Mouse anti-penta-His₆ tag monoclonal antibody (34660) was purchased from Qiagen (Valencia, CA). Horse radish peroxidase (HRP)-conjugated goat anti-mouse secondary antibodies were purchased from DakoCytomation (Denmark).

Human embryonic kidney cells (293) were obtained from and cultured in the medium recommended by the American Type Culture Collection (Manassas, VA). All cell lines were incubated at 37°C and 5% CO₂ under humidified conditions.

In order to generate recombinant adenoviruses with hexon insertions of arginine-glycine-aspartic acid (RGD)-containing sequences, fragments of the Ad5 penton base gene corresponding to the RGD motifs were derived by PCR and cloned into the BamHI site in the previously described HVR2-His₆/pH5S or HVR5-His₆/pH5S plasmids 18. The sequences corresponding to penton base-derived peptides, 33RGD, 43RGD, 53RGD, 63RGD, 73RGD, and 83RGD, were PCR amplified from Ad5 genomic DNA with the following pairs of primers: 33RGD sense (s) and 33RGD anti-sense (as), 43RGD sense (s) and 43RGD anti-sense (as), 53RGD sense (s) and 53RGD anti-sense (as), 63RGD sense (s) and 63RGD anti-sense (as), 73RGD sense (s) and 73RGD anti-sense (as), and 83RGD sense (s) and 83RGD anti-sense (as) (Table 1). For additional details, see reference 22. To create Ad5 vectors containing RGD epitopes in the HVRs of hexon, these resulting plasmids were digested with EcoRI and PmeI. These resulting fragments containing the homologous recombination regions and the hexon genes were purified, then recombined with a SwaI-digested Ad5 backbone vector that lacks the hexon gene, pAd5/ΔH5 23. These recombination reactions were performed in Escherichia coli BJ5183 (Strategene, La Jolla, CA). The resultant clones were designated Ad5/HVR2-33RGD-His₆, Ad5/HVR5-33RGD-His₆, Ad5/HVR5-43RGD-His₆, and Ad5/HVR5-53RGD-His₆, all of which contain the green fluorescence protein gene and firefly luciferase gene in the E1 region 18. The constructs were confirmed by restriction enzyme digestions and sequence analysis. Ad5, Ad5/HVR2-His₆, and Ad5/HVR5-His₆ were previously constructed as described 18.

To rescue viruses, the constructed plasmids were digested with PacI, and 2 μg DNA were transfected (Lipofectamine 2000 Reagent, Invitrogen, Carlsbad, CA) into the Ad-E1-expressing 293 cells. After plaques formed, they were processed for large-scale proliferation in 293 cells. Viruses were purified by double cesium chloride ultracentrifugation and dialyzed against phosphate-buffered saline containing 10% glycerol. Viruses were stored at -80°C until use. Final aliquots of virus were analyzed for physical titer using absorbance at 260 nm. The infectious viral titer (infectious particles per ml) was determined by tissue culture infectious dose (TCID₅₀) assay. Modifications of the hexon gene was confirmed by PCR analysis with the primers 5'HVR2 (s), CTCACGTATTTGGGCAGGCGCC and 3'HVR5(as), GGCATGTAAGAAATATGAGTGTCTGGG, which anneal up and downstream of the site of the insertion within the hexon open reading frame (Table 1).

The enzyme-linked immunosorbent assay (ELISA) assay was performed essentially as described previously 24. In brief, different amounts of viruses ranging from 4 × 10⁶ to 9 × 10⁹ VPs were immobilized in wells of a 96-well plate (Nunc Maxisorp, Rochester, NY) by overnight incubation in (per well) 100 μl of 100 mM carbonate buffer (pH 9.5) at 4°C. After washing with 0.05% Tween 20 in Tris-buffered saline and blocking with blocking solution (2% bovine serum albumin and 0.05% Tween 20 in TBS), the immobilized viruses were incubated with anti-penta-His₆ tag monoclonal antibody (Qiagen, Valencia, CA) for 2 h at room temperature, followed by AP-conjugated goat anti-mouse antibody incubation. Colormetric reaction was performed with p-nitrophenyl phosphate (Sigma-Aldrich, St. Louis, MO) as recommended by the manufacturer, and optical density at 450–650 nm (OD_450–650) was obtained with a microplate reader (Molecular Devices).

For the anti-RGD33-His₆ and anti-His₆ response, ELISA plates (Nunc Maxisorp, Rochester, NY) were coated with 20 μM of the RGD33-His₆ peptide or the His₆ peptide in 100 μl of 50 mM carbonate (pH 9.6) per well according to the method we described previously 25. Plates were washed and then blocked with 3% BSA/PBS. After washing, 60 μl of 1:50 diluted sera was added. After incubation for at least 2 hr at RT, the plates were extensively washed, and the isotype-specific HRP-conjugated anti-mouse antibody (Southern Biotech., Birmingham, AL) was added. ELISAs were developed with TMB substrate (Sigma-Aldrich, St. Louis, MO). OD_450–650 was measured on an Emax microplate reader.

Female C57BL/6J (H-2^b) mice at 6–8 weeks of age were obtained from the Jackson Laboratory (Bar Harbor, ME). Groups of at least three to five mice were analyzed in each experiment or at each time point. For antibody response analysis, the following adenoviral vectors were injected into each group of mice: Ad5, Ad5/HVR2-His₆, Ad5/HVR5-His₆, Ad5/HVR2-33RGD-His₆, Ad5/HVR5-33RGD-His₆, Ad5/HVR5-43RGD-His₆, and Ad5/HVR5-53RGD-His₆ at 1 × 10¹⁰viral particles (VPs) per mouse using tail intravenous injection. For CD4⁺ T cell response analysis, the following adenoviral vectors were injected to each group of mice: Ad5, Ad5/HVR2-33RGD-His₆, or Ad5/HVR5-33RGD-His₆ at 1 × 10¹⁰ VP per mouse using tail intravenous injection. On day 40, these mice were intravenously boosted with the same dose of the same vectors or peptide. These mice were then sacrificed 9 days later. All animal protocols were approved by the Institutional Animal Care and Use Committee at the University of Alabama at Birmingham.

The antigenic epitope of His₆ and RGD33-His₆ were predicted using the Emboss program http://emboss.sourceforge.net/apps/antigenic.html and by the Kyle-Doolittle hydropathic plot from the FIMM database of functional molecular immunology http://sdmc.lit.org.sg:8080/fimm/. Peptide sequences that were given high binding scores in both prediction programs were chosen for ELISA analysis. Peptides were synthesized by GenScript Co (Piscataway, NJ) and were >98% pure as indicated by analytical high-performance liquid chromatography. Peptides were dissolved in 100% DMSO at a concentration of 10 mM and stored at -20°C until use.

Intracellular analysis of cytokines produced by CD4+ T cells was carried out using FACS analysis according to the protocol of Harrington, et al. and Mangan, et al.2627. Briefly, prior to carrying out intracellular cytokine staining, polarized whole spleen cells or CD4+ T cells were stimulated for 5 h with phorbylmyristyl acetate (50 ng/ml; Sigma-Aldrich, St. Louis, MO) and ionomycin (750 ng/ml; Sigma-Aldrich) in the presence of either GolgiStop at the recommended concentrations (BD Pharmingen, San Diego, CA). Cells were first stained extracellularly with fluorescein isothiocyanate-conjugated anti-CD4+ (RM4-5), fixed and permeabilized with Cytofix/Cytoperm solution (BD Pharmingen), and then stained intracellularly with allophycocyanin-conjugated anti-IFN-γ (XMG1.2) and anti-IL-4 (11B11). Samples were acquired on a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ) and data were analyzed with FlowJo (Ashland, OR) software.

The data are presented as the mean ± the standard error. Statistical analyses were performed with the nonpaired two-tailed Student t test, assuming equal variance. Statistical significance was defined as P < 0.05.

In order to assess the capacity of the Ad5 hexon hypervariable regions to accommodate heterologous polypeptides, we genetically incorporated incrementally increasing fragments of the Arg-Gly-Asp (RGD)-containing loop of the Ad5 penton base. Fragments were engineered to contain the RGD motif in the middle, flanked by penton base-derived sequences of equal lengths on both sides. The length of each flanking sequence in the shortest construct was 15 amino acid (aa) residues; this was increased by 10-aa increments in succeeding constructs 22. DNA sequences corresponding to the fragments of the penton base protein were assembled by PCR (Figure 1A. and Table 1). These PCR products were cloned between codons for Ser192 and His193 (Fig. 1B–1) of the previously modified Ad5/HVR2-His₆ genome 18 or between codons for Ser273 and His274 of the previously modified Ad5/HVR5-His₆genome (Fig. 1B–2) 18. A total of six fragments encoding the penton base protein ranging in size from 33, 43, 53, 63, 73, and 83 aa were amplified and incorporated into the Ad5 hexon HVR2 or HVR5 region.

The newly designed hexon genes were transferred into the E1-deleted Ad5 genome lacking the hexon gene. Subsequent transfection of 293 cells with the resultant recombinant genomes led to the rescue of 4 of the 12 vectors. Viable viruses were produced with incorporation of 33 aa plus a 12 aa linker at HVR2 or HVR5 (Table 2A). In addition, viable viruses were rescued with incorporations of 43 and 53 aa plus linkers at HVR5 (Table 2A). The recombinant hexon viruses rescued contained the aforementioned penton base-RGD composition (Table 2B). Rescued viruses were further amplified and their identities were confirmed by PCR, non-defective revertant viruses were not detected (data not shown). These data were further confirmed by partial sequencing of the hexon genes contained in the Ad5/HVR2 or Ad5/HVR5 genomes. Having established the identities of the newly rescued Ad viruses, we next tested whether the large incorporations in hexon had any effect on virus stability and/or infectious properties. Physical titer, as well as infectious titer was determined for each virus. The viral particle/infectious particle (VP/IP) ratio was calculated for the control viruses, (Ad5, Ad/HVR2-His₆, and Ad/HVR5-His₆) as well as all of the hexon-modified viruses. We observed that, as the incorporation size at hexon increased the VP/IP ratio also increased compared to the His₆ vectors or unmodified Ad5 (Table 3). A normal VP/IP ratio of unmodified Ad ranges from ~10–30.

Our previous studies determined that His₆ epitopes incorporated in HVR2 or HVR5 could bind to anti-His₆ tag antibody via an ELISA assay, therefore surface exposed 18. After establishing the ability to place large epitopes into HVR2 or HVR5, we next sought to explore whether the larger epitope incorporations were also surface exposed. Only surface expressed motifs should be accessible to antibody binding, thus, we verified that the RGD-His₆ motif in HVR2 or HVR5 were accessible on the virion surface by ELISA with an anti-His₆ antibody (Fig. 2). In the assay, varying amounts of purified viruses were immobilized in the wells of ELISA plates and incubated with anti-His₆ antibody and appropriate secondary antibody. The results demonstrated that Ad5/HVR2-33RGD-His₆, Ad5/HVR5-33RGD-His₆, Ad5/HVR5-43RGD-His₆, Ad5/HVR5-53RGD-His₆, and positive controls (Ad5/HVR2-His₆ and Ad5/HVR5-His_6,) 18 have significant levels of binding by anti-His₆ antibody, while negative control Ad5 showed essentially no binding. These results indicate that the RGD-His₆ epitopes incorporated in HVR2 or HVR5 are exposed on the virion surface.

We next sought to establish that these modified Ad vectors could elicit an immune response in mice. In this regard, a high IgG response is in part indicative of protection for the host organism. Equal amounts of viral particles were used to immunize C57BL/6J mice. The sera from these mice were collected at multiple time points up to 70 days post-injection for analysis with ELISA binding assays (Fig. 3). For these assays synthesized His₆peptides (His6/linker) (LGSHHHHHHLGS) were first bound to the ELISA plate, the plates were then incubated with immunized mice sera. The binding of mouse anti-His₆ IgG to the synthesized peptides was detected with a HRP-conjugated secondary antibody (Fig. 3A–B). The data illustrate no binding of the His₆ peptide with serum from the mice immunized with the negative control Ad5 or the uninfected mice. This is in contrast to substantial binding seen with mice immunized with Ad5/HVR5-43RGD-His₆, Ad5/HVR5-53RGD-His₆, or positive controls 18, while Ad5/HVR2-33RGD-His₆ and Ad5/HVR5-33RGD-His₆ showed weaker binding. Of note, all of these vectors contain His₆ epitopes in the modified HVR regions. The data demonstrated that immunization with Ads containing capsid-incorporated antigen elicits an anti-His₆ IgG response in mice which shows a substantial peak at 30 days (Fig. 3A) when observed over a time course of 70 days (Fig. 3B); furthermore, the magnitude of the immune response was a function of antigen locale and flanking sequences (Fig. 3A–B).

Similarly, significant results were seen in response to the synthesized 33RGD-His₆ antigenic peptide (which contains a core RGD residue flanked by His₆/linker). These results were observed at time points ranging from 1–70 days (Fig. 4A). Since the probe contained both the 33RGD and His₆ epitopes binding was expected for all of the sera samples except sera from Ad5 immunized mice.

We next performed experiments to determine the quantitative aspects of the isotype-specific humoral responses that were generated in response to our vectors. For IgG1 isotype antibodies, the highest levels of anti-33RGD-His₆ IgG1 were seen on day 7 after immunization with Ad5/HVR5-33RGD-His₆, Ad5/HVR5-43RGD-His₆, and Ad5/HVR5-53RGD-His₆ virions. These results confirm that the HVR5 loop provides the most immunogenic environment for production of anti-33RGD-His₆ IgG1 isotype antibodies. Further supporting this, the IgG1 antibody response to the 33RGD-His₆ in the HVR2 loop was markedly lower when directly compared to the 33RGD-His₆ in the HVR5 loop (Fig. 4B). The IgG2b (Fig. 4C) and IgG2c (Fig. 4D) isotype specific antibody response to RGD33-His₆ epitope followed the same pattern as IgG1, except that peak values did not occur until day 12 after immunization, and antibody levels were sustained at high levels out to day 50. These results indicate that RGD-His₆ epitopes in the HVR5 loop are more immunogenic and invoke higher sera levels of total anti-33RGD-His₆ IgG antibodies than RGD-His₆ epitopes in the HVR2 loop.

Increased antibody titers of the IgG class require help from either Th1 CD4⁺ T cells that produce IFN-γ or Th2 CD4⁺ T cells that produce IL-4 28. Th1 is generally associated with isotype class switching to IgG2a (in IgH^d strain of mice) or IgG2c (in IgH^b stain), whereas Th2 help is associated with class switching to IgG1 or IgG2b in mice 29. To determine if there is an increase in Th1 or Th2 response to the 33RGD-His₆ peptide after boost of the Ad5/HVR2-33RGD-His₆ or Ad5/HVR5-33RGD-His₆ vector, a single-cell suspension of spleen cells was prepared on day 9 after secondary virus infection. Cells were stained with a fluorescent labeled anti-CD4 antibody and then permeabilized in intracellular stain with fluorescent conjugated antibodies against IL-4 or IFN-γ. CD4⁺ T cells from mice immunized with Ad5/HVR5-33RGD-His₆ produced a significant increase in IFN-γ expressing cells and a lesser increase in CD4⁺ T cells that express IL-4. In C57BL/6J mice immunized with Ad5/HVR2-33RGD-His₆ or Ad5, there were very low numbers of IFN-γ⁺ CD4⁺ T cells (Fig. 5A–B). CD4⁺ cells expressing IL-4 was equally increased in mice immunized with Ad5/HVR2-33RGD His₆ or with Ad5/HVR5-33RGD-His₆ (Fig. 5A–B). The increased IgG antibody response to 33RGD-His₆ in the HVR5 loop of Ad is associated with a significant increased Th1 T cell response.

To evaluate whether immunization with our hexon-modified viruses resulted in improved secondary antibody responses, mice were immunized with Ad5, Ad5/HVR2-33RGD-His₆, or Ad5/HVR5-33RGD-His₆. Forty days later, mice were boosted with the respective hexon-modified viruses. Sera levels of antibodies against the 33RGD-His₆ peptide were determined at day 9 following the booster injection. The Ad5/HVR5-33RGD group exhibited further enhancement with respect to IgG1 antibody response to the 33RGD-His₆ peptide after boosting compared to Ad5 control (Fig. 6). This trend is similar to that seen after primary immunization (Fig. 4B).