
                     </c>
                     <c ca="center">
                        <p>-2.02</p>
                     </c>
                     <c ca="center">
                        <p>93</p>
                     </c>
                     <c ca="center">
                        <p>34.6</p>
                     </c>
                     <c ca="center">
                        <p>-2.97</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gender</p>
                     </c>
                     <c ca="center">
                        <p>Female</p>
                     </c>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="center">
                        <p>37.6</p>
                     </c>
                     <c ca="center">
                        <p>-1.49</p>
                     </c>
                     <c ca="center">
                        <p>31</p>
                     </c>
                     <c ca="center">
                        <p>38.0</p>
                     </c>
                     <c ca="center">
                        <p>-1.27</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Male</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                     <c ca="center">
                        <p>33.7</p>
                     </c>
                     <c ca="center">
                        <p>-2.43</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                     <c ca="center">
                        <p>32.9</p>
                     </c>
                     <c ca="center">
                        <p>-3.80</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Age</p>
                     </c>
                     <c ca="center">
                        <p>&lt;20</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>34.4</p>
                     </c>
                     <c ca="center">
                        <p>-3.00</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>34.8</p>
                     </c>
                     <c ca="center">
                        <p>-4.70</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>20&#8211;30</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>32.2</p>
                     </c>
                     <c ca="center">
                        <p>-1.56</p>
                     </c>
                     <c ca="center">
                        <p>36</p>
                     </c>
                     <c ca="center">
                        <p>33.4</p>
                     </c>
                     <c ca="center">
                        <p>-2.36</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>30&#8211;40</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>39.6</p>
                     </c>
                     <c ca="center">
                        <p>-2.32</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>37.2</p>
                     </c>
                     <c ca="center">
                        <p>-2.81</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>40&#8211;50</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>33.9</p>
                     </c>
                     <c ca="center">
                        <p>-2.60</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>35.0</p>
                     </c>
                     <c ca="center">
                        <p>-2.72</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>50&#8211;60</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>41.6</p>
                     </c>
                     <c ca="center">
                        <p>-0.85</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>32.6</p>
                     </c>
                     <c ca="center">
                        <p>-4.93</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>60&#8211;70</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>32.5</p>
                     </c>
                     <c ca="center">
                        <p>-6.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Heritage</p>
                     </c>
                     <c ca="center">
                        <p>African Amer</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>37.9</p>
                     </c>
                     <c ca="center">
                        <p>-1.63</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>36.7</p>
                     </c>
                     <c ca="center">
                        <p>-2.82</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Asian</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>36.5</p>
                     </c>
                     <c ca="center">
                        <p>-3.08</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>36.2</p>
                     </c>
                     <c ca="center">
                        <p>-3.34</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Caucasian</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                     <c ca="center">
                        <p>35.4</p>
                     </c>
                     <c ca="center">
                        <p>-2.01</p>
                     </c>
                     <c ca="center">
                        <p>81</p>
                     </c>
                     <c ca="center">
                        <p>34.5</p>
                     </c>
                     <c ca="center">
                        <p>-2.50</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Hispanic</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>32.3</p>
                     </c>
                     <c ca="center">
                        <p>-0.99</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>34.7</p>
                     </c>
                     <c ca="center">
                        <p>-2.16</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Dietary protocols</p>
            </st>
            <sec>
               <st>
                  <p>Low carbohydrate (LC)</p>
               </st>
               <p>The LC diet intervention has been described previously <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Subjects were free-living with the main goal to restrict carbohydrate (CHO) to a level that induced a small level of ketosis. There were no restrictions on the type of fat from saturated and unsaturated sources or cholesterol levels. Foods commonly consumed were beef (e.g., hamburger, steak), poultry (e.g., chicken, turkey), fish, vegetable oils, various nuts/seeds and peanut butter, moderate amounts of vegetables, salads with low CHO dressing, moderate amounts of cheese, eggs, protein drinks, and water or low CHO diet drinks. To ensure appropriate CHO restriction, subjects monitored their level of ketosis daily using urine reagent strips that produce a relative color change in the presence of one of the primary ketones, acetoacetic acid. Blood ketones were also checked during the diets. On this basis, all subjects were in ketosis for the majority of the experimental period. The actual mean nutrient breakdown of the diets as a percentage of total energy was obtained from at least 15 days of weighed food records across the various studies from which subjects were pooled.</p>
            </sec>
            <sec>
               <st>
                  <p>Low fat (LF)</p>
               </st>
               <p>The LF diet was designed to provide &lt;10% of total calories from saturated fat and &lt;300 mg cholesterol/day <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Foods encouraged included whole grains (breads, cereals, and pastas), fruit and fruit juices, vegetables, vegetable oils, low-fat dairy and lean meat products. Standard diabetic exchange lists were used to foster a macronutrient balance of protein (~20% energy), fat (~25% energy), and carbohydrate (~55% of energy). All subjects received extensive initial verbal and written instructions and weekly follow-up dietetic education. Subjects received thorough instructions for completing detailed weighed food records during baseline and various phases of the diet that were subsequently analyzed using regularly updated nutrient analysis software (NUTRITIONIST PRO&#8482;, Version 1.5, First Databank Inc, The Hearst Corporation, San Bruno, CA). The actual mean nutrient breakdown of the diets as a percentage of total energy was obtained from at least 15 days of weighed food records.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Percent body fat measurement</p>
            </st>
            <p>Whole body composition was assessed using DXA (Prodigy&#8482;, Lunar Corporation, Madison, WI). Analyses were performed by the same technician (blinded as to dietary intervention) using commercial software (enCORE version 6.00.270). Percent body fat was calculated as soft tissue fat mass divided by the sum of soft tissue fat mass, soft tissue lean body mass, and bone mineral content. Coefficients of variation for lean body mass, fat mass, and bone mineral content on repeat scans with repositioning on a group of men and women in our laboratory were 0.4, 1.4, and 0.6%, respectively.</p>
         </sec>
         <sec>
            <st>
               <p>Selection of candidate genes</p>
            </st>
            <p>To identify genes involved in physiological responses to carbohydrate versus fat ingestion, we canvassed physiological pathways and biological processes relevant to the regulation of adiposity, including but not limited to eating behavior, digestion and absorption, hormonal signaling in the prandial and postprandial period, the regulation of fuel distribution and processing, and the control of adipocyte size and proliferation. From these categories, we selected 28 genes to represent three categories: food intake, energy homeostasis, and adipocyte regulation. Table <tblr tid="T2">2</tblr> provides summary information relevant to the genes and SNPs. The role for each gene is described below.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Genes and SNPs analyzed for associations with percent body fat change profiles for LF and LC groups.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Area</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Pathway</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Gene</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Symbol</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Type</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Food Intake</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Neural</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>galanin</p>
                     </c>
                     <c ca="left">
                        <p>GAL</p>
                     </c>
                     <c ca="left">
                        <p>rs694066</p>
                     </c>
                     <c ca="left">
                        <p>intron 1</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>leptin receptor</p>
                     </c>
                     <c ca="left">
                        <p>LEPR</p>
                     </c>
                     <c ca="left">
                        <p>rs7602</p>
                     </c>
                     <c ca="left">
                        <p>intron 1 (3' UTR on another gene)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs1171276</p>
                     </c>
                     <c ca="left">
                        <p>intron 1 (untranslated)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs8179183</p>
                     </c>
                     <c ca="left">
                        <p>exon 12, N656K</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>melanocortin 3 receptor</p>
                     </c>
                     <c ca="left">
                        <p>MC3R</p>
                     </c>
                     <c ca="left">
                        <p>rs6024725</p>
                     </c>
                     <c ca="left">
                        <p>~10 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>neuropeptide Y</p>
                     </c>
                     <c ca="left">
                        <p>NPY</p>
                     </c>
                     <c ca="left">
                        <p>rs1468271</p>
                     </c>
                     <c ca="left">
                        <p>intron 1</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>neuropeptide Y receptor Y5</p>
                     </c>
                     <c ca="left">
                        <p>NPY5R</p>
                     </c>
                     <c ca="left">
                        <p>rs11100494</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs6837793</p>
                     </c>
                     <c ca="left">
                        <p>~9 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Neural/Gut</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>histamine N-methyltransferase</p>
                     </c>
                     <c ca="left">
                        <p>HNMT</p>
                     </c>
                     <c ca="left">
                        <p>rs1801105</p>
                     </c>
                     <c ca="left">
                        <p>exon 4, I105T</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs12691940</p>
                     </c>
                     <c ca="left">
                        <p>intron 2</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gut</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>apolipoprotein A-IV</p>
                     </c>
                     <c ca="left">
                        <p>APOA4</p>
                     </c>
                     <c ca="left">
                        <p>rs675</p>
                     </c>
                     <c ca="left">
                        <p>T367S, exon 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs5092</p>
                     </c>
                     <c ca="left">
                        <p>exon 2, T29T</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ghrelin precursor</p>
                     </c>
                     <c ca="left">
                        <p>GHRL</p>
                     </c>
                     <c ca="left">
                        <p>rs26312</p>
                     </c>
                     <c ca="left">
                        <p>~1 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>lipase, gastric</p>
                     </c>
                     <c ca="left">
                        <p>LIPF</p>
                     </c>
                     <c ca="left">
                        <p>rs814628</p>
                     </c>
                     <c ca="left">
                        <p>exon 4, A161T</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>peptide YY</p>
                     </c>
                     <c ca="left">
                        <p>PYY</p>
                     </c>
                     <c ca="left">
                        <p>rs1058046</p>
                     </c>
                     <c ca="left">
                        <p>exon 2, R72T</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs231460</p>
                     </c>
                     <c ca="left">
                        <p>~1.8 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Energy Homeostasis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Metabolic Enzyme</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>glycogen synthase kinase 3 beta</p>
                     </c>
                     <c ca="left">
                        <p>GSK3B</p>
                     </c>
                     <c ca="left">
                        <p>rs4688046</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs334555</p>
                     </c>
                     <c ca="left">
                        <p>intron 1</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs10934502</p>
                     </c>
                     <c ca="left">
                        <p>intron 2</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>glycogen synthase 1 (muscle)</p>
                     </c>
                     <c ca="left">
                        <p>GYS1</p>
                     </c>
                     <c ca="left">
                        <p>rs2287754</p>
                     </c>
                     <c ca="left">
                        <p>5' UTR</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>glycogen synthase 2 (liver)</p>
                     </c>
                     <c ca="left">
                        <p>GYS2</p>
                     </c>
                     <c ca="left">
                        <p>rs1478290</p>
                     </c>
                     <c ca="left">
                        <p>upstream, ~3.5 Kb</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2306179</p>
                     </c>
                     <c ca="left">
                        <p>intron 5</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs10505873</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>phosphofructokinase, liver</p>
                     </c>
                     <c ca="left">
                        <p>PFKL</p>
                     </c>
                     <c ca="left">
                        <p>rs2838549</p>
                     </c>
                     <c ca="left">
                        <p>intron 8</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>phosphofructokinase, muscle</p>
                     </c>
                     <c ca="left">
                        <p>PFKM</p>
                     </c>
                     <c ca="left">
                        <p>rs2269935</p>
                     </c>
                     <c ca="left">
                        <p>~700 bp upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pyruvate kinase, liver and RBC</p>
                     </c>
                     <c ca="left">
                        <p>PKLR</p>
                     </c>
                     <c ca="left">
                        <p>rs3762272</p>
                     </c>
                     <c ca="left">
                        <p>intron 2</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>pyruvate kinase, muscle</p>
                     </c>
                     <c ca="left">
                        <p>PKM2</p>
                     </c>
                     <c ca="left">
                        <p>rs2856929</p>
                     </c>
                     <c ca="left">
                        <p>intron 7 (MT)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Nuclear Signaling</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>retinoic acid receptor, alpha</p>
                     </c>
                     <c ca="left">
                        <p>RARA</p>
                     </c>
                     <c ca="left">
                        <p>rs4890109</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs9904270</p>
                     </c>
                     <c ca="left">
                        <p>~7.5 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>retinoic acid receptor, beta</p>
                     </c>
                     <c ca="left">
                        <p>RARB</p>
                     </c>
                     <c ca="left">
                        <p>rs2033447</p>
                     </c>
                     <c ca="left">
                        <p>intron 2 (MT)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs1290443</p>
                     </c>
                     <c ca="left">
                        <p>intron 3 (MT)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs322695</p>
                     </c>
                     <c ca="left">
                        <p>~100 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>retinoic acid receptor, gamma</p>
                     </c>
                     <c ca="left">
                        <p>RARG</p>
                     </c>
                     <c ca="left">
                        <p>rs10082776</p>
                     </c>
                     <c ca="left">
                        <p>intron 2 (untranslated)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>retinoid X receptor, alpha</p>
                     </c>
                     <c ca="left">
                        <p>RXRA</p>
                     </c>
                     <c ca="left">
                        <p>rs4917348</p>
                     </c>
                     <c ca="left">
                        <p>~100 kbp upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs3750546</p>
                     </c>
                     <c ca="left">
                        <p>~100 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs3118536</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>retinoid X receptor, gamma</p>
                     </c>
                     <c ca="left">
                        <p>RXRG</p>
                     </c>
                     <c ca="left">
                        <p>rs157864</p>
                     </c>
                     <c ca="left">
                        <p>intron 4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Adipocyte Regulation</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Adipokine-related</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>adiponectin receptor 2</p>
                     </c>
                     <c ca="left">
                        <p>ADIPOR2</p>
                     </c>
                     <c ca="left">
                        <p>rs2058112</p>
                     </c>
                     <c ca="left">
                        <p>intron 1 (untranslated?)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs7975375</p>
                     </c>
                     <c ca="left">
                        <p>intron 1 (untranslated?)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>angiotensin II receptor, type 1</p>
                     </c>
                     <c ca="left">
                        <p>AGTR1</p>
                     </c>
                     <c ca="left">
                        <p>rs12695902</p>
                     </c>
                     <c ca="left">
                        <p>intron 3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs931490</p>
                     </c>
                     <c ca="left">
                        <p>intron 2 (untranslated?), (MT)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>angiotensin II receptor, type 2</p>
                     </c>
                     <c ca="left">
                        <p>AGTR2</p>
                     </c>
                     <c ca="left">
                        <p>rs5950584</p>
                     </c>
                     <c ca="left">
                        <p>~4.5 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>resistin</p>
                     </c>
                     <c ca="left">
                        <p>RETN</p>
                     </c>
                     <c ca="left">
                        <p>rs3219177</p>
                     </c>
                     <c ca="left">
                        <p>intron 1</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Lipid Metabolic</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>apolipoprotein E</p>
                     </c>
                     <c ca="left">
                        <p>APOE</p>
                     </c>
                     <c ca="left">
                        <p>rs7412</p>
                     </c>
                     <c ca="left">
                        <p>exon 3, C176R, *2&#8211;>*3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs429358</p>
                     </c>
                     <c ca="left">
                        <p>exon 3, R130C, *4&#8211;>*3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs405509</p>
                     </c>
                     <c ca="left">
                        <p>~200 bp upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs439401</p>
                     </c>
                     <c ca="left">
                        <p>~1.5 kbp downstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs446037</p>
                     </c>
                     <c ca="left">
                        <p>~1.5 kbp upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>cholesteryl ester transfer protein, plasma</p>
                     </c>
                     <c ca="left">
                        <p>CETP</p>
                     </c>
                     <c ca="left">
                        <p>rs5883</p>
                     </c>
                     <c ca="left">
                        <p>exon 9, F287F</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs1532624</p>
                     </c>
                     <c ca="left">
                        <p>intron 7</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs3764261</p>
                     </c>
                     <c ca="left">
                        <p>~2.6 kb upstream</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs5880</p>
                     </c>
                     <c ca="left">
                        <p>nonsynonymous, P390A</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <sec>
               <st>
                  <p>Food intake</p>
               </st>
               <p>The <it>GAL </it>and <it>GHRL </it>genes, expressed in the hypothalamus <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> and stomach <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, respectively, encode for the orexigens galanin and ghrelin, respectively <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>. <it>HNMT </it>encodes for histamine N-methyl transferase, which inactivates histamine and is widely expressed in the stomach, thymus, lung, spleen, kidney, and particularly the brain <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. <it>LIPF </it>encodes for gastric lipase, which hydrolyzes triglycerides, freeing fatty acids for intestinal uptake <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. The <it>PYY </it>gene encodes for peptide YY, a gut endocrine factor that circulates after meals <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. <it>NPY </it>encodes for neuropeptide Y, an abundant brain and autonomic neurotransmitter <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> and potent orexigen <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. <it>NPY5R </it>encodes for one of five neuropeptide Y receptors studied in relation to energy balance <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. The <it>LEPR </it>gene encodes for the leptin receptor, believed critical in the central regulation of energy homeostasis <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. <it>MC3R </it>encodes for the melanocortin receptor 3, which regulates energy homeostasis in response to neuropeptides secreted by pro-opiomelanocortin and agouti related peptide releasing neurons <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. <it>APOA4 </it>encodes for apolipoprotein A-IV, is expressed by intestinal cells in response to fat absorption <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>, and has a hypothesized, centrally-mediated role in the regulation of energy intake <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>Energy homeostasis</p>
               </st>
               <p><it>GSK3B </it>encodes for glycogen synthase kinase 3 &#946;-9, which inactivates glycogen synthase by phosphorylation <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Glycogen synthase (<it>GYS</it>) catalyzes the rate-limiting step in glycogen synthesis. <it>GYS1 </it>and <it>GYS2 </it>are expressed liver and muscle, respectively. The <it>PFKL </it>and <it>PFKM </it>genes encode the liver <abbrgrp><abbr bid="B38">38</abbr></abbrgrp> and muscle <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> isoforms of phosphofructokinase, respectively. Phosphofructokinase is the key regulatory enzyme for glycolysis. <it>PKLR </it>and <it>PKM2 </it>encode for liver and muscle isoforms of pyruvate kinase, an enzyme of glycolysis and gluconeogenesis <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. The <it>RARA</it>, <it>RARB</it>, and <it>RARG</it>; and <it>RXRA </it>and <it>RXRG </it>genes are members of the nuclear receptor superfamily. The <it>RAR </it>and <it>RXR </it>gene products participate in the regulation of energy balance at a neural level <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> and their expression in hepatic and adipose tissues is diet-responsive <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>Adipose regulation</p>
               </st>
               <p>The <it>ACGT1 </it>and <it>AGTR2 </it>genes express angiotensin II receptors type I and II. Both play roles in adipocyte regulation and cellularity <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. The <it>ADIPOR2 </it>gene encodes adiponectin receptor type I; muscle expression of this gene plays a role in non-oxidative glycolysis <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Apolipoprotein E and cholesteryl ester protein, encoded by the <it>APOE </it>and <it>CETP </it>genes, respectively, have widespread roles in lipid metabolism. Both are expressed in adipocytes <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr></abbrgrp> and subject to nutritional regulation <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B48">48</abbr></abbrgrp>. <it>RSTN </it>encodes for the adipocyte-secreted factor, resistin, which is increased in obesity <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>Laboratory analysis</p>
               </st>
               <p>Blood samples were collected from an arm vein into tubes for DNA extraction. The DNA was extracted from 8.5 mL of whole blood using the PreAnalytiX PAXgene DNA isolation kit (Qiagen Inc, Valencia, CA). For some earlier participants, neither whole blood nor DNA were available, so DNA from lymphocytes remaining in archived serum samples were amplified using the QiaGen REPLI-g Whole Genome Amplification kit. Genotyping was performed using the Illumina BeadArray&#8482; platform and the GoldenGate&#8482; assay <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B51">51</abbr></abbrgrp>. The assay information and observed allele frequencies for the SNPs used in this study are listed in Table <tblr tid="T3">3</tblr>.</p>
               <tbl id="T3">
                  <title>
                     <p>Table 3</p>
                  </title>
                  <caption>
                     <p>Assay DNA sequences for the SNPs analyzed.</p>
                  </caption>
                  <tblbdy cols="8">
                     <r>
                        <c ca="left">
                           <p>
                              <b>SNP</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>Gene</b>
                           </p>
                        </c>
                        <c ca="right">
                           <p>
                              <b>Chr</b>
                           </p>
                        </c>
                        <c ca="right">
                           <p>
                              <b>mac</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>min</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>maj</b>
                           </p>
                        </c>
                        <c ca="right">
                           <p>
                              <b>Freq</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Sequence Context</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="8">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs694066</p>
                        </c>
                        <c ca="left">
                           <p>GAL</p>
                        </c>
                        <c ca="right">
                           <p>11</p>
                        </c>
                        <c ca="right">
                           <p>20</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.09</p>
                        </c>
                        <c ca="center">
                           <p>TTCTAAGTCCTCTGCCATGCC [A/G]GGAAAGCCTGGGTGCACCCA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs7602</p>
                        </c>
                        <c ca="left">
                           <p>LEPR</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>29</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.16</p>
                        </c>
                        <c ca="center">
                           <p>CTTGGAGAGGCAGATAACGCT [A/G]AAGCAGGCCTCTCATGACCC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1171276</p>
                        </c>
                        <c ca="left">
                           <p>APOA4</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>23</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.13</p>
                        </c>
                        <c ca="center">
                           <p>AGTTTCATGTACATTAAATAT [A/G]AATTTCTTTTGGCTGGAAAT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs8179183</p>
                        </c>
                        <c ca="left">
                           <p>APOA4</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.18</p>
                        </c>
                        <c ca="center">
                           <p>TAATGGAGATACTATGAAAAA [C/G]GAGAAAAATGTCACTTTACT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs6024725</p>
                        </c>
                        <c ca="left">
                           <p>MC3R</p>
                        </c>
                        <c ca="right">
                           <p>20</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.22</p>
                        </c>
                        <c ca="center">
                           <p>CCTAGAGACATATCTCAGTTA [A/G]GTTTTAGCCTCACCAGTATT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1468271</p>
                        </c>
                        <c ca="left">
                           <p>NPY</p>
                        </c>
                        <c ca="right">
                           <p>7</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.06</p>
                        </c>
                        <c ca="center">
                           <p>GACCCTGTAATTTTCAGAAAC [A/G]CACATAGGAGTGGGTGTCTG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs11100494</p>
                        </c>
                        <c ca="left">
                           <p>NPY5R</p>
                        </c>
                        <c ca="right">
                           <p>4</p>
                        </c>
                        <c ca="right">
                           <p>10</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.05</p>
                        </c>
                        <c ca="center">
                           <p>CAGAAAGATGTCATCATCCAG [A/C]ATTGCGTCCACACAGTCAAC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs6837793</p>
                        </c>
                        <c ca="left">
                           <p>NPY5R</p>
                        </c>
                        <c ca="right">
                           <p>4</p>
                        </c>
                        <c ca="right">
                           <p>18</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.10</p>
                        </c>
                        <c ca="center">
                           <p>ATGAATTGTCACTCAGAAGAA [A/G]CTTAATAGGCATTAATACTA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1801105</p>
                        </c>
                        <c ca="left">
                           <p>HNMT</p>
                        </c>
                        <c ca="right">
                           <p>2</p>
                        </c>
                        <c ca="right">
                           <p>14</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.08</p>
                        </c>
                        <c ca="center">
                           <p>TTTACGTTCTCGAGGTTCGAT [A/G]TCTTGGCTACAAGCTCTAAA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs12691940</p>
                        </c>
                        <c ca="left">
                           <p>HNMT</p>
                        </c>
                        <c ca="right">
                           <p>2</p>
                        </c>
                        <c ca="right">
                           <p>66</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.00</p>
                        </c>
                        <c ca="center">
                           <p>AATCAACCAAGTGGAAGAAAG [A/G]ATATCAGAGTCTGAAGACAA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs675</p>
                        </c>
                        <c ca="left">
                           <p>APOA4</p>
                        </c>
                        <c ca="right">
                           <p>11</p>
                        </c>
                        <c ca="right">
                           <p>32</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="right">
                           <p>0.16</p>
                        </c>
                        <c ca="center">
                           <p>GAGAAAGAGAGCCAGGACAAG [A/T]CTCTCTCCCTCCCTGAGCTG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs5092</p>
                        </c>
                        <c ca="left">
                           <p>APOA4</p>
                        </c>
                        <c ca="right">
                           <p>11</p>
                        </c>
                        <c ca="right">
                           <p>30</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.16</p>
                        </c>
                        <c ca="center">
                           <p>CAGTGCTGACCAGGTGGCCAC [A/G]GTGATGTGGGACTACTTCAG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs26312</p>
                        </c>
                        <c ca="left">
                           <p>GHRL</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>36</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>GCTGTTGCTGCTCTGGCCTCT [A/G]TGAGCCCCGGGAGTCCGCAG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs814628</p>
                        </c>
                        <c ca="left">
                           <p>LIPF</p>
                        </c>
                        <c ca="right">
                           <p>10</p>
                        </c>
                        <c ca="right">
                           <p>26</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.14</p>
                        </c>
                        <c ca="center">
                           <p>ATCGACTTCATTGTAAAGAAA [A/G]CTGGACAGAAGCAGCTACAC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1058046</p>
                        </c>
                        <c ca="left">
                           <p>PYY</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="right">
                           <p>78</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.38</p>
                        </c>
                        <c ca="center">
                           <p>GGAAAAGAGACGGCCCGGACA [C/G]GCTTCTTTCCAAAACGTTCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs231460</p>
                        </c>
                        <c ca="left">
                           <p>PYY</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="right">
                           <p>43</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.23</p>
                        </c>
                        <c ca="center">
                           <p>TGCTCACCCTAGGATGGAGGG [A/G]GCAGTGGGGGCTGGTTAGGA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs4688046</p>
                        </c>
                        <c ca="left">
                           <p>GSK3B</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>44</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.24</p>
                        </c>
                        <c ca="center">
                           <p>TAGTAAACTATTTCTTCCCAT [A/G]GGAGAAGATGGATTCTTTTC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs334555</p>
                        </c>
                        <c ca="left">
                           <p>GSK3B</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>24</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.13</p>
                        </c>
                        <c ca="center">
                           <p>AATTATATCTTATTATTAAAA [C/G]TCTACCAACTCAAAGCTTCC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs10934502</p>
                        </c>
                        <c ca="left">
                           <p>GSK3B</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>40</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.24</p>
                        </c>
                        <c ca="center">
                           <p>GCTTCCTTATGTAAAATGTAG [A/G]TATTTCTAAAGTAACGCAAT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2287754</p>
                        </c>
                        <c ca="left">
                           <p>GYS1</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>25</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>CGGGAAGCTTGCAAGACGCTC [A/G]GCTTCCTATTGCAAGACCGC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1478290</p>
                        </c>
                        <c ca="left">
                           <p>GYS2</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>59</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.26</p>
                        </c>
                        <c ca="center">
                           <p>AATGTGGCTGAAGCCAAAAGC [A/C]TAATGAATGAGGGGAAGCCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2306179</p>
                        </c>
                        <c ca="left">
                           <p>GYS2</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>52</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.27</p>
                        </c>
                        <c ca="center">
                           <p>TTTCAGTAGGTTTGCAGGGAA [A/G]CCAACTCAAAGCTATATCTG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs10505873</p>
                        </c>
                        <c ca="left">
                           <p>GYS2</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>67</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.49</p>
                        </c>
                        <c ca="center">
                           <p>TGCTCAGCCTTCTTCAATGAC [A/G]GTGTTTTGCTATTGTCTCTA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2838549</p>
                        </c>
                        <c ca="left">
                           <p>PFKL</p>
                        </c>
                        <c ca="right">
                           <p>21</p>
                        </c>
                        <c ca="right">
                           <p>15</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.09</p>
                        </c>
                        <c ca="center">
                           <p>GGACACTGGTTCCACCTCCGC [A/G]TGGCTGTACAGTGCTGCCGA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2269935</p>
                        </c>
                        <c ca="left">
                           <p>PFKM</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>53</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.26</p>
                        </c>
                        <c ca="center">
                           <p>CGGCAATTAGACTGGCTAGAG [A/C]CACCTCAGTCAGGCTCTCCC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs3762272</p>
                        </c>
                        <c ca="left">
                           <p>PKLR</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>13</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.06</p>
                        </c>
                        <c ca="center">
                           <p>AACAAAGATTCTCCTTTCCTC [A/G]TTCACCACTTTCTTGCTGTT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2856929</p>
                        </c>
                        <c ca="left">
                           <p>PKM2</p>
                        </c>
                        <c ca="right">
                           <p>15</p>
                        </c>
                        <c ca="right">
                           <p>39</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.24</p>
                        </c>
                        <c ca="center">
                           <p>CAGGCTCAGGGTCTAAATTCC [A/G]TATCCTTTCTTCCATACCCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs4890109</p>
                        </c>
                        <c ca="left">
                           <p>RARA</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="right">
                           <p>10</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.05</p>
                        </c>
                        <c ca="center">
                           <p>GGCTGCTCAGGGCCTCGTCCA [A/C]CCCCAGCCTGACAGAGAGCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs9904270</p>
                        </c>
                        <c ca="left">
                           <p>RARA</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="right">
                           <p>29</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>GCCTTCCCCTTAGAGAAGAGC [A/G]CCTGCCAGACAAGGGAGAAG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2033447</p>
                        </c>
                        <c ca="left">
                           <p>RARB</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>43</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.20</p>
                        </c>
                        <c ca="center">
                           <p>ATGCCGGGTGCTAGAGATACA [A/G]CAGTGAACATGACAAAGTTC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1290443</p>
                        </c>
                        <c ca="left">
                           <p>RARB</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>30</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>AGAAGCTCTTTCATGTTGTCA [A/G]TTTTAGAAATCCAAATCATT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs322695</p>
                        </c>
                        <c ca="left">
                           <p>RARB</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>29</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>CCTGTAGGATTGTGTTCCTCT [A/G]AAACTGTCCCCTAAATTATG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2838549</p>
                        </c>
                        <c ca="left">
                           <p>PFKL</p>
                        </c>
                        <c ca="right">
                           <p>21</p>
                        </c>
                        <c ca="right">
                           <p>51</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.09</p>
                        </c>
                        <c ca="center">
                           <p>GGACACTGGTTCCACCTCCGC [A/G]TGGCTGTACAGTGCTGCCGA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs157864</p>
                        </c>
                        <c ca="left">
                           <p>RXRG</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.10</p>
                        </c>
                        <c ca="center">
                           <p>ATGATATTGAATTAAAGGAAA [A/G]TGAATGGTCTCAGTCAGAGA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs3118536</p>
                        </c>
                        <c ca="left">
                           <p>RXRA</p>
                        </c>
                        <c ca="right">
                           <p>9</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.14</p>
                        </c>
                        <c ca="center">
                           <p>CTGCAGGTGCACGGTTTCCTG [A/C]TTGCCCAGGTGTCTCTGAGC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs4917348</p>
                        </c>
                        <c ca="left">
                           <p>RXRA</p>
                        </c>
                        <c ca="right">
                           <p>9</p>
                        </c>
                        <c ca="right">
                           <p>40</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.21</p>
                        </c>
                        <c ca="center">
                           <p>GGTGGGGTTAGAGGGGATGGT [A/G]CCTGGCAGTGTGCAGCAGAC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs3750546</p>
                        </c>
                        <c ca="left">
                           <p>RXRA</p>
                        </c>
                        <c ca="right">
                           <p>9</p>
                        </c>
                        <c ca="right">
                           <p>43</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.20</p>
                        </c>
                        <c ca="center">
                           <p>CCTGAGGATGAAGGGGCGTCC [A/G]TGGCCAGGCAGCAGTGAGAA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs157864</p>
                        </c>
                        <c ca="left">
                           <p>PYY</p>
                        </c>
                        <c ca="right">
                           <p>1</p>
                        </c>
                        <c ca="right">
                           <p>17</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.10</p>
                        </c>
                        <c ca="center">
                           <p>ATGATATTGAATTAAAGGAAA [A/G]TGAATGGTCTCAGTCAGAGA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs2058112</p>
                        </c>
                        <c ca="left">
                           <p>ADIPOR2</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>27</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>TCTTCTTGCCCTACATACTTC [A/G]AAAGCCCTTGGAGAAATCCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs7975375</p>
                        </c>
                        <c ca="left">
                           <p>ADIPOR2</p>
                        </c>
                        <c ca="right">
                           <p>12</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.17</p>
                        </c>
                        <c ca="center">
                           <p>CTTTTCACAGGAAAATTTCTT [A/G]GGAGTCTATTGTCACTGTCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs12695902</p>
                        </c>
                        <c ca="left">
                           <p>AGTR1</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>16</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.09</p>
                        </c>
                        <c ca="center">
                           <p>CATCAGGATTATCAGCATTTA [A/G]GCCAGAGTTGCAAATTAAGT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs931490</p>
                        </c>
                        <c ca="left">
                           <p>AGTR1</p>
                        </c>
                        <c ca="right">
                           <p>3</p>
                        </c>
                        <c ca="right">
                           <p>23</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.19</p>
                        </c>
                        <c ca="center">
                           <p>GGCGCCCCCTGGACTTCTGCT [A/G]GAATTTAGATTTAAATAGAT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs5950584</p>
                        </c>
                        <c ca="left">
                           <p>AGTR2</p>
                        </c>
                        <c ca="right">
                           <p>X</p>
                        </c>
                        <c ca="right">
                           <p>8</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.04</p>
                        </c>
                        <c ca="center">
                           <p>CTATCCTCAAATGCTATATAA [A/C]CCAACTGGTGGAAAAAAATT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs3219177</p>
                        </c>
                        <c ca="left">
                           <p>RETN</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.15</p>
                        </c>
                        <c ca="center">
                           <p>CCAGGGATCAGTGAGGTCTCT [A/G]AGACCCTTGGGGAGCTTGCC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs7412</p>
                        </c>
                        <c ca="left">
                           <p>APOE</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>18</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.08</p>
                        </c>
                        <c ca="center">
                           <p>CGGCCTGGTACACTGCCAGGC [A/G]CTTCTGCAGGTCATCGGCAT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs429358</p>
                        </c>
                        <c ca="left">
                           <p>APOE</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>31</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.14</p>
                        </c>
                        <c ca="center">
                           <p>GGTACTGCACCAGGCGGCCGC [A/G]CACGTCCTCCATGTCCGCGC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs405509</p>
                        </c>
                        <c ca="left">
                           <p>APOE</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>79</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.00</p>
                        </c>
                        <c ca="center">
                           <p>GAGGACACCTCGCCCAGTAAT [A/C]CAGACACCCTCCTCCATTCT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs439401</p>
                        </c>
                        <c ca="left">
                           <p>APOE</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>59</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.34</p>
                        </c>
                        <c ca="center">
                           <p>GAGAACTGAGGGGGTGGGAGG [A/G]GAAGAGAGTGCCGGCGGCTC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs446037</p>
                        </c>
                        <c ca="left">
                           <p>APOE</p>
                        </c>
                        <c ca="right">
                           <p>19</p>
                        </c>
                        <c ca="right">
                           <p>5</p>
                        </c>
                        <c ca="center">
                           <p>A</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.02</p>
                        </c>
                        <c ca="center">
                           <p>AGACACAGGTGACCCAACTCC [A/C]ATGGCTGGCCTAGGCCCCTC</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs5883</p>
                        </c>
                        <c ca="left">
                           <p>CETP</p>
                        </c>
                        <c ca="right">
                           <p>16</p>
                        </c>
                        <c ca="right">
                           <p>13</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="right">
                           <p>0.06</p>
                        </c>
                        <c ca="center">
                           <p>AGCTACCTTGGCCAGCGAGTG [A/G]AAGACTCGCTCAGAGAACCA</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs1532624</p>
                        </c>
                        <c ca="left">
                           <p>CETP</p>
                        </c>
                        <c ca="right">
                           <p>16</p>
                        </c>
                        <c ca="right">
                           <p>76</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.00</p>
                        </c>
                        <c ca="center">
                           <p>TCTGCCCCTTTGGGCTGCAGC [A/C]TCACAAGCTGTGTGGCGTTG</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs3764261</p>
                        </c>
                        <c ca="left">
                           <p>CETP</p>
                        </c>
                        <c ca="right">
                           <p>16</p>
                        </c>
                        <c ca="right">
                           <p>46</p>
                        </c>
                        <c ca="center">
                           <p>T</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.27</p>
                        </c>
                        <c ca="center">
                           <p>AGTGAATGAGATAGCAGACAA [A/C]CCAGATGCCTACCGACAGGT</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>rs5880</p>
                        </c>
                        <c ca="left">
                           <p>CETP</p>
                        </c>
                        <c ca="right">
                           <p>16</p>
                        </c>
                        <c ca="right">
                           <p>15</p>
                        </c>
                        <c ca="center">
                           <p>C</p>
                        </c>
                        <c ca="center">
                           <p>G</p>
                        </c>
                        <c ca="right">
                           <p>0.08</p>
                        </c>
                        <c ca="center">
                           <p>GATATCGTGACTACCGTCCAG [C/G]CCTCCTATTCTAAGAAAAGC</p>
                        </c>
                     </r>
                  </tblbdy>
                  <tblfn>
                     <p>Chr: chromosome location of the gene; mac: the number of minor alleles found; maj: sequence of the most common allele, major; min: sequence of the least common allele, minor; Freq: frequency (0.00&#8211;1.00) of the minor allele in the study population.</p>
                  </tblfn>
               </tbl>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Data analysis</p>
            </st>
            <p>All statistical analysis was performed using the R Statistics Language and Environment <abbrgrp><abbr bid="B52">52</abbr><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr></abbrgrp>. Covariates were analyzed using multiple linear regression, and selected using the stepwise procedure. The change in relative fat mass, &#916;%BF, was calculated as the difference between post-diet and baseline measurements of %BF. To test for association with SNP genotypes, the residual of &#916;%BF after covariate analysis was tested using linear regression on the SNP genotypes. SNP genotype was coded quantitatively as a numerical variable indicating the number of minor alleles: 0 for major homozygotes, 1 for heterozygotes, and 2 for minor homozygotes. The F-statistic p-value for the SNP variable was used to evaluate the significance of association. To test the validity of the p-values, we also performed an independent calculation of the p-values using permutation testing. The ranking of the first three SNPs were identical under permutation and F-statistic analyses (data not shown). To account for the multiple testing of 53 SNPs, we calculated adjusted p-values using Benjamini and Hochberg's false discovery rate (FDR) procedure <abbrgrp><abbr bid="B55">55</abbr><abbr bid="B56">56</abbr><abbr bid="B57">57</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>LOESS representation</p>
            </st>
            <p>We use a locally smoothed function of the SNP frequency as it varies with &#916;%BF to visually represent the nature of an association. LOESS (LOcally wEighted Scatter plot Smooth) is a method to smooth data using a locally weighted linear regression <abbrgrp><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr></abbrgrp>. At each point in the LOESS curve, a quadratic polynomial is fitted to the data in the vicinity of that point. The data are weighted such that they contribute less if they are further away, according to the tricubic function</p>
            <p>
               <display-formula>
                  <m:math name="1743-7075-5-4-i1" xmlns:m="http://www.w3.org/1998/Math/MathML">
                     <m:semantics>
                        <m:mrow>
                           <m:msub>
                              <m:mi>w</m:mi>
                              <m:mi>i</m:mi>
                           </m:msub>
                           <m:mo>=</m:mo>
                           <m:msup>
                              <m:mrow>
                                 <m:mrow>
                                    <m:mo>(</m:mo>
                                    <m:mrow>
                                       <m:mn>1</m:mn>
                                       <m:mo>&#8722;</m:mo>
                                       <m:msup>
                                          <m:mrow>
                                             <m:mrow>
                                                <m:mo>|</m:mo>
                                                <m:mrow>
                                                   <m:mfrac>
                                                      <m:mrow>
                                                         <m:mi>x</m:mi>
                                                         <m:mo>&#8722;</m:mo>
                                                         <m:msub>
                                                            <m:mi>x</m:mi>
                                                            <m:mi>i</m:mi>
                                                         </m:msub>
                                                      </m:mrow>
                                                      <m:mrow>
                                                         <m:mi>d</m:mi>
                                                         <m:mo stretchy="false">(</m:mo>
                                                         <m:mi>x</m:mi>
                                                         <m:mo stretchy="false">)</m:mo>
                                                      </m:mrow>
                                                   </m:mfrac>
                                                </m:mrow>
                                                <m:mo>|</m:mo>
                                             </m:mrow>
                                          </m:mrow>
                                          <m:mn>3</m:mn>
                                       </m:msup>
                                    </m:mrow>
                                    <m:mo>)</m:mo>
                                 </m:mrow>
                              </m:mrow>
                              <m:mn>3</m:mn>
                           </m:msup>
                           <m:mo>,</m:mo>
                        </m:mrow>
                        <m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xI8qiVKYPFjYdHaVhbbf9v8qqaqFr0xc9vqFj0dXdbba91qpepeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaem4DaC3aaSbaaSqaaiabdMgaPbqabaGccqGH9aqpdaqadaqaaiabigdaXiabgkHiTmaaemaajuaGbaWaaSaaaeaacqWG4baEcqGHsislcqWG4baEdaWgaaqaaiabdMgaPbqabaaabaGaemizaqMaeiikaGIaemiEaGNaeiykaKcaaaGccaGLhWUaayjcSdWaaWbaaSqabeaacqaIZaWmaaaakiaawIcacaGLPaaadaahaaWcbeqaaiabiodaZaaakiabcYcaSaaa@446C@</m:annotation>
                     </m:semantics>
                  </m:math>
               </display-formula>
            </p>
            <p>where <it>x </it>is the abscissa of the point to be estimated, the <it>x</it><sub><it>i </it></sub>are the data points in the vicinity, and <it>d</it>(<it>x</it>) is the maximum distance of <it>x </it>to the <it>x</it><sub><it>i</it></sub>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Dietary intake</p>
            </st>
            <p>The intake of total dietary energy at baseline did not differ between groups, nor did absolute amounts of protein, carbohydrate, and fat (Table <tblr tid="T4">4</tblr>). Relative to total energy intake, the intakes of protein, carbohydrate, and fat energy at baseline for LC and LF, expressed as percent of total energy, were 15.9%, 50.2%, and 32.6; and 16.6%, 47.7%, and 34.9%; respectively.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Dietary data at baseline and during LF and LC interventions.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4" ca="center">
                        <p>Intake (grams/day)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Condition</p>
                     </c>
                     <c ca="center">
                        <p>Group</p>
                     </c>
                     <c ca="center">
                        <p>Total Energy Intake (Kcal/d)</p>
                     </c>
                     <c ca="center">
                        <p>Protein</p>
                     </c>
                     <c ca="center">
                        <p>Carbohydrate</p>
                     </c>
                     <c ca="center">
                        <p>Fat</p>
                     </c>
                     <c ca="center">
                        <p>Alcohol</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Baseline</p>
                     </c>
                     <c ca="center">
                        <p>LF</p>
                     </c>
                     <c ca="center">
                        <p>2176.3 &#177; 518.4</p>
                     </c>
                     <c ca="center">
                        <p>87.3 &#177; 23.0</p>
                     </c>
                     <c ca="center">
                        <p>273.2 &#177; 65.5</p>
                     </c>
                     <c ca="center">
                        <p>80.9 &#177; 29.7</p>
                     </c>
                     <c ca="center">
                        <p>3.5 &#177; 6.9</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>LC</p>
                     </c>
                     <c ca="center">
                        <p>2291.8 &#177; 735.9</p>
                     </c>
                     <c ca="center">
                        <p>94.3 &#177; 32.2</p>
                     </c>
                     <c ca="center">
                        <p>267.3 &#177; 80.5</p>
                     </c>
                     <c ca="center">
                        <p>92.1 &#177; 43.6</p>
                     </c>
                     <c ca="center">
                        <p>4.4 &#177; 1.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Diet</p>
                     </c>
                     <c ca="center">
                        <p>LF</p>
                     </c>
                     <c ca="center">
                        <p>1470.0 &#177; 348.7<sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>69.2 &#177; 19.0<sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>212.1 &#177; 59.2 <sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>37.3 &#177; 12.6 <sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>3.1 &#177; 4.6</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>LC</p>
                     </c>
                     <c ca="center">
                        <p>1705.2 &#177; 57.1 <sup>&#8225;&#8224;</sup></p>
                     </c>
                     <c ca="center">
                        <p>114.9 &#177; 32.8 <sup>&#8225;&#167;</sup></p>
                     </c>
                     <c ca="center">
                        <p>53.2 &#177; 42.6 <sup>&#8225;&#167;</sup></p>
                     </c>
                     <c ca="center">
                        <p>111.9 &#177; 38.7 <sup>&#8225;&#167;</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.9 &#177; 3.3 *</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>&#8224; </sup>p &lt; 0.01, LC vs. LF, within condition</p>
                  <p><sup>&#167; </sup>p &lt; 1e<sup>-10</sup>, LC vs. LF, within condition</p>
                  <p>* p &lt; 0.05, Baseline vs. Diet, within group</p>
                  <p><sup>&#8225; </sup>p &lt; 0.0001, Baseline vs. Diet, within group</p>
               </tblfn>
            </tbl>
            <p>Dietary intervention decreased mean total energy intake to 1470 kcal in LF and to 1705 kcal/day in LC (p &lt; 0.01), representing mean changes from baseline of -32.5% and -26.5%, respectively. During intervention, carbohydrate intake averaged 212 g/day (57% of total energy) in LF compared to 53 g/day (12% of total energy intake) in LC. Protein intake averaged 94 g/day (19% of total energy) in LF and 115 g/day (28% of total energy) in LC. Fat intake averaged 37 g/day (23% of total energy) in LF and 112 g/day (59% of total energy) in LC. All between-group differences in macronutrient gram intake were significant (p &lt; 1<sup>e-10</sup>, Table <tblr tid="T4">4</tblr>).</p>
         </sec>
         <sec>
            <st>
               <p>Body mass and composition</p>
            </st>
            <p>There were no differences in body size or composition between groups at baseline. With diet intervention, the change in total body, fat, and lean masses were significantly greater in LC (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Baseline and change in total body mass and composition for LC and LF.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Baseline</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Change</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Group</p>
                     </c>
                     <c ca="center">
                        <p>Total Body Mass</p>
                     </c>
                     <c ca="center">
                        <p>Fat Mass</p>
                     </c>
                     <c ca="center">
                        <p>Lean Mass</p>
                     </c>
                     <c ca="center">
                        <p>Total Body Mass</p>
                     </c>
                     <c ca="center">
                        <p>Fat Mass</p>
                     </c>
                     <c ca="center">
                        <p>Lean Mass</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>LF</p>
                     </c>
                     <c ca="center">
                        <p>89.5 &#177; 21.2</p>
                     </c>
                     <c ca="center">
                        <p>32.2 &#177; 11.2</p>
                     </c>
                     <c ca="center">
                        <p>54.4 &#177; 13.1</p>
                     </c>
                     <c ca="center">
                        <p>-4.0 &#177; 2.9</p>
                     </c>
                     <c ca="center">
                        <p>-3.2 &#177; 2.2</p>
                     </c>
                     <c ca="center">
                        <p>-0.7 &#177; 1.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>LC</p>
                     </c>
                     <c ca="center">
                        <p>91.0 &#177; 20.0</p>
                     </c>
                     <c ca="center">
                        <p>31.8 &#177; 10.3</p>
                     </c>
                     <c ca="center">
                        <p>56.3 &#177; 12.8</p>
                     </c>
                     <c ca="center">
                        <p>-6.5 &#177; 4.1<sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>-4.8 &#177; 3.0<sup>&#8225;</sup></p>
                     </c>
                     <c ca="center">
                        <p>-1.4 &#177; 2.6*</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* p &lt; 0.05, LC vs. LF</p>
                  <p><sup>&#8225; </sup>p &lt; 0.0001, LC vs. LF</p>
               </tblfn>
            </tbl>
            <p>Figure <figr fid="F1">1</figr> depicts the baseline and changes in % body fat profiles in the LF and LC study populations. The distributions are approximately normal and the baseline percent body fat levels for LF (35.4 &#177; 7.8%) and LC (34.5% &#177; 7.3%) were not different between groups. Overall LC induced an absolute decrease in % body fat of 2.98 &#177; 2.62%, reflecting losses of 4.8 kg of fat mass and 1.42 kg of lean mass, compared to a % fat decrease of 1.92 &#177; 1.63% in LF (p &lt; 0.01), reflecting losses of 3.18 kg for fat mass and 0.70 kg for lean mass. Men outnumbered women in both study groups and had lower baseline % body fat in both groups (33.7 vs. 37.6 LF, and 32.9 vs. 38.0 LC) (Table <tblr tid="T1">1</tblr>). The change in % body fat (&#916;%BF) due to diet was greater for men versus women (Table <tblr tid="T5">5</tblr>). For physiogenomics analyses, we employed gender as a covariate to account for the difference.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Distribution of baseline and change in percent body fat for LF (top) and LC (bottom) groups</p>
               </caption>
               <text>
                  <p>Distribution of baseline and change in percent body fat for LF (top) and LC (bottom) groups. The vertical axes (<it>Frequency</it>) indicates the number of patients observed within a given 10% interval up to 60% (baseline, left panels) or within a given 2% or 5% interval (change, right panels) on the horizontal axes. Genotyping was not completed in 3 LF subjects and 7 LC subjects.</p>
               </text>
               <graphic file="1743-7075-5-4-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Physiogenomic associations</p>
            </st>
            <p>Table <tblr tid="T6">6</tblr> lists the results of the association tests, comparing LF and LC groups. A single SNP rs322695 in the <it>RARB </it>gene was significantly associated with &#916;%BF for both the LF and LC interventions (p &lt; 0.0001 and p &lt; 0.0121, respectively). SNPs in the <it>HNMT </it>(rs3100722, p &lt; 0.002) and <it>PFKL </it>genes (rs2838549, p &lt; 0.002) were significant only for the LF group. Conversely, the rs5950584 SNP in the <it>AGTR2 </it>gene was significant only for the LC group (p &lt; 0.0001). The FDR-corrected p values yield an estimate of the false positive rate. The following SNPs, <it>RARB </it>rs322695, <it>HNMT </it>rs1269140, and <it>PFKL </it>rs2838549 and associations in LF, and the <it>AGTR2 </it>SNP rs5950584 association in LC are clearly significant after the FDR correction (p &lt; 0.005, p &lt; 0.041, p &lt; 0.041, and p &lt; 0.041, respectively). All remaining genes showed no significant association in either treatment group, and no gene showed significance for both diet treatments after adjusting for multiple tests.</p>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Significance levels of gene SNPs associated with % body fat change profiles for carbohydrate-restricted (LC) and fat-restricted (LF) diet treatments.</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>Marker</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>P-value</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>Coefficient</b>
                        </p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>FDR</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Area</p>
                     </c>
                     <c ca="left">
                        <p>SNP</p>
                     </c>
                     <c ca="left">
                        <p>Gene</p>
                     </c>
                     <c ca="right">
                        <p>LF</p>
                     </c>
                     <c ca="right">
                        <p>LC</p>
                     </c>
                     <c ca="right">
                        <p>LF</p>
                     </c>
                     <c ca="right">
                        <p>LC</p>
                     </c>
                     <c ca="right">
                        <p>LF</p>
                     </c>
                     <c ca="right">
                        <p>LC</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Food Intake</p>
                     </c>
                     <c ca="left">
                        <p>rs1801105</p>
                     </c>
                     <c ca="left">
                        <p>HNMT</p>
                     </c>
                     <c ca="right">
                        <p>0.941</p>
                     </c>
                     <c ca="right">
                        <p>0.028</p>
                     </c>
                     <c ca="right">
                        <p>-0.03</p>
                     </c>
                     <c ca="right">
                        <p>-2.03</p>
                     </c>
                     <c ca="right">
                        <p>0.960</p>
                     </c>
                     <c ca="right">
                        <p>0.368</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs12691940</p>
                     </c>
                     <c ca="left">
                        <p>HNMT</p>
                     </c>
                     <c ca="right">
                        <p>0.002</p>
                     </c>
                     <c ca="right">
                        <p>0.755</p>
                     </c>
                     <c ca="right">
                        <p>0.89</p>
                     </c>
                     <c ca="right">
                        <p>-0.12</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>0.041</b>
                        </p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs1468271</p>
                     </c>
                     <c ca="left">
                        <p>NPY</p>
                     </c>
                     <c ca="right">
                        <p>0.049</p>
                     </c>
                     <c ca="right">
                        <p>0.181</p>
                     </c>
                     <c ca="right">
                        <p>-0.89</p>
                     </c>
                     <c ca="right">
                        <p>-0.90</p>
                     </c>
                     <c ca="right">
                        <p>0.321</p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Energy Homeostasis</p>
                     </c>
                     <c ca="left">
                        <p>rs1478290</p>
                     </c>
                     <c ca="left">
                        <p>GYS2</p>
                     </c>
                     <c ca="right">
                        <p>0.038</p>
                     </c>
                     <c ca="right">
                        <p>0.009</p>
                     </c>
                     <c ca="right">
                        <p>-0.60</p>
                     </c>
                     <c ca="right">
                        <p>-0.86</p>
                     </c>
                     <c ca="right">
                        <p>0.321</p>
                     </c>
                     <c ca="right">
                        <p>0.209</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs2838549</p>
                     </c>
                     <c ca="left">
                        <p>PFKL</p>
                     </c>
                     <c ca="right">
                        <p>0.002</p>
                     </c>
                     <c ca="right">
                        <p>0.902</p>
                     </c>
                     <c ca="right">
                        <p>1.37</p>
                     </c>
                     <c ca="right">
                        <p>-0.10</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>0.041</b>
                        </p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs3762272</p>
                     </c>
                     <c ca="left">
                        <p>PKLR</p>
                     </c>
                     <c ca="right">
                        <p>0.048</p>
                     </c>
                     <c ca="right">
                        <p>0.282</p>
                     </c>
                     <c ca="right">
                        <p>-2.24</p>
                     </c>
                     <c ca="right">
                        <p>-0.60</p>
                     </c>
                     <c ca="right">
                        <p>0.321</p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs322695</p>
                     </c>
                     <c ca="left">
                        <p>RARB</p>
                     </c>
                     <c ca="right">
                        <p>0.0001</p>
                     </c>
                     <c ca="right">
                        <p>0.012</p>
                     </c>
                     <c ca="right">
                        <p>1.29</p>
                     </c>
                     <c ca="right">
                        <p>1.03</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>0.005</b>
                        </p>
                     </c>
                     <c ca="right">
                        <p>0.209</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Adipocyte Regulation</p>
                     </c>
                     <c ca="left">
                        <p>rs2058112</p>
                     </c>
                     <c ca="left">
                        <p>ADIPOR2</p>
                     </c>
                     <c ca="right">
                        <p>0.044</p>
                     </c>
                     <c ca="right">
                        <p>0.141</p>
                     </c>
                     <c ca="right">
                        <p>-0.89</p>
                     </c>
                     <c ca="right">
                        <p>-0.78</p>
                     </c>
                     <c ca="right">
                        <p>0.321</p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs5950584</p>
                     </c>
                     <c ca="left">
                        <p>AGTR2</p>
                     </c>
                     <c ca="right">
                        <p>0.507</p>
                     </c>
                     <c ca="right">
                        <p>0.0001</p>
                     </c>
                     <c ca="right">
                        <p>-0.77</p>
                     </c>
                     <c ca="right">
                        <p>-3.31</p>
                     </c>
                     <c ca="right">
                        <p>0.732</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>0.021</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>rs439401</p>
                     </c>
                     <c ca="left">
                        <p>APOE</p>
                     </c>
                     <c ca="right">
                        <p>0.036</p>
                     </c>
                     <c ca="right">
                        <p>0.691</p>
                     </c>
                     <c ca="right">
                        <p>-0.74</p>
                     </c>
                     <c ca="right">
                        <p>-0.15</p>
                     </c>
                     <c ca="right">
                        <p>0.321</p>
                     </c>
                     <c ca="right">
                        <p>0.974</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: Coefficient: linear regression coefficient; FDR: false discovery rate p value, with those in bold type significant at &#945; &#8804; 0.05.</p>
               </tblfn>
            </tbl>
            <p>Figure <figr fid="F2">2</figr> shows the top three markers (according to p value) related to LF response. The first panel shows the LOESS curve for SNP rs322695 of the <it>RARB </it>gene. The frequency of the minor allele increases as the &#916;%BF response to the LF diet becomes less pronounced (i.e., no loss of relative fat mass). The minor allele is completely absent among subjects with the largest decreases in %BF, and the frequency is &lt;10% among subjects whose decrease in %BF exceeded 1%. This finding indicates a strong association between the <it>RARB </it>marker and response to LF. Similar patterns are seen for <it>HNMT </it>rs3100722 and <it>PFKL </it>SNP rs2838549. The SNPs, <it>RARB </it>SNP rs322695, <it>HNMT </it>SNP rs3100722, and <it>PFKL </it>SNP rs2838549, are considered "torpid" markers for responsiveness to the LF diet.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Physiogenomic representation of the most significant genetic associations found in the low fat diet group</p>
               </caption>
               <text>
                  <p>Physiogenomic representation of the most significant genetic associations found in the low fat diet group. Individual patient genotypes (<it>circles</it>) of each SNP are overlaid on the distribution of &#916;%BF (<it>thin line</it>). Each circle represents a patient, with the horizontal axis specifying the &#916;%BF, and the vertical axis the carrier status for the minor allele: bottom, non-carriers; middle, single-carriers; top, double-carriers. A LOESS fit of the allele frequency (<it>thick line</it>) as a function of &#916;%BF is shown. The ordinate is labeled for the marker frequency (<it>thick line</it>) of the SNP denoted at the top of each panel. The ordinate scale is the same in all three panels. The ordinate scales for the genotypes (<it>circles</it>) and &#916;%BF distribution (<it>thin line</it>) are not shown. The abscissa is labeled for &#916;%BF in each panel. The abscissa scale is the same in all three panels and applies identically to marker frequency, genotypes, and &#916;%BF distribution.</p>
               </text>
               <graphic file="1743-7075-5-4-2"/>
            </fig>
            <p>Figure <figr fid="F3">3</figr> shows the top three markers associated with &#916;%BF through LC. The first panel in Figure <figr fid="F3">3</figr> shows the LOESS curve for SNP rs5950584 of the <it>AGTR2 </it>gene. The frequency of the minor allele is 30% in the &#916;%BF range that is less than -5%, and the minor allele is completely absent among subjects with subtle change in &#916;%BF (i.e., no loss of relative fat). A similar pattern is seen with the <it>GYS2 </it>SNP rs1478290. These two SNPs are considered reactive markers. The third panel shows the <it>RARB </it>SNP rs322695 response. The minor allele shows a higher frequency in the subject with little response in &#916;%BF, indicating that the <it>RARB </it>SNP rs322695 is a torpid marker of responsiveness to LC diet also.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Physiogenomic representation of the most significant genetic associations found in the low carbohydrate group</p>
               </caption>
               <text>
                  <p>Physiogenomic representation of the most significant genetic associations found in the low carbohydrate group. See Figure 2 legend for details regarding individual patient genotypes (<it>circles</it>), the distribution of &#916;%BF (<it>thin line</it>), and the LOESS fit of the allele frequency (<it>thick line</it>) as a function of &#916;%BF.</p>
               </text>
               <graphic file="1743-7075-5-4-3"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The present study shows that genetic associations with changes in &#916;%BF established for genes in pathways encompassing food intake, energy homeostasis, and adipocyte regulation occur in part through common pathways, and in part through different pathways that may differentiate low fat (LF) and low carbohydrate (LC) restriction. For both diets, &#916;%BF profiles assessed using DXA were affected by an intergenic SNP upstream of <it>RARB </it>(rs322695), suggesting that <it>RARB </it>is involved in a fat loss pathway common to both diets. In contrast, strong diet-specific associations were also found for a promoter region SNP in <it>AGTR2 </it>(rs5950584) through LC and <it>PFKL </it>through LF, suggesting that there are separate mechanisms for fat loss under the LF and LC diets.</p>
         <sec>
            <st>
               <p>Physiogenomic associations common to both LF and LC</p>
            </st>
            <p>We observed a significant relationship between the <it>RARB </it>SNP rs322695 and change in relative fat to <it>both </it>diets after accounting for nongenetic factors. The relationship was significant after correction for multiple testing in mediation of the LF &#916;%BF profiles (p &lt; 0.005). This observation is noteworthy in light of the putative role of the retinoic acid system in insulin resistance <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. The <it>RARB </it>SNP rs322695 is found 100 kb upstream and ~600 kb from the adjacent <it>THR </it>(thyroid hormone receptor) gene. We have attributed this SNP to <it>RARB </it>because it is the next gene downstream, and regulatory elements such as enhancers have been found several hundred kb from their transcription start sites. However, it cannot be excluded that the SNP effect may be unrelated to <it>RARB </it>protein expression, and rather involve an as yet uncharacterized protein or non-coding RNA <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. We are unaware of other polymorphisms in the region or near <it>RARB </it>that are related to body weight or fat regulation in humans and believe this finding to be novel.</p>
            <p>The widespread genomic distribution of retinoic acid response elements (<it>RARE</it>) suggests participation in many physiological pathways <abbrgrp><abbr bid="B62">62</abbr><abbr bid="B63">63</abbr><abbr bid="B64">64</abbr></abbrgrp>. Recently Morgan et al. <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> described a neural hypothesis for regulation of annual cycles of body fattening in animals in which changes in the expression of <it>RAR </it>in the arcuate nucleus of the brain were noted. Vitamin A deficiency preferentially decreases hepatic <it>RARB </it>expression <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>, and regulates hepatic glucose metabolic enzymes <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. Given that hepatic enzyme energy regulation occurs in part through <it>RARB </it>signaling, the present finding allows the hypothesis that the rs322695 variant affects such regulation.</p>
         </sec>
         <sec>
            <st>
               <p>Physiogenomic associations specific to LF</p>
            </st>
            <p>In addition to the <it>RARB </it>gene, LF &#916;%BF profiles had relationships through <it>PFKL </it>and one SNP in <it>HNMT </it>not found with LC. The <it>HNMT </it>SNP rs3100722, found at intron 2, and the <it>PFKL </it>SNP rs2838549, located in intron 8, showed significant relationships (p &lt; 0.041) after correction for multiple tests) second in strength only to the <it>RARB </it>gene. The <it>HNMT </it>inhibitor metoprine suppresses feeding in mice <abbrgrp><abbr bid="B67">67</abbr></abbrgrp>. The present finding enables us to hypothesize a role for <it>HNMT </it>in the regulation of food intake. Hepatic phosphofructokinase, a key regulatory enzyme for glycolysis encoded by <it>PFKL</it>, is responsive to macronutrient changes <abbrgrp><abbr bid="B68">68</abbr></abbrgrp> and is regulated by Vitamin A <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. Genetic loci near <it>PFKL </it>have been associated with bipolar affective disorder <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>, but to our knowledge, no SNPs are known to modulate diet response.</p>
         </sec>
         <sec>
            <st>
               <p>Physiogenomic associations specific to LC</p>
            </st>
            <p>The strongest association (p &lt; 0.003, after correction for multiple tests) was found in the LC group with SNP rs5950584 in the angiotensin II receptor, type 2 (<it>AGTR2</it>). This SNP is found ~4.5 kb upstream in the promoter region. The <it>AGTR2 </it>gene has a metabolic role that is in contrast to the vascular role of the angiotensin II type 1 receptor (<it>AGTR1 </it>gene), which we previously found linked to statin-associated elevations in serum creatine kinase <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Humans and mice express <it>AGTR2 </it>in muscle and adipose tissue, and evidence supports the existence of a functional renin angiotensin II system within adipose tissue <abbrgrp><abbr bid="B70">70</abbr></abbrgrp>. Mice lacking the <it>AGTR2 </it>receptor are resistant to the adipocyte hypertrophy and muscle cell insulin resistance induced by high fat, hypercaloric feeding <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>. <it>AGTR2</it>-dependent angiotensin II signaling thus could account for LC unresponsiveness <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>. <it>AGTR2 </it>polymorphisms were reported to modulate left ventricular mass, through the polymorphism known as G1675A (rs1403543) in a European population <abbrgrp><abbr bid="B72">72</abbr></abbrgrp>, and the T-A combination derived from G/T rs5193 and G/A rs5194 SNPs in a Cantonese population <abbrgrp><abbr bid="B73">73</abbr></abbrgrp>.</p>
            <p>In the present study, the <it>AGTR2 </it>SNP rs5950584 serves as a reactive marker for the LC diet response. The <it>AGTR2 </it>gene is X-linked, thus men can have only one of either the T (major) or the G (minor) allele, while women may have zero, one, or two copies of either allele. Men lost significantly more fat than women, which together with the X-linked nature of the gene might lead to a false positive result. However, gender was highly significant in our covariate model, and the association test was performed adjusting for it, which excludes such a confounding effect.</p>
            <p>Another association was found between LC response and the SNP rs1478290 in the <it>GYS2 </it>gene. The <it>GYS2 </it>product is glycogen synthase 2, a key regulator of hepatic glucose storage that is increased by feeding <abbrgrp><abbr bid="B74">74</abbr></abbrgrp>. The <it>GYS2 </it>SNP rs1478290 is found in the promoter region. We previously found a different <it>GYS2 </it>SNP, rs2306179, located in intron 5, to be associated with body weight loss in response to LC diet <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. The present study, conducted in a larger number of subjects, found also that a variant in the <it>GYS2 </it>gene is a response marker for the change in relative fat induced by LC.</p>
         </sec>
         <sec>
            <st>
               <p>Differentiation of LF and LC diet responses</p>
            </st>
            <p>The number of significant associations overall suggests a complex system through which regulation of the %BF phenotype is accomplished. Our list of genes, which is comparable to other studies to date <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, is exploratory, not comprehensive, and is representative of food intake, energy homeostasis, and adipocyte regulation. Virtually none of the genes in the present study were examined by previous diet studies <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B15">15</abbr></abbrgrp>. Nevertheless, the present results showed a larger number of gene associations with &#916;%BF profiles in relation to the LF diet compared to the LC diet. Based simply on the numbers of genes found to be significantly associated, we infer that the low fat diet utilizes a greater number of signal inputs into the regulation of relative body fat compared to the low carbohydrate diet. Even after the most stringent correction for multiple testing, RARB remained significantly associated with LF &#916;%BF and AGTR2 remained associated with LC &#916;%BF.</p>
            <p>Our findings run counter to those of a recent study <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> that reported no significant SNP associations with changes in BMI following carbohydrate or fat restriction despite using large cohorts. Methodological differences between the studies are worth noting. The present study used DXA to precisely assess &#916;%BF as opposed to relying on BMI. Second, different genes were studied. Here, the selection of genes was designed to reflect &#916;%BF phenotype variability. In contrast, the SNPs examined by Sorenson et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> were those demonstrated in previous reports to affect obesity and not diet response <it>per se</it>. Macronutrient compositions of the intervention diets were quite dichotomous in the present study, especially for carbohydrate (~12% and 57% of total energy as carbohydrate in the LC and LF arms, respectively, in the present study; <it>vs</it>. 42% and 57%, respectively, in the study of Sorenson et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>). We believe a greater imbalance in the macronutrient combination increases the strength of the dietary stimuli, which accentuates differences in the physiological signal intensities associated with each diet, increasing the chances for detection of physiogenomic relationships.</p>
         </sec>
         <sec>
            <st>
               <p>Clinical implication</p>
            </st>
            <p>The prevention and treatment of obesity could be more efficient if dietary recommendations were carried out based on knowledge of innate individual characteristics that are genetically predictable. Moreover, adherence to dietary advice may increase when the advice is personalized. DNA-guided regimens allow healthcare providers to tailor therapies based on individual patient characteristics, rather than the average diet responses applied in longitudinal studies <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B75">75</abbr></abbrgrp>. A dietary treatment with a higher average chance for success, for example, may be desirable for those patients who inherited an ensemble of DNA markers with the most responsive factors and the least torpid factors for it. We interpret the coefficients associated with each significant gene marker in Table <tblr tid="T4">4</tblr> as either having responsive or torpid effects to facilitate fat loss. The ability to match a diet regimen's genetic "contour" with the DNA profile of an individual patient marks the beginning of high-resolution personalized nutritional medicine for the treatment and prevention of obesity.</p>
         </sec>
         <sec>
            <st>
               <p>Limitations</p>
            </st>
            <p>The number of subjects studied, the list of genes analyzed, and in some cases the frequency of the minor allele in SNPs of interest, were relatively small. Thus the results will need to be validated before clinical application. Nevertheless, the <it>RARB </it>and <it>AGTR2 </it>results are clearly significant even when fully and most conservatively corrected for multiple comparisons. The p-values were confirmed by non-parametric permutation analysis, excluding non-normal distribution as a source of false positives. In addition, the RARB result was found in the LF group and independently confirmed in the LC group. Although we assessed only a small sample of SNPs in the genome, this study included 53 SNPs from 28 genes representing a larger ensemble of genetic probes than other published diet studies. The data for the present study were compiled from a series of studies in whom the majority of subjects were of European ancestry. We lack power to detect ethnogeographic associations or confounding effects. We did not consider men and women separately but accounted for the effect of gender through its use as a covariate. Future studies investigating a sex difference might be useful. Finally, both diets were hypocaloric. It is possible that the genes shown to exert their effects through both diets, actually do so through the commonality of caloric restriction.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RLS drafted the manuscript. JSV conceived of the study, designed and executed many of the diet restriction studies that supplied DNA, and helped draft the manuscript. AW participated in the design of the study, oversaw the genetic analyses, and performed the statistical analysis. MK performed the molecular genetic analyses. MLF participated in the design of the study and conducted some of the diet restriction studies that supplied DNA samples. WK participated in the design and coordination of diet restriction studies that supplied DNA and phenotype information. GR participated in the study design, provided oversight for genetic analyses and helped to draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This research was funded by grants from the University of Connecticut Center for Science &amp; Technology Commercialization and by Genomas internal research and development funds.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Comparison of energy-restricted very low-carbohydrate and low-fat diets on weight loss and body composition in overweight men and women</p>
            </title>
            <aug>
               <au>
                  <snm>Volek</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sharman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Judelson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rubin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Watson</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sokmen</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Silvestre</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>French</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Nutr Metab (Lond)</source>
            <pubdate>2004</pubdate>
            <volume>1</volume>
            <fpage>13</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">538279</pubid>
                  <pubid idtype="pmpid" link="fulltext">15533250</pubid>
                  <pubid idtype="doi">10.1186/1743-7075-1-13</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Separate effects of reduced carbohydrate intake and weight loss on atherogenic dyslipidemia</p>
            </title>
            <aug>
               <au>
                  <snm>Krauss</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Blanche</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Rawlings</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Fernstrom</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>PT</fnm>
               </au>
            </aug>
            <source>Am J Clin Nutr</source>
            <pubdate>2006</pubdate>
            <volume>83</volume>
            <fpage>1025</fpage>
            <lpage>1031</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16685042</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Comparison of the Atkins, Zone, Ornish, and LEARN diets for change in weight and related risk factors among overweight premenopausal women: the A TO Z Weight Loss Study: a randomized trial</p>
            </title>
            <aug>
               <au>
                  <snm>Gardner</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Kiazand</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Alhassan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Stafford</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Balise</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>JAMA</source>
            <pubdate>2007</pubdate>
            <volume>297</volume>
            <fpage>969</fpage>
            <lpage>977</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/jama.297.9.969</pubid>
                  <pubid idtype="pmpid" link="fulltext">17341711</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>A randomized trial of a low-carbohydrate diet for obesity</p>
            </title>
            <aug>
               <au>
                  <snm>Foster</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Wyatt</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>JO</fnm>
               </au>
               <au>
                  <snm>McGuckin</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Brill</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mohammed</snm>
                  <fnm>BS</fnm>
               </au>
               <au>
                  <snm>Szapary</snm>
                  <fnm>PO</fnm>
               </au>
               <au>
                  <snm>Rader</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Edman</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>2003</pubdate>
            <volume>348</volume>
            <fpage>2082</fpage>
            <lpage>2090</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJMoa022207</pubid>
                  <pubid idtype="pmpid" link="fulltext">12761365</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Physiogenomic analysis of weight loss induced by dietary carbohydrate restriction</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Windemuth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kocherla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Holford</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Forsythe</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Volek</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Nutr Metab (Lond)</source>
            <pubdate>2006</pubdate>
            <volume>3</volume>
            <fpage>20</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1479825</pubid>
                  <pubid idtype="pmpid" link="fulltext">16700901</pubid>
                  <pubid idtype="doi">10.1186/1743-7075-3-20</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Effects of variation in protein and carbohydrate intake on body mass and composition during energy restriction: a meta-regression 1</p>
            </title>
            <aug>
               <au>
                  <snm>Krieger</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Sitren</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Daniels</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Langkamp-Henken</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Am J Clin Nutr</source>
            <pubdate>2006</pubdate>
            <volume>83</volume>
            <fpage>260</fpage>
            <lpage>274</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16469983</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Effects of dietary carbohydrate restriction with high protein intake on protein metabolism and the somatotropic axis</p>
            </title>
            <aug>
               <au>
                  <snm>Harber</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Schenk</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Barkan</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Horowitz</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>J Clin Endocrinol Metab</source>
            <pubdate>2005</pubdate>
            <volume>90</volume>
            <fpage>5175</fpage>
            <lpage>5181</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/jc.2005-0559</pubid>
                  <pubid idtype="pmpid" link="fulltext">15972575</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A High Fat, Ketogenic Diet, Induces a Unique Metabolic State in Mice</p>
            </title>
            <aug>
               <au>
                  <snm>Kennedy</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Pissios</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Otu</snm>
                  <fnm>HH</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Asakura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Furukawa</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Marino</snm>
                  <fnm>FE</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Kahn</snm>
                  <fnm>BB</fnm>
               </au>
               <au>
                  <snm>Libermann</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Maratos-Flier</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Am J Physiol Endocrinol Metab</source>
            <pubdate>2007</pubdate>
            <volume>292</volume>
            <fpage>E1724</fpage>
            <lpage>E1739</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1152/ajpendo.00717.2006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17299079</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Dietary carbohydrate modification induces alterations in gene expression in abdominal subcutaneous adipose tissue in persons with the metabolic syndrome: the FUNGENUT Study</p>
            </title>
            <aug>
               <au>
                  <snm>Kallio</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kolehmainen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Laaksonen</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Kekalainen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Salopuro</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sivenius</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pulkkinen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Mykkanen</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Niskanen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Uusitupa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Poutanen</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>Am J Clin Nutr</source>
            <pubdate>2007</pubdate>
            <volume>85</volume>
            <fpage>1417</fpage>
            <lpage>1427</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17490981</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Carbohydrate balance predicts weight and fat gain in adults</p>
            </title>
            <aug>
               <au>
                  <snm>Eckel</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Hernandez</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Weil</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Shepard</snm>
                  <fnm>TY</fnm>
               </au>
               <au>
                  <snm>Grunwald</snm>
                  <fnm>GK</fnm>
               </au>
               <au>
                  <snm>Sharp</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Francis</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>JO</fnm>
               </au>
            </aug>
            <source>Am J Clin Nutr</source>
            <pubdate>2006</pubdate>
            <volume>83</volume>
            <fpage>803</fpage>
            <lpage>808</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16600931</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Low ratio of fat to carbohydrate oxidation as predictor of weight gain: study of 24-h RQ</p>
            </title>
            <aug>
               <au>
                  <snm>Zurlo</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lillioja</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Esposito-Del Puente</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nyomba</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Raz</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Saad</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Swinburn</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Knowler</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Bogardus</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ravussin</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Am J Physiol</source>
            <pubdate>1990</pubdate>
            <volume>259</volume>
            <fpage>E650</fpage>
            <lpage>E657</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">2240203</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Nutrient balance and energy expenditure during ad libitum feeding of high-fat and high-carbohydrate diets in humans</p>
            </title>
            <aug>
               <au>
                  <snm>Thomas</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Reed</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Abumrad</snm>
                  <fnm>NN</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>JO</fnm>
               </au>
            </aug>
            <source>Am J Clin Nutr</source>
            <pubdate>1992</pubdate>
            <volume>55</volume>
            <fpage>934</fpage>
            <lpage>942</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1570800</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The human obesity gene map: the 2005 update</p>
            </title>
            <aug>
               <au>
                  <snm>Rankinen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Zuberi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chagnon</snm>
                  <fnm>YC</fnm>
               </au>
               <au>
                  <snm>Weisnagel</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Argyropoulos</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Walts</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Perusse</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bouchard</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Obesity (Silver Spring)</source>
            <pubdate>2006</pubdate>
            <volume>14</volume>
            <fpage>529</fpage>
            <lpage>644</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16741264</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Does weight loss prognosis depend on genetic make-up?</p>
            </title>
            <aug>
               <au>
                  <snm>Moreno-Aliaga</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Marti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Martinez</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Obes Rev</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>155</fpage>
            <lpage>168</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1467-789X.2005.00180.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15836466</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Genetic Polymorphisms and Weight Loss in Obesity: A Randomised Trial of Hypo-Energetic High- versus Low-Fat Diets</p>
            </title>
            <aug>
               <au>
                  <snm>Sorensen</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Boutin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Larsen</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Verdich</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Petersen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Holst</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Echwald</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Dina</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Toubro</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Petersen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Polak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Clement</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Martinez</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Langin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Oppert</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Stich</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Macdonald</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Arner</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Saris</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Pedersen</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Astrup</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Froguel</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>PLoS Clin Trials</source>
            <pubdate>2006</pubdate>
            <volume>1</volume>
            <fpage>e12</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1488899</pubid>
                  <pubid idtype="pmpid" link="fulltext">16871334</pubid>
                  <pubid idtype="doi">10.1371/journal.pctr.0010012</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Physiogenomics: Integrating Systems Engineering and Nanotechnology for Personalized Medicine</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Windemuth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Holford</snm>
                  <fnm>TR</fnm>
               </au>
            </aug>
            <source>Tissue Engineering and Artificial Organs</source>
            <publisher>Boca Raton, CRC: Taylor and Francis</publisher>
            <editor>Bronzino JD</editor>
            <edition>3rd</edition>
            <series>
               <title>
                  <p>Bioengineering Engineering Handbook</p>
               </title>
            </series>
            <pubdate>2006</pubdate>
            <volume>28</volume>
            <fpage>28-1</fpage>
            <lpage>28-9</lpage>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Physiogenomic analysis links serum creatine kinase activities during statin therapy to vascular smooth muscle homeostasis</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Windemuth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kocherla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Holford</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Seip</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Pharmacogenomics</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>865</fpage>
            <lpage>872</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2217/14622416.6.8.865</pubid>
                  <pubid idtype="pmpid" link="fulltext">16296949</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Physiogenomic comparison of weight profiles of olanzapine- and risperidone-treated patients</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Goethe</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Caley</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Woolley</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Holford</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Kocherla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Windemuth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Leon</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Psychiatry</source>
            <pubdate>2007</pubdate>
            <volume>12</volume>
            <fpage>474</fpage>
            <lpage>482</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17199131</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Physiogenomic Association of Statin-Related Myalgia to Serotonin Receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Windemuth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Seip</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Dande</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sarokin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kocherla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Holford</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Muscle and Nerve</source>
            <pubdate>2007</pubdate>
            <volume>36</volume>
            <fpage>329</fpage>
            <lpage>335</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1002/mus.20871</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Dual energy X-ray absorptiometry assessment of fat mass distribution and its association with the insulin resistance syndrome</p>
            </title>
            <aug>
               <au>
                  <snm>Paradisi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Burtner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Leaming</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Garvey</snm>
                  <fnm>WT</fnm>
               </au>
               <au>
                  <snm>Hook</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cronin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Steinberg</snm>
                  <fnm>HO</fnm>
               </au>
               <au>
                  <snm>Baron</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Diabetes Care</source>
            <pubdate>1999</pubdate>
            <volume>22</volume>
            <fpage>1310</fpage>
            <lpage>1317</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2337/diacare.22.8.1310</pubid>
                  <pubid idtype="pmpid" link="fulltext">10480776</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Validity and reliability of dual-energy X-ray absorptiometry for the assessment of abdominal adiposity</p>
            </title>
            <aug>
               <au>
                  <snm>Glickman</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Marn</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Supiano</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Dengel</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>J Appl Physiol</source>
            <pubdate>2004</pubdate>
            <volume>97</volume>
            <fpage>509</fpage>
            <lpage>514</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1152/japplphysiol.01234.2003</pubid>
                  <pubid idtype="pmpid" link="fulltext">15075304</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>An isoenergetic very low carbohydrate diet improves serum HDL cholesterol and triacylglycerol concentrations, the total cholesterol to HDL cholesterol ratio and postprandial pipemic responses compared with a low fat diet in normal weight, normolipidemic women</p>
            </title>
            <aug>
               <au>
                  <snm>Volek</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Sharman</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Scheett</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>2003</pubdate>
            <volume>133</volume>
            <fpage>2756</fpage>
            <lpage>2761</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12949361</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Body composition and hormonal responses to a carbohydrate-restricted diet</p>
            </title>
            <aug>
               <au>
                  <snm>Volek</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Sharman</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Love</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Avery</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Scheett</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Metabolism</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <fpage>864</fpage>
            <lpage>870</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/meta.2002.32037</pubid>
                  <pubid idtype="pmpid" link="fulltext">12077732</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A ketogenic diet favorably affects serum biomarkers for cardiovascular disease in normal-weight men</p>
            </title>
            <aug>
               <au>
                  <snm>Sharman</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kraemer</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Love</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Avery</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Scheett</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Volek</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>2002</pubdate>
            <volume>132</volume>
            <fpage>1879</fpage>
            <lpage>1885</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12097663</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Carbohydrate restriction alters lipoprotein metabolism by modifying VLDL, LDL, and HDL subfraction distribution and size in overweight men</p>
            </title>
            <aug>
               <au>
                  <snm>Wood</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Volek</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shachter</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Contois</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>2006</pubdate>
            <volume>136</volume>
            <fpage>384</fpage>
            <lpage>389</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16424116</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Overconsumption of dietary fat and alcohol: Mechanisms involving lipids and hypothalamic peptides</p>
            </title>
            <aug>
               <au>
                  <snm>Leibowitz</snm>
                  <fnm>SF</fnm>
               </au>
            </aug>
            <source>Physiol Behav</source>
            <pubdate>2007</pubdate>
            <fpage>513</fpage>
            <lpage>521</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2077813</pubid>
                  <pubid idtype="pmpid" link="fulltext">17481672</pubid>
                  <pubid idtype="doi">10.1016/j.physbeh.2007.03.018</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Ghrelin-induced food intake and growth hormone secretion are altered in melanocortin 3 and 4 receptor knockout mice</p>
            </title>
            <aug>
               <au>
                  <snm>Shaw</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Irani</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Haskell-Luevano</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Millard</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Peptides</source>
            <pubdate>2005</pubdate>
            <volume>26</volume>
            <fpage>1720</fpage>
            <lpage>1727</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.peptides.2004.12.026</pubid>
                  <pubid idtype="pmpid" link="fulltext">16005545</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>HNMT, histamine N-methyl transferase, function</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=605238</url>
         </bibl>
         <bibl id="B29">
            <title>
               <p>LIPF, Gastic Lipase, function</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=601980</url>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Human distribution and release of a putative new gut hormone, peptide YY</p>
            </title>
            <aug>
               <au>
                  <snm>Adrian</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Ferri</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Bacarese-Hamilton</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Fuessl</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Polak</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Bloom</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>Gastroenterology</source>
            <pubdate>1985</pubdate>
            <volume>89</volume>
            <fpage>1070</fpage>
            <lpage>1077</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3840109</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Molecular characterization of the ligand-receptor interaction of neuropeptide Y</p>
            </title>
            <aug>
               <au>
                  <snm>Ingenhoven</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Beck-Sickinger</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Curr Med Chem</source>
            <pubdate>1999</pubdate>
            <volume>6</volume>
            <fpage>1055</fpage>
            <lpage>1066</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10519913</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Treating obesity: does antagonism of NPY fit the bill?</p>
            </title>
            <aug>
               <au>
                  <snm>Farooqi</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Cell Metab</source>
            <pubdate>2006</pubdate>
            <volume>4</volume>
            <fpage>260</fpage>
            <lpage>262</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cmet.2006.09.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17011498</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Effect of NPY5R antagonist MK-0557 on weight regain after very-low-calorie diet-induced weight loss</p>
            </title>
            <aug>
               <au>
                  <snm>Erondu</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wadden</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gantz</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Musser</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Bays</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bray</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>O'Neil</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Basdevant</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kaufman</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Heymsfield</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Amatruda</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Obesity (Silver Spring)</source>
            <pubdate>2007</pubdate>
            <volume>15</volume>
            <fpage>895</fpage>
            <lpage>905</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17426325</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Genetic dissection of neuronal pathways controlling energy homeostasis</p>
            </title>
            <aug>
               <au>
                  <snm>Balthasar</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Obesity (Silver Spring)</source>
            <pubdate>2006</pubdate>
            <volume>14 Suppl 5</volume>
            <fpage>222S</fpage>
            <lpage>227S</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17021371</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The melanocortin system and energy balance</p>
            </title>
            <aug>
               <au>
                  <snm>Butler</snm>
                  <fnm>AA</fnm>
               </au>
            </aug>
            <source>Peptides</source>
            <pubdate>2006</pubdate>
            <volume>27</volume>
            <fpage>281</fpage>
            <lpage>290</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.peptides.2005.02.029</pubid>
                  <pubid idtype="pmpid" link="fulltext">16434123</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Apolipoprotein A-IV, food intake, and obesity</p>
            </title>
            <aug>
               <au>
                  <snm>Tso</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Physiol Behav</source>
            <pubdate>2004</pubdate>
            <volume>83</volume>
            <fpage>631</fpage>
            <lpage>643</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.physbeh.2004.07.032</pubid>
                  <pubid idtype="pmpid" link="fulltext">15621069</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <aug>
               <au>
                  <snm>Salway</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Metabolism at a glance</source>
            <publisher>Oxford, Blackwell Science, Ltd.</publisher>
            <edition>2nd</edition>
            <pubdate>1999</pubdate>
         </bibl>
         <bibl id="B38">
            <title>
               <p>PFKL, phosphofructokinase, liver, function</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=171860</url>
         </bibl>
         <bibl id="B39">
            <title>
               <p>PFKM, phosphofructokinase, muscle, function</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=610681</url>
         </bibl>
         <bibl id="B40">
            <title>
               <p>What can we learn from seasonal animals about the regulation of energy balance?</p>
            </title>
            <aug>
               <au>
                  <snm>Morgan</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Mercer</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Barrett</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Prog Brain Res</source>
            <pubdate>2006</pubdate>
            <volume>153</volume>
            <fpage>325</fpage>
            <lpage>337</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16876584</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Exposure to an obesity-inducing diet early affects the pattern of expression of peroxisome proliferator, retinoic acid, and triiodothyronine nuclear receptors in the rat</p>
            </title>
            <aug>
               <au>
                  <snm>Redonnet</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Groubet</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Noel-Suberville</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bonilla</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Martinez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Higueret</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Metabolism</source>
            <pubdate>2001</pubdate>
            <volume>50</volume>
            <fpage>1161</fpage>
            <lpage>1167</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/meta.2001.26759</pubid>
                  <pubid idtype="pmpid" link="fulltext">11586487</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Dietary soy protein isolate modifies hepatic retinoic acid receptor-beta proteins and inhibits their DNA binding activity in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Xiao</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Mei</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>L'abbe</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Gilani</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Cooke</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Curran</snm>
                  <fnm>IH</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>2007</pubdate>
            <volume>137</volume>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17182792</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The role of angiotensin II and its receptors in regulation of adipose tissue metabolism and cellularity</p>
            </title>
            <aug>
               <au>
                  <snm>Zorad</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fickova</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zelezna</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Macho</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kral</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Gen Physiol Biophys</source>
            <pubdate>1995</pubdate>
            <volume>14</volume>
            <fpage>383</fpage>
            <lpage>391</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8786038</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Relationships of plasma adiponectin level and adiponectin receptors 1 and 2 gene expression to insulin sensitivity and glucose and fat metabolism in monozygotic and dizygotic twins</p>
            </title>
            <aug>
               <au>
                  <snm>Storgaard</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ling</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Groop</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Vaag</snm>
                  <fnm>AA</fnm>
               </au>
            </aug>
            <source>J Clin Endocrinol Metab</source>
            <pubdate>2007</pubdate>
            <volume>92</volume>
            <fpage>2835</fpage>
            <lpage>2839</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/jc.2006-1812</pubid>
                  <pubid idtype="pmpid" link="fulltext">17426101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Nutritional regulation of adipose tissue apolipoprotein E expression</p>
            </title>
            <aug>
               <au>
                  <snm>Huang</snm>
                  <fnm>ZH</fnm>
               </au>
               <au>
                  <snm>Luque</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Kineman</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Mazzone</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Am J Physiol Endocrinol Metab</source>
            <pubdate>2007</pubdate>
            <volume>293</volume>
            <fpage>E203</fpage>
            <lpage>E209</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1152/ajpendo.00118.2007</pubid>
                  <pubid idtype="pmpid" link="fulltext">17389709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Mammalian adipose tissue and muscle are major sources of lipid transfer protein mRNA</p>
            </title>
            <aug>
               <au>
                  <snm>Jiang</snm>
                  <fnm>XC</fnm>
               </au>
               <au>
                  <snm>Moulin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Quinet</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Goldberg</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Yacoub</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Agellon</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Compton</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schnitzer-Polokoff</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Tall</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1991</pubdate>
            <volume>266</volume>
            <fpage>4631</fpage>
            <lpage>4639</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1999438</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Cloning and sequencing of human cholesteryl ester transfer protein cDNA</p>
            </title>
            <aug>
               <au>
                  <snm>Drayna</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jarnagin</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>McLean</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Henzel</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kohr</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Fielding</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lawn</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1987</pubdate>
            <volume>327</volume>
            <fpage>632</fpage>
            <lpage>634</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/327632a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">3600759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Sterol upregulation of human CETP expression in vitro and in transgenic mice by an LXR element</p>
            </title>
            <aug>
               <au>
                  <snm>Luo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tall</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>2000</pubdate>
            <volume>105</volume>
            <fpage>513</fpage>
            <lpage>520</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">289164</pubid>
                  <pubid idtype="pmpid" link="fulltext">10683381</pubid>
                  <pubid idtype="doi">10.1172/JCI8573</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Insulin resistance and obesity: resistin, a hormone secreted by adipose tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Wolf</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Nutr Rev</source>
            <pubdate>2004</pubdate>
            <volume>62</volume>
            <fpage>389</fpage>
            <lpage>394</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1301/nr.2004.oct.389-394</pubid>
                  <pubid idtype="pmpid" link="fulltext">15508908</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Highly parallel SNP genotyping</p>
            </title>
            <aug>
               <au>
                  <snm>Fan</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Oliphant</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kermani</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Garcia</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gunderson</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Hansen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Steemers</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Butler</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Deloukas</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Galver</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hunt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McBride</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bibikova</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rubano</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wickham</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Doucet</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kruglyak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bentley</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Haas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rigault</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Stuelpnagel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chee</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Cold Spring Harb Symp Quant Biol</source>
            <pubdate>2003</pubdate>
            <volume>68</volume>
            <fpage>69</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/sqb.2003.68.69</pubid>
                  <pubid idtype="pmpid">15338605</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>BeadArray technology: enabling an accurate, cost-effective approach to high-throughput genotyping</p>
            </title>
            <aug>
               <au>
                  <snm>Oliphant</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Barker</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Stuelpnagel</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Chee</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Biotechniques</source>
            <pubdate>2002</pubdate>
            <volume>Suppl</volume>
            <fpage>56</fpage>
            <lpage>61</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12083399</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <aug>
               <au>
                  <snm>Dalgaard</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Introductory Statistics with R</source>
            <publisher>New York, Springer Science + Business Media</publisher>
            <pubdate>2002</pubdate>
         </bibl>
         <bibl id="B53">
            <aug>
               <au>
                  <snm>Faraway</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Linear Models with R</source>
            <publisher>Boca Raton, FL, Chapman &amp; Hall/CRC</publisher>
            <series>
               <title>
                  <p>CRC Texts in Statistical Science Series</p>
               </title>
            </series>
            <pubdate>2004</pubdate>
         </bibl>
         <bibl id="B54">
            <aug>
               <au>
                  <snm>Maindonald</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Braun</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Data Analysis and Graphics Using R: An Example-based Approach</source>
            <publisher>Cambridge, Cambridge University Press</publisher>
            <edition>2nd</edition>
            <pubdate>2007</pubdate>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Identifying differentially expressed genes using false discovery rate controlling procedures</p>
            </title>
            <aug>
               <au>
                  <snm>Reiner</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yekutieli</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Benjamini</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>368</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btf877</pubid>
                  <pubid idtype="pmpid" link="fulltext">12584122</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Controlling the false discovery rate:  a practical and powerful approach to multiple testing</p>
            </title>
            <aug>
               <au>
                  <snm>Benjamini</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hochberg</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Journal of the Royal Statistical Society, Series B</source>
            <pubdate>1995</pubdate>
            <volume>57</volume>
            <fpage>289</fpage>
            <lpage>300</lpage>
         </bibl>
         <bibl id="B57">
            <title>
               <p>On the adaptive control of the false discovery rate in multiple testing with independent statistics</p>
            </title>
            <aug>
               <au>
                  <snm>Benjamini</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hochberg</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Journal of Educational and Behavioral Statistics</source>
            <pubdate>2000</pubdate>
            <volume>25</volume>
            <fpage>60</fpage>
            <lpage>83</lpage>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Locally weighted regression: an approach to regression analysis by local fitting</p>
            </title>
            <aug>
               <au>
                  <snm>Cleveland</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Devlin</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>Journal of the Amercian Statistical Association</source>
            <pubdate>2007</pubdate>
            <volume>83</volume>
            <fpage>596</fpage>
            <lpage>610</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2289282</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Robust locally weighted regression and smoothing scatterplots</p>
            </title>
            <aug>
               <au>
                  <snm>Cleveland</snm>
                  <fnm>WS</fnm>
               </au>
            </aug>
            <source>Journal of the Amercian Statistical Association</source>
            <pubdate>2007</pubdate>
            <volume>74</volume>
            <fpage>829</fpage>
            <lpage>836</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2286407</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Mody</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Preitner</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Peroni</snm>
                  <fnm>OD</fnm>
               </au>
               <au>
                  <snm>Zabolotny</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Kotani</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Quadro</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kahn</snm>
                  <fnm>BB</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>436</volume>
            <fpage>356</fpage>
            <lpage>362</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03711</pubid>
                  <pubid idtype="pmpid" link="fulltext">16034410</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>The functional genomics of noncoding RNA</p>
            </title>
            <aug>
               <au>
                  <snm>Mattick</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>309</volume>
            <fpage>1527</fpage>
            <lpage>1528</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1117806</pubid>
                  <pubid idtype="pmpid" link="fulltext">16141063</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <aug>
               <au>
                  <snm>Laudet</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Gronemeyer</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>The nuclear receptor facts book</source>
            <publisher>San Diego, Academic Press</publisher>
            <pubdate>2002</pubdate>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Retinoids and Hox genes</p>
            </title>
            <aug>
               <au>
                  <snm>Marshall</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Morrison</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Studer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Popperl</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Krumlauf</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>FASEB J</source>
            <pubdate>1996</pubdate>
            <volume>10</volume>
            <fpage>969</fpage>
            <lpage>978</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8801179</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Cytochrome P450RAI(CYP26) promoter: a distinct composite retinoic acid response element underlies the complex regulation of retinoic acid metabolism</p>
            </title>
            <aug>
               <au>
                  <snm>Loudig</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Babichuk</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Abu-Abed</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mueller</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Petkovich</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Endocrinol</source>
            <pubdate>2000</pubdate>
            <volume>14</volume>
            <fpage>1483</fpage>
            <lpage>1497</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/me.14.9.1483</pubid>
                  <pubid idtype="pmpid" link="fulltext">10976925</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Retinoid regulation of the phosphoenolpyruvate carboxykinase gene in liver</p>
            </title>
            <aug>
               <au>
                  <snm>Shin</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Odom</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Scribner</snm>
                  <fnm>KB</fnm>
               </au>
               <au>
                  <snm>Ghoshal</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McGrane</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Mol Cell Endocrinol</source>
            <pubdate>2002</pubdate>
            <volume>195</volume>
            <fpage>39</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0303-7207(02)00215-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12354671</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Vitamin A regulates genes involved in hepatic gluconeogenesis in mice: phosphoenolpyruvate carboxykinase, fructose-1,6-bisphosphatase and 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase</p>
            </title>
            <aug>
               <au>
                  <snm>Shin</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>McGrane</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>1997</pubdate>
            <volume>127</volume>
            <fpage>1274</fpage>
            <lpage>1278</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9202079</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Metoprine, an inhibitor of histamine N-methyltransferase but not catechol-O-methyltransferase, suppresses feeding in sated and in food deprived rats</p>
            </title>
            <aug>
               <au>
                  <snm>Lecklin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tuomisto</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>MacDonald</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Methods Find Exp Clin Pharmacol</source>
            <pubdate>1995</pubdate>
            <volume>17</volume>
            <fpage>47</fpage>
            <lpage>52</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7542717</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Time course of enzyme changes after a switch from a high-fat to a low-fat diet</p>
            </title>
            <aug>
               <au>
                  <snm>Brooks</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Lampi</snm>
                  <fnm>BJ</fnm>
               </au>
            </aug>
            <source>Comp Biochem Physiol B Biochem Mol Biol</source>
            <pubdate>1997</pubdate>
            <volume>118</volume>
            <fpage>359</fpage>
            <lpage>365</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0305-0491(97)00163-6</pubid>
                  <pubid idtype="pmpid">9440229</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>A follow-up linkage study supports evidence for a bipolar affective disorder locus on chromosome 21q22</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Juo</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Terwilliger</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Grunn</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tong</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Brito</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Loth</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Kanyas</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lerer</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Endicott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Penchaszadeh</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gilliam</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Baron</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Am J Med Genet</source>
            <pubdate>2001</pubdate>
            <volume>105</volume>
            <fpage>189</fpage>
            <lpage>194</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajmg.1195</pubid>
                  <pubid idtype="pmpid" link="fulltext">11304836</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Co-expression of renin-angiotensin system genes in human adipose tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Engeli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gorzelniak</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kreutz</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Runkel</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Distler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sharma</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>J Hypertens</source>
            <pubdate>1999</pubdate>
            <volume>17</volume>
            <fpage>555</fpage>
            <lpage>560</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00004872-199917040-00014</pubid>
                  <pubid idtype="pmpid" link="fulltext">10404958</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>Deletion of the angiotensin type 2 receptor (AT2R) reduces adipose cell size and protects from diet-induced obesity and insulin resistance</p>
            </title>
            <aug>
               <au>
                  <snm>Yvan-Charvet</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Even</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bloch-Faure</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Guerre-Millo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Moustaid-Moussa</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ferre</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Quignard-Boulange</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <fpage>991</fpage>
            <lpage>999</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2337/diabetes.54.4.991</pubid>
                  <pubid idtype="pmpid" link="fulltext">15793237</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Left ventricular mass in relation to genetic variation in angiotensin II receptors, renin system genes, and sodium excretion</p>
            </title>
            <aug>
               <au>
                  <snm>Kuznetsova</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Staessen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Thijs</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kunath</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Olszanecka</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ryabikov</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tikhonoff</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Stolarz</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bianchi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Casiglia</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fagard</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Brand-Herrmann</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Kawecka-Jaszcz</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Malyutina</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nikitin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Brand</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Circulation</source>
            <pubdate>2004</pubdate>
            <volume>110</volume>
            <fpage>2644</fpage>
            <lpage>2650</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1161/01.CIR.0000145541.63406.BA</pubid>
                  <pubid idtype="pmpid" link="fulltext">15492316</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Angiotensin II type 2 receptor gene polymorphisms and cardioprotective role in essential hypertension</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>BS</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>YZ</fnm>
               </au>
            </aug>
            <source>Heart Vessels</source>
            <pubdate>2006</pubdate>
            <volume>21</volume>
            <fpage>95</fpage>
            <lpage>101</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00380-005-0865-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">16550310</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Effect of feeding, fasting, and diabetes on liver glycogen synthase activity, protein, and mRNA in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Gannon</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Nuttall</snm>
                  <fnm>FQ</fnm>
               </au>
            </aug>
            <source>Diabetologia</source>
            <pubdate>1997</pubdate>
            <volume>40</volume>
            <fpage>758</fpage>
            <lpage>763</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s001250050746</pubid>
                  <pubid idtype="pmpid" link="fulltext">9243095</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B75">
            <title>
               <p>Quo Vadis Personalized Medicine?</p>
            </title>
            <aug>
               <au>
                  <snm>Rua&#241;o</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Personalized Medicine</source>
            <pubdate>2004</pubdate>
            <volume>1</volume>
            <fpage>1</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1517/17410541.1.1.1</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
