<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1743-7075-4-6</ui>
	<ji>1743-7075</ji>
	<fm>
		<dochead>Research</dochead>
		<bibl>
			<title>
				<p>Expression of PPAR&#945; modifies fatty acid effects on insulin secretion in uncoupling protein-2 knockout mice</p>
			</title>
			<aug>
				<au id="A1" ca="yes">
					<snm>Fatehi-Hassanabad</snm>
					<fnm>Zahra</fnm>
					<insr iid="I1"/>
					<email>zfatehi@upei.ca</email>
				</au>
				<au id="A2">
					<snm>Chan</snm>
					<mi>B</mi>
					<fnm>Catherine</fnm>
					<insr iid="I1"/>
					<email>cbchan@ualberta.ca</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Department of Biomedical Sciences, Atlantic Veterinary College, University of Prince Edward Island, Charlottetown, PE C1A 4P3, Canada</p>
				</ins>
			</insg>
			<source>Nutrition &amp; Metabolism</source>
			<issn>1743-7075</issn>
			<pubdate>2007</pubdate>
			<volume>4</volume>
			<issue>1</issue>
			<fpage>6</fpage>
			<url>http://www.nutritionandmetabolism.com/content/4/1/6</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">17341307</pubid><pubid idtype="doi">10.1186/1743-7075-4-6</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>14</day>
					<month>11</month>
					<year>2006</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>06</day>
					<month>3</month>
					<year>2007</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>06</day>
					<month>3</month>
					<year>2007</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2007</year>
			<collab>Fatehi-Hassanabad and Chan; licensee BioMed Central Ltd.</collab>
			<note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Aims/hypothesis</p>
					</st>
					<p>In uncoupling protein-2 (UCP2) knockout (KO) mice, protection of beta cells from fatty acid exposure is dependent upon transcriptional events mediated by peroxisome proliferator-activated receptor-&#945; (PPAR&#945;).</p>
				</sec>
				<sec>
					<st>
						<p>Methods</p>
					</st>
					<p>PPAR&#945; expression was reduced in isolated islets from UCP2KO and wild-type (WT) mice with siRNA for PPAR&#945; (siPPAR&#945;) overnight. Some islets were also cultured with oleic or palmitic acid, then glucose stimulated insulin secretion (GSIS) was measured. Expression of genes was examined by quantitative RT-PCR or immunoblotting. PPAR&#945; activation was assessed by oligonucleotide consensus sequence binding.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>siPPAR&#945; treatment reduced PPAR&#945; protein expression in KO and WT islets by &gt;85%. In siPPAR&#945;-treated UCP2KO islets, PA but not OA treatment significantly decreased the insulin response to 16.5 mM glucose. In WT islets, siPPAR&#945; treatment did not modify GSIS in PA and OA exposed groups. In WT islets, PA treatment significantly increased UCP2 mRNA and protein expression. Both PA and OA treatment significantly increased PPAR&#945; expression in UCP2KO and WT islets but OA treatment augmented PPAR&#945; protein expression only in UCP2KO islets (p &lt; 0.05). PA treatment induced carnitine palmitoyltransferase I, acyl CoA oxidase and malonyl CoA decarboxylase mRNA in UCP2KO islets.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st>
					<p>These data show that the negative effect of saturated fatty acid on GSIS is mediated by PPAR&#945;/UCP2. Knockout of UCP2 protects beta-cells from PA exposure. However, in the absence of both UCP2 and PPAR&#945; even a short exposure (24 h) to PA significantly impairs GSIS.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>In pancreatic beta cells, free fatty acids (FFA) modulate the process of glucose-stimulated insulin secretion (GSIS) <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Short term exposure of islets to elevated concentrations of FFA enhances GSIS whereas long term exposure results in impaired GSIS. Suppressed GSIS after FFA treatment may be caused by up-regulation in beta cells of uncoupling protein-2 (UCP2), the expression <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> and activity <abbrgrp><abbr bid="B3">3</abbr></abbrgrp> of which is increased by FFA. UCPs (numbered 1&#8211;3 in order of their discovery) decrease metabolic efficiency by dissociating ATP synthesis from substrate oxidation in the mitochondrion <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The mechanism is controversial but may involve promotion of proton or fatty acid translocation <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. In beta cells, the physiological role of UCP2 is not established. However, mild uncoupling stimulated as a consequence of variation in respiratory rate may be a fine modulator of insulin secretion <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Alternatively, UCP2 may protect islets from oxidative stress, as has been shown in brain <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Paradoxically, our previous study showed that feeding a high fat diet to mice lacking UCP2 enhanced beta cell responsiveness to glucose, preserved islet sensitivity to glucose and increased beta cell mass <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. This occurred in spite of increased mitochondrial superoxide production in the beta cells of these mice <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Interestingly, CPTI was strongly induced in UCP2 KO mouse islets <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> and palmitic acid (PA) oxidation was enhanced leading to reduced islet triglyceride content <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. This suggests that enzymes regulating FFA catabolism may be generally up-regulated in the absence of UCP2.</p>
			<p>FFA may affect beta cell function subsequent to changes in the expression of enzymes related to insulin secretion via their actions on certain transcription factors. Long chain unsaturated FFA are natural, preferentially-binding ligands of peroxisome proliferator-activated receptors (PPARs) but saturated fatty acids like PA can also act as ligands <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. The existence of both PPAR&#945; and PPAR&#947; has been detected in pancreatic beta cells of both humans and rodents <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. PPAR&#945; induces expression of UCP2 and enzymes regulating fatty acid oxidation in pancreatic beta cells <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> via PPAR response elements in target gene promoter regions <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. The induction of UCP2 presumably negatively influences insulin secretion <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. However, other studies suggest that PPAR&#945; enhances GSIS <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. We considered that the fat oxidation phenotype displayed by UCP2 KO mice on high fat diet might be related to altered PPAR&#945; transcriptional activity. In skeletal muscle cells, intracellular generation of reactive oxygen species (ROS) leads to a down-regulation of PPAR&#945; activity <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. ROS are elevated in UCP2 KO mice islets <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, leading to the hypothesis that UCP2 activity can modulate PPAR&#945; in islets.</p>
			<p>To investigate this hypothesis, the UCP2 KO mouse provides a unique model. For studies of loss of function via knockdown of target gene expression, RNA interference (RNAi) has been shown to be a powerful gene suppression tool. In mammalian cells, small interfering RNA (siRNA) of 19- to 29-nt, inhibit target gene expression in a sequence-specific manner <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. In the present study, we used a PPAR&#945; siRNA vector to suppress PPAR&#945; gene in pancreatic beta cells isolated from either UCP2KO or wild type (WT) mice in the absence or presence of saturated or monounsaturated FFA. We have also investigated the effects of these FFA on GSIS and expression of important lipogenic and lipolytic enzymes in pancreatic beta cells.</p>
		</sec>
		<sec>
			<st>
				<p>Materials and methods</p>
			</st>
			<sec>
				<st>
					<p>Reagents</p>
				</st>
				<p>Collagenase (type XI), palmitic acid (PA), oleic acid (OA), BSA (fatty acid free), N-[1-(2,3-dioleoyloxy) propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) and all cell culture supplies (except as noted) were purchased from Sigma-Aldrich (Oakville, ON, Canada). TranSilent PPAR&#945; siRNA, control vectors and transBinding PPAR&#945; assay kits were purchased from Panomics (Redwood City, CA, USA). For western blotting, primary antibodies for PPAR&#945; (rabbit polyclonal IgG) and UCP2 were from ABR (Cedarlane, Burlington, ON, Canada) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively. &#946;-actin primary antibody and all secondary antibodies were from Sigma-Aldrich. TRIzol, trypsin and Opti-MEM were obtained from Invitrogen (Burlington, ON, Canada).</p>
			</sec>
			<sec>
				<st>
					<p>Animals</p>
				</st>
				<p>Female UCP2 WT or KO mice were bred from lines generated as described previously and used at 4 months of age <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Protocols were approved by the Animal Care Committee of the University of Prince Edward Island following the guidelines of the Canadian Council on Animal Care.</p>
			</sec>
			<sec>
				<st>
					<p>Pancreatic islet isolation and culture</p>
				</st>
				<p>Pancreatic islets were isolated as described previously <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Briefly, the pancreatic duct was perfused with 3 ml of collagenase (3 mg/ml) in Hanks Balanced Salt Solution. The pancreas was then chopped into 2-mm pieces and digested by shaking (150 rpm) for a total of 40 min at 37&#176;C. Islets were enriched by filtration <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and then hand picked from the acinar tissue debris. Islets were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 1% antibiotic/antimycotic, 10 mM HEPES and 8.3 mM glucose. In different wells, defatted BSA (1%), oleic acid (OA, 0.4 mM + 1% BSA) or palmitic acid (PA, 0.4 mM + 1% BSA) was added to the isolated islets for 24 h. In some experiments, PPAR&#945; knockdown with siRNA was achieved as described below.</p>
			</sec>
			<sec>
				<st>
					<p>Islet transfection of plasmid and siRNA vectors</p>
				</st>
				<p>To optimize the tranfection protocol, islets were transfected with a plasmid containing the full length enhanced green fluorescence protein (EGFP) cDNA (1 &#956;g/&#956;l) using DOTAP (1:4 &#8211; 1:6 V/V of cDNA to DOTAP) following the protocol of Lakey et al <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Transfected islets were then incubated for 5&#8211;6 h in Opti-MEM before adding DMEM with 20% calf serum. After 24 h, the medium was replaced by fresh DMEM. After 48 h, the islets were dissociated using 0.016 % trypsin, adhered to poly-L-lysine coated glass slides, fixed in 2% glutaraldehyde solution and assayed for EGFP expression using a fluorescent microscope. The number of fluorescing cells was counted to estimate transfection efficiency under different experimental conditions. The optimal protocol (with a cDNA:DOTAP ratio of 1:6) was then used to transfect islets with PPAR&#945; siRNA or control vector (1.5 &#956;g per transfection).</p>
			</sec>
			<sec>
				<st>
					<p>Islet GSIS determination</p>
				</st>
				<p>Groups of 3 islets were pre-incubated in 1 ml DMEM with 2.8 mM glucose for 60 min at 37&#176;C, 5% CO<sub>2</sub>. Islets were then incubated for 90 min at the indicated glucose concentration (2.8, 5.5, 11, 16.5 or 22 mM glucose) to assess insulin secretion. At the end of a GSIS experiment, the supernatant was decanted to a fresh tube and insulin was solubilized from the pelleted islets by adding 3% acetic acid. All samples were frozen at -20&#176;C until insulin was quantified by radioimmunoassay.</p>
			</sec>
			<sec>
				<st>
					<p>Western blotting</p>
				</st>
				<p>For PPAR&#945; (140 &#956;g of total islet protein) and UCP2 (100 &#956;g of total islet protein) protein expression, pancreatic islets were lysed with Nonidet P-40 (0.5%) added to the protein extraction buffer containing protease inhibitor. Total protein was separated by 12% SDS-PAGE with a 5% stacking gel. Then, the gel was electrotransferred onto nitrocellulose membranes (Trans-Blot, Bio-Rad, Toronto, Canada) and blocked with 5% skim milk for 1 h. The membrane was incubated in primary antibody (anti-PPAR&#945;, 1:500 or anti-UCP2, 1:2500), diluted in 0.1% Tween Tris-buffered saline (TTBS) overnight at 4&#176;C. Subsequently, the membrane was incubated in secondary antibody (PPAR&#945;: anti-rabbit IgG HRP conjugate, 1:1000; UCP2: rabbit anti-goat HRP conjugate, 1:10 000) diluted in 0.1 % TTBS, for 2 h at room temperature. Specific signals were detected using enhanced ECL Plus reagent (GE Healthcare, Mississauga, ON, Canada). Protein loading was normalized using a house keeping gene antibody (mouse anti &#946;-actin, 1:10 000 and anti-mouse IgG HRP, 1:5000).</p>
			</sec>
			<sec>
				<st>
					<p>RNA isolation and cDNA synthesis</p>
				</st>
				<p>Total RNA was extracted from 40 isolated islets from WT or UCP2KO mice by TRIzol isolation technique. According to the manufacturer's instructions, cDNA was synthesized from 1 &#956;g total RNA using a Cloned AMV First-Strand cDNA Synthesis kit (Invitrogen).</p>
			</sec>
			<sec>
				<st>
					<p>Real time PCR</p>
				</st>
				<p>Real time PCR reactions were carried out using 1 &#956;g of cDNA. PCR products were quantified fluorometrically using SYBR Green (Bio-Rad, Toronto, ON, Canada) in a Rotor Gene RG-3000 (Corbett Life Sciences, Montreal, PQ, Canada). Glyceraldehyde-3-phosphate dehyrogenase (GAPDH) expression in each sample was used as a control. Table <tblr tid="T1">1</tblr> shows the sequences of the primers (forward and reverse) used for amplification. PCR amplification was performed for 40 cycles with 10 s at 95&#176;C, 15 s at 60&#176;C and 20 s at 72&#176;C. Data were expressed as fold increase in the specific gene expression as compared with GAPDH expression.</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>Sets of primers for real-time PCR analysis</p>
					</caption>
					<tblbdy cols="2">
						<r>
							<c ca="left">
								<p>Primer Name</p>
							</c>
							<c ca="left">
								<p>Sequence</p>
							</c>
						</r>
						<r>
							<c cspan="2">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>PPAR&#945;</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'GGGCTCTCCCACATCCTT3'</p>
								<p>reverse:</p>
								<p>5'CCCATTTCGGTAGCAGGTAGTC3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>UCP2 [8]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'CAGCCAGCGCCCAGTACC3'</p>
								<p>reverse:</p>
								<p>5'CAATGCGGACGGAGGCAAAGC3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>GAPDH [8]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'GTGGCAGTGATGGCATGGAC3'</p>
								<p>reverse:</p>
								<p>5'CAGCACCAGTGGATGCAGGG3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>ACO [53]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'ATATTTACGTCACGTTTACCCCGG3'</p>
								<p>reverse:</p>
								<p>5'GGCAGGTCATTCAAGTACGACAC3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>CPT1 [50]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'TTCACTGTGACCCCAGACGG3'</p>
								<p>reverse:</p>
								<p>5'AATGGACCAGCCCCATGGAGA3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MCD [54]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'TGTTCTGATGGGCCAGGCTTACTT3'</p>
								<p>reverse:</p>
								<p>5'TAGAGCTTTCTGAAGGCACAGGCT3'</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>ACC [55]</p>
							</c>
							<c ca="left">
								<p>forward:</p>
								<p>5'TGGATCCGCTTACAGAGAGACTTTT3'</p>
								<p>reverse:</p>
								<p>5'GCCGGAGCATCTCATTCG3'</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Nuclear protein extraction and PPAR&#945; activity assay</p>
				</st>
				<p>Isolated islets from UCP2KO and WT mice were cultured as described above. Nuclear extracts were prepared according to the kit instructions and kept at -80&#176;C until analysis. Activated PPAR&#945; from nuclear extract was measured by its DNA binding to immobilized oligonucleotide containing a PPAR consensus binding site using the TransBinding PPAR&#945; assay kit. Binding was assessed by measured absorbance at 450 nm.</p>
			</sec>
			<sec>
				<st>
					<p>Fatty acid oxidation</p>
				</st>
				<p>Oxidation of PA was measured in islets from UCP2KO and WT mice as described <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Statistical analysis</p>
				</st>
				<p>All data are expressed as means &#177; SE. Statistical significance was assessed by using either two-way ANOVA followed by Tukey-Kramer test or unpaired Student t test. A <it>P </it>value of less than 0.05 was considered statistically significant.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>Transfecting plasmid DNA with DOTAP in mouse islets</p>
				</st>
				<p>To optimize islet tranfection, the EGFP cDNA:DOTAP ratio was varied from 1:4 to 1:6 and EGFP expression examined by fluorescence microscopy. At a DNA/DOTAP ratio of 1:6 (V/V), DOTAP effectively allowed transfection of pancreatic islet cells with an EGFP-encoding plasmid (Figure <figr fid="F1">1A</figr>). When measured by assessing fluorescence of individual beta cells from trypsin-dispersed islets, the transfection efficiency was 85 &#177; 2 % (n = 8). EGFP transfection did not change insulin secretion in response to different glucose concentrations compared to untransfected islets (Figure <figr fid="F1">1B</figr>). PPAR&#945; protein expression was not modified by DOTAP treatment of the islets (data not shown).</p>
				<fig id="F1">
					<title>
						<p>Figure 1</p>
					</title>
					<caption>
						<p>Optimization of islet transfection protocol</p>
					</caption>
					<text>
						<p>Optimization of islet transfection protocol. <b>(A) </b>Intact islets transfected with DOTAP at a DNA/liposome ratio of 1:6 (V/V). Transfected cells within the islets appear green. <b>(B) </b>Glucose stimulated insulin release in control (open squares, n = 6) and DOTAP-treated islets (closed squares, n = 4). Insulin secretion (as % of total islet content) was measured in response to different concentrations of glucose. DOTAP did not modify insulin secretion.</p>
					</text>
					<graphic file="1743-7075-4-6-1"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>PPAR&#945; knock-down potentiates GSIS</p>
				</st>
				<p>In a first series of experiments, we compared the effects of siPPAR&#945; with those of control vector (siC) on the function of UCP2 KO and WT isolated pancreatic islets. Knockdown of PPAR&#945; was &gt;85% in both groups (Table <tblr tid="T2">2</tblr>, see also below). With increasing glucose concentrations GSIS was increased in siC treated UCP2KO and WT islets (Figure <figr fid="F2">2A</figr> &amp;<figr fid="F2">2B</figr>). In UCP2KO siPPAR&#945;-treated islets, the stimulatory effect of glucose on insulin secretion was significantly potentiated by ~75%, particularly at glucose concentrations &#8805;11 mM (Figure <figr fid="F2">2A</figr>, effect of glucose; P &lt; 0.001; effect of siPPAR&#945;; P &lt; 0.001). siPPAR&#945; treatment had a less marked effect (~50%) on insulin secretion from WT isolated islets at 16.5 mM glucose (Figure <figr fid="F2">2B</figr>, effect of glucose; P &lt; 0.01, effect of siPPAR&#945;; P &lt; 0.01).</p>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>Glucose stimulated insulin release in UCP2 KO <b>(A) </b>and WT <b>(B) </b>islets</p>
					</caption>
					<text>
						<p>Glucose stimulated insulin release in UCP2 KO <b>(A) </b>and WT <b>(B) </b>islets. In UCP2 KO and WT islets, insulin secretion was measured in response to different concentrations of glucose in islets transfected with siPPAR&#945; (open squares, n = 5&#8211;6) or siC (closed squares, n = 8&#8211;9). *p &lt; 0.05, **p &lt; 0.01, ***p &lt; 0.001 comparing response to glucose in siPPAR&#945; vs siC islets.</p>
					</text>
					<graphic file="1743-7075-4-6-2"/>
				</fig>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>Effect of transilent siRNA PPAR&#945; transfection (1.5 &#956;g, overnight) on PPAR&#945; expression (relative to &#946;-actin) in islets isolated from UCP2 KO mice and WT mice (compared to the transilent siRNA control vector). Data are expressed as means &#177; sem (n = 4&#8211;7).</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>Groups</p>
							</c>
							<c ca="left">
								<p>Control vector</p>
							</c>
							<c ca="left">
								<p>Transilent PPAR&#945; vector</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>UCP2 KO</p>
							</c>
							<c ca="left">
								<p>0.349 &#177; 0.136</p>
							</c>
							<c ca="left">
								<p>0.029 &#177; 0.02</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>WT</p>
							</c>
							<c ca="left">
								<p>0.242 &#177; 0.116</p>
							</c>
							<c ca="left">
								<p>0.024 &#177; 0.007</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Effects of PA and OA on GSIS after siPPAR&#945; knockdown</p>
				</st>
				<p>To examine the effects of FFA on GSIS in the absence or presence of PPAR&#945; knockdown, WT or UCP2KO islets were incubated 24 h following siRNA transfection with PA (0.4 mM + 1% BSA) or OA (0.4 mM + 1% BSA). Results for UCP2KO islets are shown in Figure <figr fid="F3">3A</figr>. In UCP2 KO siC-treated islets, PA and OA did not modify basal insulin secretion in response to 2.8 mM glucose but increasing the glucose concentration to 16.5 mM significantly augmented insulin secretion by 4-6-fold in BSA, PA and OA treated groups. Treatment of UCP2KO islets with siPPAR&#945; significantly increased basal insulin secretion by 2-fold in the BSA treatment group. In siPPAR&#945; treated UCP2KO islets, 16.5 mM glucose significantly stimulated insulin secretion by 2-fold in both FFA treatments. However, after PPAR&#945; knockdown the response to 16.5 mM glucose of UCP2KO islets was significantly reduced ~50% in the PA-incubated group compared with siC whereas the response to OA was not altered by PPAR&#945; knockdown (Figure <figr fid="F3">3A</figr>).</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Effect of siPPAR&#945; and FFA on glucose-stimulated insulin secretion</p>
					</caption>
					<text>
						<p>Effect of siPPAR&#945; and FFA on glucose-stimulated insulin secretion. Glucose-stimulated insulin release by UCP2 KO <b>(A) </b>and WT islets <b>(B) </b>after treatment with either control medium (defatted BSA, 1%), palmitic acid (PA, 0.4 mM + BSA) or oleic acid (OA, 0.4 mM + BSA) for 24 h in the presence of transilent siRNA control vector (open bars, n = 6) or transilent siPPAR&#945; in UCP2 KO islets (closed bars, n = 6). Two-way ANOVA performed on insulin release in response to 2.8 or 16.5 mM glucose showed a significant difference among treatment groups (P &lt; 0.0001). Results of Tukey-Kramer multiple comparison test at each treatment showed a significant difference between siC and si PPAR&#945; (*P &lt; 0.05 for effect of 16.5 mM glucose compared with matched 2.8 mM glucose groups; # P &lt; 0.01 for effect of si PPAR&#945;).</p>
					</text>
					<graphic file="1743-7075-4-6-3"/>
				</fig>
				<p>In siC-WT islets (Figure <figr fid="F3">3B</figr>), FFA did not modify basal or glucose-stimulated insulin release. Likewise, neither PA nor OA affected basal insulin secretion in siPPAR&#945;-WT islets. However, in siPPAR&#945;-compared to siC-treated WT islets, insulin secretion in response to 2.8 mM glucose was significantly decreased by PA. After PPAR&#945; knockdown, and compared to 16.5 mM glucose in siC groups, insulin release was significantly increased by 25% in the BSA-treated group. PPAR&#945; expression levels had no effect on GSIS in PA- or OA-cultured WT islets.</p>
			</sec>
			<sec>
				<st>
					<p>Induction of UCP2 by PA</p>
				</st>
				<p>No UCP2 mRNA or protein was detected in UCP2 KO mouse islets either in BSA- or PA-treated groups (data not shown). Culture of WT islets in 0.4 mM PA for 24 h caused a significant increase in UCP2 mRNA (Figure <figr fid="F4">4A</figr>). A similar but non-significant trend was seen for OA. Culture of WT islets with siC did not modify UCP2 mRNA expression (not shown). Culture of WT islets pretreated with siPPAR&#945; either in BSA or OA caused a non-significant increase in UCP2 mRNA expression (Figure <figr fid="F4">4A</figr>). However, there was a significant increase in UCP2 mRNA in siPPAR&#945;-treated WT islets cultured with 0.4 mM PA for 24 h (Figure <figr fid="F4">4A</figr>). UCP2 protein expression was also significantly increased in PA- but not OA-treated WT islets (Figure <figr fid="F4">4B</figr> and <figr fid="F4">4C</figr>).</p>
				<fig id="F4">
					<title>
						<p>Figure 4</p>
					</title>
					<caption>
						<p>The expression of UCP2 mRNA (<b>A</b>) and UCP2 protein expression (<b>B </b>and <b>C</b>) in WT islets</p>
					</caption>
					<text>
						<p>The expression of UCP2 mRNA (<b>A</b>) and UCP2 protein expression (<b>B </b>and <b>C</b>) in WT islets. UCP2 expression was determined by quantitative RT-PCR in WT islets after 24 h incubation with either BSA (open bars), OA (horizontal bars) or PA (closed bars) and also in those pre-treated with siPPAR&#945; then cultured with BSA (vertical bars), OA (left-hatched bars) and PA (right-hatched bars). The same treatment and incubation time was applied to detect the UCP2 protein expression by Western blotting. Treatment of WT islets with PA for 24 h significantly increased UCP2 mRNA and protein expression (*P &lt; 0.05 vs BSA or siBSA). Data are presented as means &#177; SE, N = 5 or greater for each group.</p>
					</text>
					<graphic file="1743-7075-4-6-4"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Effect of UCP2 on PPAR&#945; mRNA and protein expression in mouse pancreatic islets</p>
				</st>
				<p>To assess the effect of UCP2KO on PPAR&#945; mRNA expression, we performed real-time PCR. PPAR&#945; gene expression was not significantly different between UCP2KO and WT islets (Figure <figr fid="F5">5A</figr>). Incubation of WT and UCP2KO islets with PA and OA caused a significant induction (~100-fold) in PPAR&#945; mRNA (Figure <figr fid="F5">5A</figr>).</p>
				<fig id="F5">
					<title>
						<p>Figure 5</p>
					</title>
					<caption>
						<p>The effects of BSA, PA or OA on PPAR&#945; mRNA (<b>A</b>) and protein expression (<b>B</b>)</p>
					</caption>
					<text>
						<p>The effects of BSA, PA or OA on PPAR&#945; mRNA (<b>A</b>) and protein expression (<b>B</b>). Groups of islets isolated from KO and/or WT mice were exposed to control media (BSA, open bars), PA (closed bars) or OA (dashed bars) for 24 h. Treatment of WT and KO islets with PA and OA significantly increased PPAR&#945; mRNA expression compared to BSA (*P &lt; 0.05). PPAR&#945; protein expression was significantly increased only in KO islets treated with OA (*P &lt; 0.05). Two-way ANOVA performed on PPAR&#945; protein expression in KO and WT islets showed a significant difference between two genotypes (P &lt; 0.05). Data are presented as means &#177; SE, N = 4&#8211;6 for each group.</p>
					</text>
					<graphic file="1743-7075-4-6-5"/>
				</fig>
				<p>Similar PPAR&#945; protein expression was detected in control islets isolated from both UCP2KO and WT mice (Figure <figr fid="F5">5B</figr>). Treatment of UCP2KO islets with OA caused a 3-fold increase in PPAR&#945; expression (Figure <figr fid="F5">5B</figr>) but the effect of PA (~2-fold) was not statistically significant (Figure <figr fid="F5">5B</figr>). In WT islets, treatment with PA and OA did not change PPAR&#945; protein expression (Figure <figr fid="F5">5B</figr>). However, transfection of isolated islets from UCP2KO mice and WT mice with siPPAR&#945; caused a marked reduction in the amount of PPAR&#945; protein expression (87% and 90% in UCP2 KO and WT islets, respectively) compared to siC (Table <tblr tid="T2">2</tblr>).</p>
			</sec>
			<sec>
				<st>
					<p>PPAR&#945; activity in WT and UCP2KO islets</p>
				</st>
				<p>PPAR&#945; activity was determined by a binding assay using nuclear protein from WT and UCP2KO islets and an oligonucleotide corresponding to the PPAR&#945; consensus sequence. Treatment of UCP2KO and WT pancreatic islets with OA activated PPAR&#945; to a similar extent (~20-fold, Figure <figr fid="F6">6</figr>). Treatment of UCP2 KO and WT islets with PA activated PPAR&#945; by ~10-fold but only in UCP2 KO islets was it statistically significant (Figure <figr fid="F6">6</figr>).</p>
				<fig id="F6">
					<title>
						<p>Figure 6</p>
					</title>
					<caption>
						<p>Activation of PPAR&#945; by PA and OA in pancreatic islets</p>
					</caption>
					<text>
						<p>Activation of PPAR&#945; by PA and OA in pancreatic islets. KO and WT islets were cultured for 24 with BSA, PA or OA, then nuclear extract was prepared and PPAR&#945; activity was measured. Treatment of KO and WT islets with OA significantly increased the PPAR&#945; activity (*P &lt; 0.05 vs BSA). The activity of PPAR&#945; significantly increased only in KO islets treated with PA (*P &lt; 0.05) compared to BSA. Data are presented as means &#177; SE, N = 4 or greater for each group.</p>
					</text>
					<graphic file="1743-7075-4-6-6"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Expression of genes transcriptionally regulated by PPAR&#945;</p>
				</st>
				<p>The expression levels of two classical PPAR&#945; target genes, carnitine palmitoyl transferase I (CPTI) and acyl CoA oxidase (ACO) were quantified by real time PCR (Figure <figr fid="F7">7A,B</figr>). CPTI and ACO are rate-limiting enzymes for mitochondrial and peroxisomal fatty acid oxidation, respectively. Baseline expression (in BSA-cultured islets) was similar in both genotypes for all enzymes. The expression of CPTI was significantly induced (~10-fold) in UCP2KO and WT islets by PA treatment (Figure <figr fid="F7">7A</figr>). The induction of CPTI by OA did not achieve statistical significance. Only in UCP2KO islets exposed to PA was the expression of ACO was significantly induced by ~10-fold. In addition, the mRNA of enzymes controlling malonyl CoA concentrations, ACC and MCD was quantified (Figure <figr fid="F7">7C,D</figr>). The expression of MCD was significantly increased in PA-treated islets of KO mice by ~10-fold but no other significant changes were seen.</p>
				<fig id="F7">
					<title>
						<p>Figure 7</p>
					</title>
					<caption>
						<p>mRNA expression of lipolytic (CPT1, ACO and MCD) and lipogenic (ACC) enzymes were measured by quantitative RT-PCR in KO and WT islets after 24 h incubation with either BSA (open bars), PA (closed bars) or OA (dashed bars)</p>
					</caption>
					<text>
						<p>mRNA expression of lipolytic (CPT1, ACO and MCD) and lipogenic (ACC) enzymes were measured by quantitative RT-PCR in KO and WT islets after 24 h incubation with either BSA (open bars), PA (closed bars) or OA (dashed bars). Baseline expression (BSA-cultured islets) was similar in both genotypes for all enzymes. The expression of CPTI was significantly induced (*P &lt; 0.05 vs BSA) in UCP2 KO and WT islets by PA treatment (<b>7A</b>). The expression of ACO and MCD was significantly increased only in KO islets treated with PA (<b>7B &amp; 7D</b>). In KO and WT islets, the expression of ACC was not affected by PA or OA (<b>7C</b>). Data are presented as means &#177; SE, N = 6&#8211;8 for each group.</p>
					</text>
					<graphic file="1743-7075-4-6-7"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Fatty acid oxidation in islets</p>
				</st>
				<p>To assess whether changes in gene expression affected fatty acid oxidation, production of <sup>14</sup>CO<sub>2 </sub>from <sup>14</sup>C-PA was measured. In BSA-cultured islets, fatty acid oxidation was ~2-fold higher in islets from UCP2KO compared with WT mice. In WT islets, 24 h exposure to PA had no significant effect on fatty acid oxidation whereas PA increased (P &lt; 0.05) fatty acid oxidation in islets fromUCP2 KO mice (Figure <figr fid="F8">8</figr>).</p>
				<fig id="F8">
					<title>
						<p>Figure 8</p>
					</title>
					<caption>
						<p>Fatty acid oxidation in islets from WT and UCP2 KO mice</p>
					</caption>
					<text>
						<p>Fatty acid oxidation in islets from WT and UCP2 KO mice. Islets cultured 24 h in control (1% BSA, open bars) or PA (0.4 mM + BSA, closed bars) were incubated with <sup>14</sup>C-PA and 2.8 mM glucose for 2 h and the evolved <sup>14</sup>CO<sub>2 </sub>was used to estimate fatty acid oxidation (n = 8 for all). * P &lt; 0.05 comparing UCP2 KO to WT islets.</p>
					</text>
					<graphic file="1743-7075-4-6-8"/>
				</fig>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<p>The present study examined the interaction between PPAR&#945; and UCP2 in pancreatic beta cells in situations of low and elevated FFA to test the hypothesis that in UCP2KO mice, protection of beta cells from fatty acid exposure is dependent upon transcriptional events mediated by PPAR&#945;. We compared the endogenous expression and activity of PPAR&#945; as well as the effects of knocking down PPAR&#945; on function of pancreatic islets isolated from UCP2KO and WT mice, in the presence of PA (C16:0) and OA (C18:1). We chose PA and OA because they are the most prevalent saturated and monounsaturated FFA in the circulation. The detrimental effects of saturated FFA on insulin secretion are well known but the underlying mechanisms are still being elucidated. A high fat diet or FFA exposure may cause beta cell lipotoxicity via induction of UCP2 <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B23">23</abbr></abbrgrp>. Notably, null expression of UCP2 protects beta cells from lipotoxicity <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, possibly by increasing capacity for fatty acid oxidation <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. This observation raises the possibility that the transcription factor PPAR&#945;, which regulates expression of genes involved in fatty acid oxidation, may modulate the effects of FFA in UCP2KO mouse islets.</p>
			<p>Although the physiological role of PPAR&#945; in pancreatic islets has been intensively investigated, the results are conflicting. Under normal physiological conditions, beta cell expression of PPAR&#945; exceeds that of PPAR&#947; in rodents <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. However, different stimuli (such as fatty acids and glucose) may change the levels of PPAR subtypes in the pancreatic islets. The main physiological function of PPAR&#945; is the regulation of lipid uptake and oxidation, contrasting with that of PPAR&#947;, which promotes uptake but also storage as triacylglycerides <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. A beneficial effect of PPAR&#945; on the function of pancreatic islets is not supported by the study of Tordjman et al <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, who showed that PPAR&#945; ectopically expressed in insulinoma cells could induce lipid accumulation along with a significant reduction in GSIS, possibly through induction of UCP2. Conversely, others <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B25">25</abbr></abbrgrp> have shown that PPAR&#945; has a protective role in islets under conditions of fatty acid treatment or in ob/ob mice <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> and can promote insulin secretion.</p>
			<p>To distinguish the acute effects of PPAR&#945; on the function of pancreatic islets, we chose the short-term gene suppression by siRNA. In our study, siPPAR&#945; potentiated GSIS both in UCP2KO and WT islets cultured under control conditions. This finding supports the data of others showing that PPAR&#945; inhibits GSIS <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> but suggests that UCP2 <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> is not the only mechanism through which PPAR&#945; exerts its negative effects. This is supported by our data showing that siPPAR&#945; did not reduce UCP2 mRNA expression in WT islets. The control conditions in these experiments resulted in exposing the beta cells to very low concentrations of FFA because the DMEM was serum-free and contained 1% defatted BSA. Lowering FFA reduces GSIS <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, possibly by reducing intracellular lipid-derived signaling molecules that stimulate insulin secretion <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Reducing PPAR&#945; expression would therefore be predicted to enhance GSIS by decreasing fatty acid oxidation and allow accumulation of the stimulatory mediators. However, the effect of siPPAR&#945; on basal insulin secretion and GSIS was more pronounced in UCP2KO compared to WT islets. This may be due to increased beta cell ATP at both basal and stimulated glucose concentrations in the UCP2KO mice <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> or it may reflect other unknown beneficial effects of decreasing UCP2 expression. Another recent study showed that beta cell specific overexpression of UCP2 did not decrease GSIS <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. The reasons for this discrepancy (the effects of UCP2 KO vs UCP2 overexpression on GSIS) are not clear given that several other independent groups have shown regulatory effects of UCP2 on insulin secretion using both over- and null-expression models <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>.</p>
			<p>The expression level of PPAR&#945; modified the effect of PA on GSIS in UCP2KO but not WT islets. Whereas in siC islets, PA enhanced insulin secretion from UCP2KO beta cells as noted previously <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, the knockdown of PPAR&#945; eliminated this effect. This suggests that the potentiating effect of PA on GSIS in UCP2KO mice is mediated by PPAR&#945;. Under the same conditions OA did not change insulin secretion in response to 16.5 mM glucose. Others have also noted differences in effects on insulin secretion of saturated versus monounsaturated fatty acids <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. The lack of effect of PA treatment in WT islets, independent of PPAR&#945; status, is further evidence of an interaction between UCP2 and PPAR&#945;. Failure to inhibit insulin secretion in WT beta cells occurred in spite of UCP2 mRNA and protein induction by PA in these islets. Also, because siPPAR&#945; did not affect UCP2 expression in WT islets basally or with fatty acid exposure, other mechanisms for fatty acid-mediated transcriptional regulation of UCP2 must exist. One possibility is PPAR&#947;<abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, which has been implicated previously in induction of UCP2 after fatty acid exposure <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Interestingly, hyperlipidemic PPAR&#945;KO ob/ob mice had impaired GSIS and low expression of enzymes involved in fatty acid oxidation <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Although moderate levels of esterified intracellular lipids may benefit GSIS, impairment of fatty acid oxidation can lead to increased ceramide formation <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> and/or activation of PPAR&#947; (to compensate for the lack of PPAR&#945;, <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>). Whatever the case, the expression level of PPAR&#945; appears to determine whether PA potentiates or impairs GSIS in UCP2 KO islets. It is also important to mention that UCP2 may increase fatty acid cycling; therefore, an increase in UCP2 does not necessarily translate into an increase in fatty acid oxidation if it exports FA from the mitochondrial matrix before they can be oxidized, as has been proposed for UCP3 <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>.</p>
			<p>The altered effects of PPAR&#945; in UCP2 KO mice might be caused by either a change in expression levels or a change in activity of the transcription factor. However, absence of UCP2 did not modify baseline PPAR&#945; protein expression or basal nuclear translocation compared to WT islets. PA and OA increased both PPAR&#945; expression and transactivation in UCP2 KO islets but had a significant effect only on transactivation in WT islets, such that total activation was similar between the genotypes. Monounsaturated fatty acids are known to be more effective ligands of PPAR&#945; than saturated fatty acids <abbrgrp><abbr bid="B41">41</abbr></abbrgrp> and this was true in this study also. The similar activation levels of PPAR&#945; by PA in UCP2KO and WT islets, yet a clear PPAR&#945;-dependence of PA to exert beneficial effects on GSIS in UCP2 seems paradoxical. One explanation is that the sensitivity to PPAR&#945; of target genes is enhanced in the absence of UCP2 by an as yet undefined effect on co-activators or -repressors of PPAR&#945;. Moreover, interaction of PPAR&#945; co-activators is ligand-dependent <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>, which might explain differential effects of PA and OA on gene transcription, as we describe below.</p>
			<p>Enhanced fatty acid oxidation has been speculated to limit formation of toxic lipid byproducts during chronic exposure to saturated fatty acids in UCP2KO mouse islets <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. In this study, PA oxidation was enhanced in control islets from UCP2KO mice and increased further after culture of islets in PA for 24 h. Carnitine palmitoyltransferase I (CPTI) catalyzes the transfer of fatty acids from CoA to carnitine, allowing the initial transport of fatty acids into mitochondria for &#946;-oxidation. Its activity and expression are highly regulated and rate limiting. CPTI gene expression is regulated by PPAR&#945; <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Although gene expression levels do not necessarily equate to functional activity it is of interest to point out that UCP2KO and WT islets treated with PA had similarly elevated CPTI mRNA expression. Unless there are differences in translation between the two genotypes, then CPTI expression cannot account for increased fatty acid oxidation in these experiments. This is in contrast to the result of <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, but FFA exposure was different in that study (4.5 months) compared to the present study (24 h).</p>
			<p>Malonyl-CoA is a metabolic signaling molecule that regulates lipid partitioning through its inhibitory action on CPTI. Malonyl-CoA levels change in different physiological and pathological conditions <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. For example, in ischemia- reperfusion, which is associated with a significant increase in fatty acid oxidation, malonyl-CoA levels decrease rapidly <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Inhibition of CPTI by malonyl-CoA leads to a decrease in the uptake of fatty acids into the mitochondria, which results in decreasing mitochondrial fatty acid oxidation <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. Malonyl-CoA concentrations can be regulated through synthesis, degradation or both. Acetyl CoA carboxylase (ACC) is the rate-limiting enzyme in the synthesis and regulation of malonyl-CoA. In our study the ACC expression was not different among UCP2KO or WT islets. In contrast, we found that malonyl-CoA decarboxylase (MCD) expression in UCP2 KO islets was induced by 24 h PA treatment, which would be predicted to reduce malonyl-CoA levels and enhance fatty acid oxidation, as has been found in muscle <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. Also, conditions that increase hepatic fatty acid oxidation (such as streptozotocin-induced diabetes or a 48 h fast) increase MCD activity <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. In disease states such as hyperlipidemia and diabetes, the important role of MCD in the regulation of fatty acid metabolism, through altering the cytoplasmic levels of malonyl-CoA, is known <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>.</p>
			<p>Finally, fatty acid oxidation outside of the mitochondrion may also be increased to account for the changes seen in UCP2KO mouse islets. Acyl CoA oxidase (ACO) catalyzes the first step in peroxisomal fatty acid oxidation <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Although the basal expression of ACO was similar in UCP2KO vs WT islets, only in the absence of UCP2 did PA induce this enzyme, suggesting that peroxisomal fatty acid oxidation may also contribute to enhanced fatty acid oxidation in UCP2KO islets.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>In the absence of UCP2, the effects of PPAR&#945; activation on transcription of fatty acid oxidation-promoting enzymes (ACO, CPT-I and MCD) precipitate an intracellular environment favouring fatty acid oxidation to reduce lipotoxicity and enhance GSIS in the presence of saturated fatty acid. In the short term, this effect appears to be mediated mainly by differential induction of ACO and MCD, whereas in the longer term CPTI may also be increased in UCP2KO relative to WT islets <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Conversely, knockdown of PPAR&#945; in UCP2KO islets leaves them vulnerable to detrimental effects of saturated fatty acids. This could occur if MCD and ACO were not up-regulated, reducing fatty acid oxidative capacity. Notably, MCD expression is elevated in heart of PPAR&#945; KO mice, concomitant with impaired fatty acid oxidation <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. This hypothesis could be examined in islets in future. In fact very recently, the effectiveness of MCD inhibitors on ischemic heart disease have been reported <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Moreover, because PPAR&#945; expression and activation were similar in UCP2KO and WT islets, and because OA induced PPAR&#945; but did not promote GSIS, we suggest that other molecules, yet to be identified, are also involved in regulating the differential response of UCP2KO islets to PA.</p>
		</sec>
		<sec>
			<st>
				<p>Abbreviations</p>
			</st>
			<p>PPAR&#945;: peroxisome proliferator-activated receptor-&#945;, UCP2: uncoupling protein-2, PA: Palmitic acid, OA: Oleic acid, GSIS: glucose stimulated insulin secretion, FFA: Free fatty acids, TTBS: Tween Tris-buffered saline, GAPDH: Glyceraldehyde-3-phosphate dehyrogenase, CPTI: carnitine palmitoyltransferase I, ACO: acyl CoA oxidase, ACC: Acetyl CoA carboxylase, MCD: malonyl CoA decarboxylase, EGFP: enhanced green fluorescence protein, KO: knockout, WT: wild-type, DMEM: Dulbecco's modified Eagle medium.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>The author(s) declare that they have no competing interests.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>This work was supported by a grant from the Canadian Institutes of Health Research (MOP 43978).</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>What is Minkowski had been ageusic? An alternative angle on diabetes</p>
				</title>
				<aug>
					<au>
						<snm>McGarry</snm>
						<fnm>JD</fnm>
					</au>
				</aug>
				<source>Science</source>
				<pubdate>1992</pubdate>
				<volume>258</volume>
				<issue>5083</issue>
				<fpage>766</fpage>
				<lpage>70</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1126/science.1439783</pubid>
						<pubid idtype="pmpid" link="fulltext">1439783</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>Regulation of the uncoupling protein-2 gene in INS-1 B-cells by oleic acid</p>
				</title>
				<aug>
					<au>
						<snm>Medvedev</snm>
						<fnm>AV</fnm>
					</au>
					<au>
						<snm>Robidoux</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bai</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Cao</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Floering</snm>
						<fnm>LM</fnm>
					</au>
					<au>
						<snm>Daniel</snm>
						<fnm>KW</fnm>
					</au>
					<au>
						<snm>Collins</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2002</pubdate>
				<volume>277</volume>
				<fpage>42639</fpage>
				<lpage>44</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M208645200</pubid>
						<pubid idtype="pmpid" link="fulltext">12205102</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Role of ATP production and uncoupling protein-2 in the insulin secretory defect induced by chronic exposure to high glucose or free fatty acids and effects of peroxisome proliferators activated receptor-&#947; inhibition</p>
				</title>
				<aug>
					<au>
						<snm>Patane</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Anello</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Piro</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Vigneri</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Purrello</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Rabuazzo</snm>
						<fnm>AM</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2002</pubdate>
				<volume>51</volume>
				<fpage>2749</fpage>
				<lpage>56</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.51.9.2749</pubid>
						<pubid idtype="pmpid" link="fulltext">12196468</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>UCP2 and UCP3 in muscle controlling body metabolism</p>
				</title>
				<aug>
					<au>
						<snm>Schrauwen</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Hesselink</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>J Exp Biol</source>
				<pubdate>2002</pubdate>
				<volume>205</volume>
				<fpage>2275</fpage>
				<lpage>85</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">12110661</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>The reactions catalysed by the mitochondrial uncoupling proteins UCP2 and UCP3</p>
				</title>
				<aug>
					<au>
						<snm>Esteves</snm>
						<fnm>TC</fnm>
					</au>
					<au>
						<snm>Brand</snm>
						<fnm>MD</fnm>
					</au>
				</aug>
				<source>Biochim Biophys Acta</source>
				<pubdate>2005</pubdate>
				<volume>1709</volume>
				<fpage>35</fpage>
				<lpage>44</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.bbabio.2005.06.002</pubid>
						<pubid idtype="pmpid" link="fulltext">16005426</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Respiration uncoupling and metabolism in the control of energy expenditure</p>
				</title>
				<aug>
					<au>
						<snm>Ricquier</snm>
						<fnm>D</fnm>
					</au>
				</aug>
				<source>Proc Nutr Soc</source>
				<pubdate>2005</pubdate>
				<volume>64</volume>
				<fpage>47</fpage>
				<lpage>52</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1079/PNS2004408</pubid>
						<pubid idtype="pmpid" link="fulltext">15877922</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Uncoupling protein 2 has protective function during experimental autoimmune encephalomyelitis</p>
				</title>
				<aug>
					<au>
						<snm>Vogler</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Pahnke</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Rousset</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ricquier</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Moch</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Miroux</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Ibrahim</snm>
						<fnm>SM</fnm>
					</au>
				</aug>
				<source>Am J Pathol</source>
				<pubdate>2006</pubdate>
				<volume>168</volume>
				<fpage>1570</fpage>
				<lpage>5</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">16651623</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet</p>
				</title>
				<aug>
					<au>
						<snm>Joseph</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Koshkin</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Zhang</snm>
						<fnm>CY</fnm>
					</au>
					<au>
						<snm>Wang</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Lowell</snm>
						<fnm>BB</fnm>
					</au>
					<au>
						<snm>Chan</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Wheeler</snm>
						<fnm>MB</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2002</pubdate>
				<volume>51</volume>
				<fpage>3211</fpage>
				<lpage>9</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.51.11.3211</pubid>
						<pubid idtype="pmpid" link="fulltext">12401712</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>Free fatty acid-induced &#946;-cell defects are dependent on uncoupling protein 2 expression</p>
				</title>
				<aug>
					<au>
						<snm>Joseph</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Koshkin</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Saleh</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Sivitz</snm>
						<fnm>WT</fnm>
					</au>
					<au>
						<snm>Zhang</snm>
						<fnm>CY</fnm>
					</au>
					<au>
						<snm>Lowell</snm>
						<fnm>BB</fnm>
					</au>
					<au>
						<snm>Chan</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Wheeler</snm>
						<fnm>MB</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2004</pubdate>
				<volume>279</volume>
				<fpage>51049</fpage>
				<lpage>56</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M409189200</pubid>
						<pubid idtype="pmpid" link="fulltext">15448158</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<title>
					<p>Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor</p>
				</title>
				<aug>
					<au>
						<snm>Gottlicher</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Widmark</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Li</snm>
						<fnm>Q</fnm>
					</au>
					<au>
						<snm>Gustafsson</snm>
						<fnm>JA</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1992</pubdate>
				<volume>89</volume>
				<fpage>4653</fpage>
				<lpage>7</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">49141</pubid>
						<pubid idtype="pmpid" link="fulltext">1316614</pubid>
						<pubid idtype="doi">10.1073/pnas.89.10.4653</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Role of peroxisome proliferator-activated receptor &#945; in disease of pancreatic &#946; cells</p>
				</title>
				<aug>
					<au>
						<snm>Zhou</snm>
						<fnm>Y-T</fnm>
					</au>
					<au>
						<snm>Shimabukuro</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Wang</snm>
						<fnm>M-Y</fnm>
					</au>
					<au>
						<snm>Lee</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Higa</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Milburn</snm>
						<fnm>JL</fnm>
					</au>
					<au>
						<snm>Newgard</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Unger</snm>
						<fnm>RH</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1998</pubdate>
				<volume>95</volume>
				<fpage>8898</fpage>
				<lpage>903</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">21174</pubid>
						<pubid idtype="pmpid" link="fulltext">9671776</pubid>
						<pubid idtype="doi">10.1073/pnas.95.15.8898</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Glucose down-regulates the expression of the peroxisome proliferator-activated receptor-&#945; gene in the pancreatic &#946;-cell</p>
				</title>
				<aug>
					<au>
						<snm>Roduit</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Morin</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Masse</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Segall</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Roche</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Newgard</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Assimacopoulos-Jeannet</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Prentki</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2000</pubdate>
				<volume>275</volume>
				<fpage>35799</fpage>
				<lpage>806</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M006001200</pubid>
						<pubid idtype="pmpid" link="fulltext">10967113</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Expression of peroxisome proliferator-activated receptor &#947; in the normal human pancreatic islet cells</p>
				</title>
				<aug>
					<au>
						<snm>Dubois</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Paltou</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Kerr-Conte</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Gyr</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Vandewalle</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Desreumaux</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Auwerx</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Schoonjans</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Lefebvre</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>Diabetologia</source>
				<pubdate>2000</pubdate>
				<volume>43</volume>
				<fpage>1165</fpage>
				<lpage>9</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s001250051508</pubid>
						<pubid idtype="pmpid" link="fulltext">11043863</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B14">
				<title>
					<p>PPAR&#945; suppresses insulin secretion and induces UCP2 in insulinoma cells</p>
				</title>
				<aug>
					<au>
						<snm>Tordjman</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Standley</snm>
						<fnm>KN</fnm>
					</au>
					<au>
						<snm>Bernal-Mizrachi</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Leone</snm>
						<fnm>TC</fnm>
					</au>
					<au>
						<snm>Coleman</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Kelly</snm>
						<fnm>DP</fnm>
					</au>
					<au>
						<snm>Scmenkovich</snm>
						<fnm>CF</fnm>
					</au>
				</aug>
				<source>J Lipid Res</source>
				<pubdate>2002</pubdate>
				<volume>43</volume>
				<fpage>936</fpage>
				<lpage>43</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">12032169</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>Peroxisome proliferator-activated receptors &#947; and &#945; mediate in vivo regulation of uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression</p>
				</title>
				<aug>
					<au>
						<snm>Kelly</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Vicario</snm>
						<fnm>PP</fnm>
					</au>
					<au>
						<snm>Thompson</snm>
						<fnm>GM</fnm>
					</au>
					<au>
						<snm>Candelore</snm>
						<fnm>MR</fnm>
					</au>
					<au>
						<snm>Doebber</snm>
						<fnm>TW</fnm>
					</au>
					<au>
						<snm>Ventre</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Wu</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Meurer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Forrest</snm>
						<fnm>MJ</fnm>
					</au>
					<au>
						<snm>Conner</snm>
						<fnm>MW</fnm>
					</au>
					<au>
						<snm>Cascieri</snm>
						<fnm>MA</fnm>
					</au>
					<au>
						<snm>Moller</snm>
						<fnm>DE</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>1998</pubdate>
				<volume>139</volume>
				<fpage>4920</fpage>
				<lpage>7</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.139.12.4920</pubid>
						<pubid idtype="pmpid" link="fulltext">9832429</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>Cloning and characterization of the 5' flanking region of the human uncoupling protein 3 (UCP3) gene</p>
				</title>
				<aug>
					<au>
						<snm>Acin</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Rodriguez</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Rique</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Canet</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Boutin</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Galizzi</snm>
						<fnm>JP</fnm>
					</au>
				</aug>
				<source>Biochem Biophys Res Commun</source>
				<pubdate>1999</pubdate>
				<volume>258</volume>
				<issue>2</issue>
				<fpage>278</fpage>
				<lpage>83</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1006/bbrc.1999.0530</pubid>
						<pubid idtype="pmpid" link="fulltext">10329378</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Peroxisome proliferator-activated receptor &#945; potentiates, whereas PPAR(attenuates, glucose-stimulated insulin secretion in pancreatic &#946;-cells</p>
				</title>
				<aug>
					<au>
						<snm>Ravnskjaer</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Borgesen</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Rubi</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Larsen</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Nielsen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Fridriksson</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Maechler</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Mandrup</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2005</pubdate>
				<volume>146</volume>
				<fpage>3266</fpage>
				<lpage>76</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.2004-1430</pubid>
						<pubid idtype="pmpid" link="fulltext">15878969</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>Increased reactive oxygen species production down-regulates peroxisome proliferator-acitvated &#945; pathway in C2C12 skeletal muscle cells</p>
				</title>
				<aug>
					<au>
						<snm>Cabrero</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Alegret</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Sanchez</snm>
						<fnm>RM</fnm>
					</au>
					<au>
						<snm>Adzet</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Laguna</snm>
						<fnm>JC</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2002</pubdate>
				<volume>277</volume>
				<fpage>10100</fpage>
				<lpage>7</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M110321200</pubid>
						<pubid idtype="pmpid" link="fulltext">11792699</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells</p>
				</title>
				<aug>
					<au>
						<snm>Elbashir</snm>
						<fnm>SM</fnm>
					</au>
					<au>
						<snm>Harborth</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Lendeckel</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Yalcin</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Weber</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Tuschl</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Nature</source>
				<pubdate>2001</pubdate>
				<volume>411</volume>
				<fpage>494</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/35078107</pubid>
						<pubid idtype="pmpid" link="fulltext">11373684</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, &#946;-cell dysfunction and type 2 diabetes</p>
				</title>
				<aug>
					<au>
						<snm>Zhang</snm>
						<fnm>CY</fnm>
					</au>
					<au>
						<snm>Baffy</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Perret</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Krauss</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Peroni</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Grujic</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Hagen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Vidal-Puig</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Boss</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>TB</fnm>
					</au>
					<au>
						<snm>Zheng</snm>
						<fnm>XX</fnm>
					</au>
					<au>
						<snm>Wheeler</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Shulman</snm>
						<fnm>GI</fnm>
					</au>
					<au>
						<snm>Chan</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Lowel</snm>
						<fnm>BB</fnm>
					</au>
				</aug>
				<source>Cell</source>
				<pubdate>2001</pubdate>
				<volume>105</volume>
				<fpage>745</fpage>
				<lpage>55</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0092-8674(01)00378-6</pubid>
						<pubid idtype="pmpid" link="fulltext">11440717</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Islet filtration: A simple and rapid new purification procedure that avoids Ficoll and improves islet mass and function</p>
				</title>
				<aug>
					<au>
						<snm>Salvalaggio</snm>
						<fnm>PR</fnm>
					</au>
					<au>
						<snm>Deng</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ariyan</snm>
						<fnm>CE</fnm>
					</au>
					<au>
						<snm>Millet</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Zawalich</snm>
						<fnm>WS</fnm>
					</au>
					<au>
						<snm>Basadonna</snm>
						<fnm>GP</fnm>
					</au>
					<au>
						<snm>Rothstein</snm>
						<fnm>DM</fnm>
					</au>
				</aug>
				<source>Transplantation</source>
				<pubdate>2002</pubdate>
				<volume>74</volume>
				<fpage>877</fpage>
				<lpage>900</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1097/00007890-200209270-00023</pubid>
						<pubid idtype="pmpid" link="fulltext">12364870</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>Nonviral transfection of intact pancreatic islets</p>
				</title>
				<aug>
					<au>
						<snm>Lakey</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Young</snm>
						<fnm>ATL</fnm>
					</au>
					<au>
						<snm>Pardue</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Calvin</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Albertson</snm>
						<fnm>TE</fnm>
					</au>
					<au>
						<snm>Jacobson</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Cavanagh</snm>
						<fnm>TJ</fnm>
					</au>
				</aug>
				<source>Cell Transplantation</source>
				<pubdate>2001</pubdate>
				<volume>10</volume>
				<fpage>697</fpage>
				<lpage>708</lpage>
				<xrefbib>
					<pubid idtype="pmpid">11814112</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>Uncoupling protein 2: a possible link between fatty acid excess and impaired glucose-induced insulin secretion?</p>
				</title>
				<aug>
					<au>
						<snm>Lameloise</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Muzzin</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Prentki</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Assimacopoulos-Jeannet</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2001</pubdate>
				<volume>50</volume>
				<fpage>803</fpage>
				<lpage>9</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.50.4.803</pubid>
						<pubid idtype="pmpid" link="fulltext">11289045</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B24">
				<title>
					<p>Genetic regulation of metabolic pathways in &#946;-cells disrupted by hyperglycemia</p>
				</title>
				<aug>
					<au>
						<snm>Laybutt</snm>
						<fnm>DR</fnm>
					</au>
					<au>
						<snm>Sharma</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Sgroi</snm>
						<fnm>DC</fnm>
					</au>
					<au>
						<snm>Gaudet</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bonner-Weir</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Weir</snm>
						<fnm>GC</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2002</pubdate>
				<volume>277</volume>
				<fpage>10912</fpage>
				<lpage>21</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M111751200</pubid>
						<pubid idtype="pmpid" link="fulltext">11782487</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Peroxisome proliferator-activated receptor &#945; activation prevents diabetes in OLETF rats: comparison with PPAR&#947;activation</p>
				</title>
				<aug>
					<au>
						<snm>Koh</snm>
						<fnm>EH</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Park</snm>
						<fnm>JY</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>HS</fnm>
					</au>
					<au>
						<snm>Youn</snm>
						<fnm>JY</fnm>
					</au>
					<au>
						<snm>Park</snm>
						<fnm>HS</fnm>
					</au>
					<au>
						<snm>Youn</snm>
						<fnm>JH</fnm>
					</au>
					<au>
						<snm>Lee</snm>
						<fnm>KU</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2003</pubdate>
				<volume>52</volume>
				<fpage>2331</fpage>
				<lpage>7</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.52.9.2331</pubid>
						<pubid idtype="pmpid" link="fulltext">12941773</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B26">
				<title>
					<p>Peroxisome proliferator-activated receptor &#945; improves pancreatic adaptation to insulin resistance in obese mice and reduces lipotoxicity in human islets</p>
				</title>
				<aug>
					<au>
						<snm>Lalloyer</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Vandewalle</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Percevault</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Torpier</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Kerr-Conte</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Oosterveer</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Paumelle</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Fruchart</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Kuipers</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Pattou</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Fievet</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Staels</snm>
						<fnm>B</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2006</pubdate>
				<volume>55</volume>
				<fpage>1605</fpage>
				<lpage>13</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/db06-0016</pubid>
						<pubid idtype="pmpid" link="fulltext">16731822</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B27">
				<title>
					<p>Pancreatic islet adaptation to fasting is dependent on peroxisome proliferators-activated receptor &#945; transcriptional up-regulation of fatty acid oxidation</p>
				</title>
				<aug>
					<au>
						<snm>Gremlich</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Nolan</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Roduit</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Burcelin</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Peyot</snm>
						<fnm>ML</fnm>
					</au>
					<au>
						<snm>Delghingaro-Augusto</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Desvergne</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Michalik</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Prentki</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Wahli</snm>
						<fnm>W</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2005</pubdate>
				<volume>146</volume>
				<fpage>375</fpage>
				<lpage>82</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.2004-0667</pubid>
						<pubid idtype="pmpid" link="fulltext">15459119</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B28">
				<title>
					<p>Essentiality of circulating fatty acids for glucose-stimulated insulin secretion in the fasted rat</p>
				</title>
				<aug>
					<au>
						<snm>Stein</snm>
						<fnm>DT</fnm>
					</au>
					<au>
						<snm>Esser</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Stevenson</snm>
						<fnm>BE</fnm>
					</au>
					<au>
						<snm>Lane</snm>
						<fnm>KE</fnm>
					</au>
					<au>
						<snm>Whiteside</snm>
						<fnm>JH</fnm>
					</au>
					<au>
						<snm>Daniels</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Chen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>McGarry</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>J Clin Invest</source>
				<pubdate>1996</pubdate>
				<volume>97</volume>
				<fpage>2728</fpage>
				<lpage>35</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">507365</pubid>
						<pubid idtype="pmpid" link="fulltext">8675683</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>A role for the malonyl-CoA long chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli</p>
				</title>
				<aug>
					<au>
						<snm>Roduit</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Nolan</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Alarcon</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Moore</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Barbeau</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Delghinaro-Augusto</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Przybykowski</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Morin</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Masse</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Massie</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Ruderman</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Rhodes</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Ouitout</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Prentki</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2004</pubdate>
				<volume>53</volume>
				<fpage>1007</fpage>
				<lpage>19</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.53.4.1007</pubid>
						<pubid idtype="pmpid" link="fulltext">15047616</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B30">
				<title>
					<p>Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes</p>
				</title>
				<aug>
					<au>
						<snm>Zhang</snm>
						<fnm>CY</fnm>
					</au>
					<au>
						<snm>Baffy</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Perret</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Krauss</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Peroni</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Grujic</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Hagen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Vidal-Puig</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Boss</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>YB</fnm>
					</au>
					<au>
						<snm>Zheng</snm>
						<fnm>XX</fnm>
					</au>
					<au>
						<snm>Wheeler</snm>
						<fnm>MB</fnm>
					</au>
					<au>
						<snm>Shulman</snm>
						<fnm>GI</fnm>
					</au>
					<au>
						<snm>Chan</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Lowell</snm>
						<fnm>BB</fnm>
					</au>
				</aug>
				<source>Cell</source>
				<pubdate>2001</pubdate>
				<volume>105</volume>
				<fpage>745</fpage>
				<lpage>55</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0092-8674(01)00378-6</pubid>
						<pubid idtype="pmpid" link="fulltext">11440717</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B31">
				<title>
					<p>Increasing uncoupling protein-2 in pancreatic beta cells does not alter glucose-induced insulin secretion but decreases production of reactive oxygen species</p>
				</title>
				<aug>
					<au>
						<snm>Produit-Zengaffinen</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Davis-Lameloise</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Perreten</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Becard</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Gjinovci</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Keller</snm>
						<fnm>PA</fnm>
					</au>
					<au>
						<snm>Wollheim</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Herrera</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Muzzin</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Assimacopoulos-Jeannet</snm>
						<fnm>F</fnm>
					</au>
				</aug>
				<source>Diabetologia</source>
				<pubdate>2007</pubdate>
				<volume>50</volume>
				<fpage>84</fpage>
				<lpage>93</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00125-006-0499-6</pubid>
						<pubid idtype="pmpid" link="fulltext">17131143</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B32">
				<title>
					<p>Effects of adenoviral overexpression of uncoupling protein-2 and -3 on mitochondrial respiration in insulinoma cells</p>
				</title>
				<aug>
					<au>
						<snm>Hong</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Fink</snm>
						<fnm>BD</fnm>
					</au>
					<au>
						<snm>Dillon</snm>
						<fnm>JS</fnm>
					</au>
					<au>
						<snm>Sivitz</snm>
						<fnm>WI</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2001</pubdate>
				<volume>142</volume>
				<fpage>249</fpage>
				<lpage>56</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.142.1.249</pubid>
						<pubid idtype="pmpid" link="fulltext">11145588</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B33">
				<title>
					<p>Role of uncoupling protein-2 up-regulation and triglyceride accumulation in impaired glucose-stimulated insulin secretion in a beta-cell lipotoxicity model overexpressing sterol regulatory element-binding protein-1c</p>
				</title>
				<aug>
					<au>
						<snm>Yamashita</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Eto</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Okazaki</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Yamashita</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Yamauchi</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Sekine</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Nagai</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Noda</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Kadowaki</snm>
						<fnm>T</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2004</pubdate>
				<volume>145</volume>
				<fpage>3566</fpage>
				<lpage>77</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.2003-1602</pubid>
						<pubid idtype="pmpid" link="fulltext">15059954</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B34">
				<title>
					<p>Taurine increases glucose sensitivity of UCP2-overexpressing beta-cells by ameliorating mitochondrial metabolism</p>
				</title>
				<aug>
					<au>
						<snm>Han</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bae</snm>
						<fnm>JH</fnm>
					</au>
					<au>
						<snm>Kim</snm>
						<fnm>SY</fnm>
					</au>
					<au>
						<snm>Lee</snm>
						<fnm>HY</fnm>
					</au>
					<au>
						<snm>Jang</snm>
						<fnm>BC</fnm>
					</au>
					<au>
						<snm>Lee</snm>
						<fnm>IK</fnm>
					</au>
					<au>
						<snm>Cho</snm>
						<fnm>CH</fnm>
					</au>
					<au>
						<snm>Lim</snm>
						<fnm>JG</fnm>
					</au>
					<au>
						<snm>Suh</snm>
						<fnm>SI</fnm>
					</au>
					<au>
						<snm>Kwon</snm>
						<fnm>TK</fnm>
					</au>
					<au>
						<snm>Park</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Ryu</snm>
						<fnm>SY</fnm>
					</au>
					<au>
						<snm>Ho</snm>
						<fnm>WK</fnm>
					</au>
					<au>
						<snm>Earm</snm>
						<fnm>YE</fnm>
					</au>
					<au>
						<snm>Song</snm>
						<fnm>DK</fnm>
					</au>
				</aug>
				<source>Am J Physiol Endocrinol Metab</source>
				<pubdate>2004</pubdate>
				<volume>287</volume>
				<fpage>E1008</fpage>
				<lpage>18</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1152/ajpendo.00008.2004</pubid>
						<pubid idtype="pmpid" link="fulltext">15265758</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B35">
				<title>
					<p>Inhibition of UCP2 expression reverses diet-induced diabetes mellitus by effects on both insulin secretion and action</p>
				</title>
				<aug>
					<au>
						<snm>De Souza</snm>
						<fnm>CT</fnm>
					</au>
					<au>
						<snm>Araujo</snm>
						<fnm>EP</fnm>
					</au>
					<au>
						<snm>Stoppiglia</snm>
						<fnm>LF</fnm>
					</au>
					<au>
						<snm>Pauli</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Ropelle</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Rocco</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Marin</snm>
						<fnm>RM</fnm>
					</au>
					<au>
						<snm>Franchini</snm>
						<fnm>KG</fnm>
					</au>
					<au>
						<snm>Carvalheira</snm>
						<fnm>JB</fnm>
					</au>
					<au>
						<snm>Saad</snm>
						<fnm>MJ</fnm>
					</au>
					<au>
						<snm>Boschero</snm>
						<fnm>AC</fnm>
					</au>
					<au>
						<snm>Carneiro</snm>
						<fnm>EM</fnm>
					</au>
				</aug>
				<source>Faseb J</source>
				<note>DOI: fj.06-7148, published online January 5, 2007</note>
			</bibl>
			<bibl id="B36">
				<title>
					<p>Monounsaturated fatty acids prevent the deleterious effects of palmitate and high glucose on human pancreatic &#946;-cell turnover and function</p>
				</title>
				<aug>
					<au>
						<snm>Maedler</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Oberholzer</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bucher</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Spinas</snm>
						<fnm>GA</fnm>
					</au>
					<au>
						<snm>Donath</snm>
						<fnm>MY</fnm>
					</au>
				</aug>
				<source>Diabetes</source>
				<pubdate>2003</pubdate>
				<volume>52</volume>
				<fpage>726</fpage>
				<lpage>33</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.2337/diabetes.52.3.726</pubid>
						<pubid idtype="pmpid" link="fulltext">12606514</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B37">
				<title>
					<p>PPAR-gamma overexpression selectively suppresses insulin secretory capacity in isolated pancreatic islets through induction of UCP-2 protein</p>
				</title>
				<aug>
					<au>
						<snm>Ito</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Ozawa</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Takahashi</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Tanaka</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Katsuta</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Yamaguchi</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Maruyama</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Takizawa</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Katahira</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Yoshimoto</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Nagamatsu</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Ishida</snm>
						<fnm>H</fnm>
					</au>
				</aug>
				<source>Biochem Biophys Res Commun</source>
				<pubdate>2004</pubdate>
				<volume>324</volume>
				<fpage>810</fpage>
				<lpage>4</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.bbrc.2004.08.238</pubid>
						<pubid idtype="pmpid" link="fulltext">15474499</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B38">
				<title>
					<p>Peroxisome proliferator-activated receptor &#945; mediates the effects of high-fat diet on hepatic gene expression</p>
				</title>
				<aug>
					<au>
						<snm>Patsouris</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Reddy</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Muller</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Kersten</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2006</pubdate>
				<volume>147</volume>
				<fpage>1508</fpage>
				<lpage>16</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.2005-1132</pubid>
						<pubid idtype="pmpid" link="fulltext">16357043</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B39">
				<title>
					<p>Physiological role of UCP3 may be export of fatty acids from mitochondria when fatty acid oxidation predominates: an hypothesis</p>
				</title>
				<aug>
					<au>
						<snm>Himms-Hagen</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Harper</snm>
						<fnm>M-E</fnm>
					</au>
				</aug>
				<source>Expt Biol Med</source>
				<pubdate>2001</pubdate>
				<volume>226</volume>
				<fpage>78</fpage>
				<lpage>84</lpage>
			</bibl>
			<bibl id="B40">
				<title>
					<p>The role of uncoupling protein 3 in fatty acid metabolism: protection against lipotoxicity?</p>
				</title>
				<aug>
					<au>
						<snm>Schrauwen</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Hesselink</snm>
						<fnm>MK</fnm>
					</au>
				</aug>
				<source>Proc Nutr Soc</source>
				<pubdate>2004</pubdate>
				<volume>63</volume>
				<fpage>287</fpage>
				<lpage>92</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1079/PNS2003336</pubid>
						<pubid idtype="pmpid" link="fulltext">15294045</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B41">
				<title>
					<p>PPARs; transcriptional effectors of fatty acids and their derivatives</p>
				</title>
				<aug>
					<au>
						<snm>Hihi</snm>
						<fnm>AK</fnm>
					</au>
					<au>
						<snm>Michalik</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Wahli</snm>
						<fnm>W</fnm>
					</au>
				</aug>
				<source>Cell Mol Life Sci</source>
				<pubdate>2002</pubdate>
				<volume>59</volume>
				<fpage>790</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s00018-002-8467-x</pubid>
						<pubid idtype="pmpid" link="fulltext">12088279</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B42">
				<title>
					<p>Examination of ligand-dependent coactivator recruitment by peroxisome proliferator-activated receptor -alpha (PPAR alpha)</p>
				</title>
				<aug>
					<au>
						<snm>Tien</snm>
						<fnm>ES</fnm>
					</au>
					<au>
						<snm>Hannon</snm>
						<fnm>DB</fnm>
					</au>
					<au>
						<snm>Thompson</snm>
						<fnm>JT</fnm>
					</au>
					<au>
						<snm>Vanden Heuvel</snm>
						<fnm>JP</fnm>
					</au>
				</aug>
				<source>PPARRes</source>
				<pubdate>2006</pubdate>
				<note>doi:10,1155/PPAR/2006/69612</note>
			</bibl>
			<bibl id="B43">
				<title>
					<p>A critical role for the peroxisome proliferator-activated receptor &#945; in the cellular fasting response: the PPAR&#945;-null mouse as a model fatty acid oxidation disorders</p>
				</title>
				<aug>
					<au>
						<snm>Leone</snm>
						<fnm>TC</fnm>
					</au>
					<au>
						<snm>Weinheimer</snm>
						<fnm>CJ</fnm>
					</au>
					<au>
						<snm>Kelly</snm>
						<fnm>DP</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1999</pubdate>
				<volume>96</volume>
				<fpage>7473</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">22110</pubid>
						<pubid idtype="pmpid" link="fulltext">10377439</pubid>
						<pubid idtype="doi">10.1073/pnas.96.13.7473</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B44">
				<title>
					<p>Malonyl-CoA content and fatty acid oxidation in rat muscle and liver in vivo</p>
				</title>
				<aug>
					<au>
						<snm>Chien</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Dean</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Saha</snm>
						<fnm>AK</fnm>
					</au>
					<au>
						<snm>Faltt</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Ruderman</snm>
						<fnm>NB</fnm>
					</au>
				</aug>
				<source>Am J Physiol Endocrinol Metab</source>
				<pubdate>2000</pubdate>
				<volume>279</volume>
				<fpage>E259</fpage>
				<lpage>65</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">10913024</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B45">
				<title>
					<p>High rates of fatty acid oxidation during reperfusion of ischemic hearts are associated with a decrease in malonyl-CoA levels due to an increase in 5'-AMP-activated protein kinase inhibition of acetyl-CoA carboxylase</p>
				</title>
				<aug>
					<au>
						<snm>Kudo</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Barr</snm>
						<fnm>AJ</fnm>
					</au>
					<au>
						<snm>Barr</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Desai</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Lopaschuk</snm>
						<fnm>GD</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>1995</pubdate>
				<volume>270</volume>
				<fpage>17513</fpage>
				<lpage>20</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.270.29.17513</pubid>
						<pubid idtype="pmpid" link="fulltext">7615556</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B46">
				<title>
					<p>Reconstitution of purified, active and malonyl-CoA-sensitive rat liver carnitine palmitoyltransferase I: relationship between membrane environment and malonyl-CoA sensitivity</p>
				</title>
				<aug>
					<au>
						<snm>McGarry</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>NF</fnm>
					</au>
				</aug>
				<source>Biochem J</source>
				<pubdate>2000</pubdate>
				<volume>349</volume>
				<fpage>179</fpage>
				<lpage>87</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1221135</pubid>
						<pubid idtype="pmpid" link="fulltext">10861226</pubid>
						<pubid idtype="doi">10.1042/0264-6021:3490179</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B47">
				<title>
					<p>Regulation of fatty acid oxidation and glucose metabolism in rat soleus muscle: effects of AICAR</p>
				</title>
				<aug>
					<au>
						<snm>Kaushik</snm>
						<fnm>VK</fnm>
					</au>
					<au>
						<snm>Young</snm>
						<fnm>ME</fnm>
					</au>
					<au>
						<snm>Dean</snm>
						<fnm>DJ</fnm>
					</au>
					<au>
						<snm>Kurowski</snm>
						<fnm>TG</fnm>
					</au>
					<au>
						<snm>Saha</snm>
						<fnm>AK</fnm>
					</au>
					<au>
						<snm>Ruderman</snm>
						<fnm>NB</fnm>
					</au>
				</aug>
				<source>Am J Physiol Endocrinol Metab</source>
				<pubdate>2001</pubdate>
				<volume>281</volume>
				<fpage>E335</fpage>
				<lpage>40</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11440910</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B48">
				<title>
					<p>Characterization of rat liver malonyl-CoA decarboxylase and the study of its role in regulating fatty acid metabolism</p>
				</title>
				<aug>
					<au>
						<snm>Dyck</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Berthiaume</snm>
						<fnm>LG</fnm>
					</au>
				</aug>
				<source>Biochem J</source>
				<pubdate>2000</pubdate>
				<volume>350</volume>
				<fpage>599</fpage>
				<lpage>608</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1221289</pubid>
						<pubid idtype="pmpid" link="fulltext">10947976</pubid>
						<pubid idtype="doi">10.1042/0264-6021:3500599</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B49">
				<title>
					<p>Contribution of malonyl-CoA decarboxylase to the high fatty acid oxidation rates seen in the diabetic heart</p>
				</title>
				<aug>
					<au>
						<snm>Sakamoto</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Barr</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Kavanagh</snm>
						<fnm>KM</fnm>
					</au>
					<au>
						<snm>Lopaschuk</snm>
						<fnm>GD</fnm>
					</au>
				</aug>
				<source>Am J Physiol Heart Circ Physiol</source>
				<pubdate>2000</pubdate>
				<volume>278</volume>
				<fpage>H1196</fpage>
				<lpage>204</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">10749714</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B50">
				<title>
					<p>Down-regulation of acyl-CoA oxidase gene expression and increased NF-&#954;B activity in etomoxir-induced cardiac hypertrophy</p>
				</title>
				<aug>
					<au>
						<snm>Cabrero</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Merlos</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Laguna</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Vazquez Carrera</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>J Lipid Res</source>
				<pubdate>2003</pubdate>
				<volume>44</volume>
				<fpage>388</fpage>
				<lpage>98</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1194/jlr.M200294-JLR200</pubid>
						<pubid idtype="pmpid" link="fulltext">12576521</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B51">
				<title>
					<p>A role for peroxisome proliferator-activated receptor " (PPAR") in the control of cardiac malonyl-CoA levels: reduced fatty acid oxidation rates and increased glucose oxidation rates in the hearts of mice lacking PPAR" are associated with higher concentrations of malonyl-CoA and reduced expression of malonyl-CoA decarboxylase</p>
				</title>
				<aug>
					<au>
						<snm>Campbell</snm>
						<fnm>FM</fnm>
					</au>
					<au>
						<snm>Kozak</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Wagner</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Altarejos</snm>
						<fnm>JY</fnm>
					</au>
					<au>
						<snm>Dyck</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Belke</snm>
						<fnm>DD</fnm>
					</au>
					<au>
						<snm>Seveson</snm>
						<fnm>DL</fnm>
					</au>
					<au>
						<snm>Kelly</snm>
						<fnm>DP</fnm>
					</au>
					<au>
						<snm>Lopaschuk</snm>
						<fnm>GD</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2002</pubdate>
				<volume>277</volume>
				<fpage>4098</fpage>
				<lpage>103</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M106054200</pubid>
						<pubid idtype="pmpid" link="fulltext">11734553</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B52">
				<title>
					<p>Synthesis and structure-activity relationship of small-molecule malonyl coenzyme A decarboxylase inhibitors</p>
				</title>
				<aug>
					<au>
						<snm>Cheng</snm>
						<fnm>JF</fnm>
					</au>
					<au>
						<snm>Chen</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Wallace</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Tith</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Haramura</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Liu</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Mak</snm>
						<fnm>CC</fnm>
					</au>
					<au>
						<snm>Arrhenius</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Reily</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Thorn</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Harmon</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Barr</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Dyck</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Lopaschuk</snm>
						<fnm>GD</fnm>
					</au>
					<au>
						<snm>Nadzan</snm>
						<fnm>AM</fnm>
					</au>
				</aug>
				<source>J Med Chem</source>
				<pubdate>2006</pubdate>
				<volume>49</volume>
				<issue>5</issue>
				<fpage>1517</fpage>
				<lpage>25</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1021/jm050109n</pubid>
						<pubid idtype="pmpid" link="fulltext">16509570</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B53">
				<title>
					<p>CLOCK/BMAL1 is involved in lipid metabolism via transactivation of the peroxisome proliferator-activated receptor (PPAR) response element</p>
				</title>
				<aug>
					<au>
						<snm>Inoue</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Shinoda</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Ikeda</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Hayashi</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Kanazawa</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Nomura</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Matsunaga</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Xu</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Kawai</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Awata</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Komod</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Katayama</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>J Atherosclerosis Thrombosis</source>
				<pubdate>2005</pubdate>
				<volume>12</volume>
				<fpage>169</fpage>
				<lpage>74</lpage>
			</bibl>
			<bibl id="B54">
				<title>
					<p>Generation and initial analysis of more than 15,000 full length human and mouse cDNA sequences</p>
				</title>
				<aug>
					<au>
						<snm>Strausberg</snm>
						<fnm>RL</fnm>
					</au>
					<au>
						<snm>Feingold</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Grouse</snm>
						<fnm>LH</fnm>
					</au>
					<au>
						<snm>Derge</snm>
						<fnm>JG</fnm>
					</au>
					<au>
						<snm>Klausner</snm>
						<fnm>RD</fnm>
					</au>
					<au>
						<snm>Collins</snm>
						<fnm>FS</fnm>
					</au>
					<au>
						<snm>Wagner</snm>
						<fnm>L</fnm>
					</au>
					<etal/>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>2002</pubdate>
				<volume>99</volume>
				<fpage>16899</fpage>
				<lpage>903</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">139241</pubid>
						<pubid idtype="pmpid" link="fulltext">12477932</pubid>
						<pubid idtype="doi">10.1073/pnas.242603899</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B55">
				<title>
					<p>Chronic intermittent hypoxia upregulates genes of lipid biosynthesis in obese mice</p>
				</title>
				<aug>
					<au>
						<snm>Li</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Grigoryev</snm>
						<fnm>DN</fnm>
					</au>
					<au>
						<snm>Ye</snm>
						<fnm>SQ</fnm>
					</au>
					<au>
						<snm>Thorne</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Schwartz</snm>
						<fnm>AR</fnm>
					</au>
					<au>
						<snm>Smith</snm>
						<fnm>PL</fnm>
					</au>
					<au>
						<snm>O'Donnell</snm>
						<fnm>CP</fnm>
					</au>
					<au>
						<snm>Polotsky</snm>
						<fnm>VY</fnm>
					</au>
				</aug>
				<source>J Appl Physiol</source>
				<pubdate>2005</pubdate>
				<volume>99</volume>
				<fpage>1643</fpage>
				<lpage>8</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1152/japplphysiol.00522.2005</pubid>
						<pubid idtype="pmpid" link="fulltext">16037401</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
	</bm>
</art>
