<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1742-4933-5-14</ui>
   <ji>1742-4933</ji>
   <fm>
      <dochead>Short report</dochead>
      <bibl>
         <title>
            <p>Age-related appearance of a CMV-specific high-avidity CD8<sup>+ </sup>T cell clonotype which does not occur in young adults</p>
         </title>
         <aug>
            <au ce="yes" id="A1">
               <snm>Schwanninger</snm>
               <fnm>Angelika</fnm>
               <insr iid="I1"/>
               <email>aschw@interchange.ubc.ca</email>
            </au>
            <au ce="yes" id="A2">
               <snm>Weinberger</snm>
               <fnm>Birgit</fnm>
               <insr iid="I1"/>
               <email>birgit.weinberger@oeaw.ac.at</email>
            </au>
            <au id="A3">
               <snm>Weiskopf</snm>
               <fnm>Daniela</fnm>
               <insr iid="I1"/>
               <email>daniela.weiskopf@oeaw.ac.at</email>
            </au>
            <au id="A4">
               <snm>Herndler-Brandstetter</snm>
               <fnm>Dietmar</fnm>
               <insr iid="I1"/>
               <email>dietmar.herndler-brandstetter@oeaw.ac.at</email>
            </au>
            <au id="A5">
               <snm>Reitinger</snm>
               <fnm>Stephan</fnm>
               <insr iid="I1"/>
               <email>sreit@chem.ubc.ca</email>
            </au>
            <au id="A6">
               <snm>Gassner</snm>
               <fnm>Christoph</fnm>
               <insr iid="I2"/>
               <email>christoph.gassner@uki.at</email>
            </au>
            <au id="A7">
               <snm>Schennach</snm>
               <fnm>Harald</fnm>
               <insr iid="I2"/>
               <email>harald.schennach@uki.at</email>
            </au>
            <au id="A8">
               <snm>Parson</snm>
               <fnm>Walther</fnm>
               <insr iid="I3"/>
               <email>walther.parson@i-med.ac.at</email>
            </au>
            <au id="A9">
               <snm>W&#252;rzner</snm>
               <fnm>Reinhard</fnm>
               <insr iid="I4"/>
               <email>reinhard.wuerzner@i-med.ac.at</email>
            </au>
            <au ca="yes" id="A10">
               <snm>Grubeck-Loebenstein</snm>
               <fnm>Beatrix</fnm>
               <insr iid="I1"/>
               <email>beatrix.grubeck@oeaw.ac.at</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Institute for Biomedical Aging Research, Austrian Academy of Sciences, Rennweg 10, 6020 Innsbruck, Austria</p>
            </ins>
            <ins id="I2">
               <p>Central Institute for Blood Transfusion and Division for Immunology, University Hospital, 6020 Innsbruck, Austria</p>
            </ins>
            <ins id="I3">
               <p>Institute of Legal Medicine, Innsbruck Medical University, 6020 Innsbruck, Austria</p>
            </ins>
            <ins id="I4">
               <p>Department of Hygiene, Microbiology and Social Medicine, Innsbruck Medical University, 6020 Innsbruck, Austria</p>
            </ins>
         </insg>
         <source>Immunity &amp; Ageing</source>
         <issn>1742-4933</issn>
         <pubdate>2008</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>14</fpage>
         <url>http://www.immunityageing.com/content/5/1/14</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19014475</pubid>
               <pubid idtype="doi">10.1186/1742-4933-5-14</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>08</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>12</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>12</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Schwanninger et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <p>Old age is associated with characteristic changes of the immune system contributing to higher incidence and severity of many infectious diseases. Particularly within the T cell compartment latent infection with human Cytomegalovirus (CMV) is contributing to and accelerating immunosenescence. However, latent CMV infection and reactivation usually does not cause overt symptoms in immunocompetent elderly persons indicating immunological control of disease. Little is still known about the clonal composition of CMV-specific T cell responses in donors of different age. We therefore analyzed CD8<sup>+ </sup>T cells specific for an immunodominant pp65-derived nonamer-peptide (NLVPMVATV; CMV<sub>NLV</sub>) in different age-groups. Independent of donor age CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells preferentially use the V beta family 8. This family has monoclonal expansions in the majority of donors after stimulation of CD8<sup>+ </sup>T cells with the peptide. By sequencing the CDR3 region of the T cell receptor we demonstrated that CMV<sub>NLV</sub>-specific, BV8<sup>+ </sup>CD8<sup>+ </sup>T cells share the conserved CDR3-sequence motif SANYGYT in donors of all age groups. Interestingly, a second conserved clonotype with the CDR3-sequence motif SVNEAF appears in middle-aged and elderly donors. This clonotype is absent in young individuals. The age-related clonotype SVNEAF binds to the pMHC-complex with higher avidity than the clonotype SANYGYT, which is predominant in young adults. The dominance of this high avidity clonotype may explain the lack of overt CMV-disease in old age.</p>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification id="refman" subtype="user_supplied_xml" type="bmc"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Ageing is associated with an increase in the incidence and severity of many infectious diseases. The most common infections in the elderly are influenza, infections with Streptococcus pneumoniae, infections of the skin and also of the urogenital tract <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In addition, reactivation of latent viruses and bacteria such as Varicella-Zoster-Virus leading to Herpes zoster <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp> and Mycobacterium tuberculosis <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp> are more frequent in old age. This may be due to decreased immunosurveillance as well as to other factors such as age-associated diseases, poor nutrition, chronic renal failure and institutionalization.</p>
         <p>Cytomegalovirus (CMV) is a human beta-herpesvirus with a prevalence of 60&#8211;100% in the adult population. The link between CMV-infection, immunosenescence and longevity has recently been a subject of great interest <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Despite frequent reactivation of latent CMV in the elderly as suggested by increased anti-CMV antibodies and viral shedding in the urine <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> there are no reports about overt CMV-disease in immunocompetent elderly persons. T cells are essential for the control of viral replication, spread and disease <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. In CMV-seropositive elderly persons up to 25% of the total CD8<sup>+ </sup>T cell pool can be specific for CMV with the epitope NLVPMVATV of the pp65 matrix protein (CMV<sub>NLV</sub>) being immunodominant <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. These CMV-specific cells show a highly differentiated effector phenotype <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp> and express markers for cytotoxicity <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. They are proinflammatory <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, and to a high degree clonally expanded <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. This has led to the suggestion that CMV-specific T cell clones take up a lot of space and may therefore be responsible for the loss of T cells of other specificities, such as for instance for Epstein-Barr virus (EBV) <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. The proinflammatory properties of the steadily increasing number of CMV-specific T cells may represent an additional problem, as age-related subclinical inflammatory processes termed "inflamm-ageing" can be enhanced <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Inflammation is known to support the development and progression of age-related diseases such as for instance Alzheimer's disease <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. In longitudinal studies on octo- and nonagenerians CMV-seropositivity has also been linked to the so-called "immune-risk phenotype" and with increased mortality <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>.</p>
         <p>Despite the obvious importance of CMV infection in old age little is known about the clonal composition of CMV-specific T cells in apparently healthy elderly persons. We therefore analyzed the clonal composition of CD8<sup>+ </sup>T cells, which are specific for the HLA-A*0201-restricted, immunodominant pp65-derived epitope NLVPMVATV <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp> in persons of different age.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Stimulation of CD8<sup>+ </sup>T cells with CMV<sub>NLV</sub>-peptide leads to expansion of CMV<sub>NLV</sub>-specific cells with restricted V beta usage</p>
            </st>
            <p>CD8<sup>+ </sup>T cells were isolated from peripheral blood of healthy donors of different age groups and were cultivated for 14 days in the presence of the immunodominant, HLA A*0201-restricted CMV-derived peptide NLVPMVATV, IL-2 and autologous irradiated feeder cells. The frequencies of CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were determined ex vivo and were 0.6% &#177; 0.7, 1.7% &#177; 0.8, and 1.7 &#177; 1.9, for young, middle-aged and elderly donors respectively (mean &#177; SD; p &lt; 0.05 for young vs. middle-aged and young vs. old). Irrespective of age, high frequencies of CMV<sub>NLV</sub>-specific T cells were obtained for most donors after 14 days of culture (mean 77.0% &#177; 14.9). Figure <figr fid="F1">1A</figr> shows examples of pentamer-FACS-stainings before and after culture for one young, one middle-aged and one elderly donor.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Preferential expansion of BV8 and BV13 CD8<sup>+ </sup>T cells after stimulation with CMV<sub>NLV</sub>-peptide</p>
               </caption>
               <text>
                  <p><b>Preferential expansion of BV8 and BV13 CD8<sup>+ </sup>T cells after stimulation with CMV<sub>NLV</sub>-peptide</b>. Cells were stimulated in vitro for 14 days with CMV<sub>NLV</sub>-peptide in the presence of IL-2 and autologous, irradiated PBMC. (A) CD8<sup>+ </sup>T cells were stained with APC-conjugated pentamers containing the CMV<sub>NLV</sub>-peptide. Representative examples are shown for one young, one middle-aged and one elderly donor directly ex vivo and after 14 days of culture. Percentages of CD8<sup>+ </sup>CMV<sub>NLV</sub>-specific T cells are indicated. (B) After 14 days of culture CMV<sub>NLV</sub>-specific T cells were further purified from the expanded cells using MACS-technology. Spectratyping was performed from PCR-products of 24 individual V beta families for 31 donors (10 young, 7 middle-aged, 14 elderly). In the right panel examples for the different clonality and intensity scores (see Methods) are shown. Clonality and intensity scores are added to obtain a total score. For each BV family the percentage of donors with a total score above 5 is shown.</p>
               </text>
               <graphic file="1742-4933-5-14-1"/>
            </fig>
            <p>In order to analyze the T cell receptor (TCR) repertoire CMV<sub>NLV</sub>-specific T cells were further purified using pentamers and microbeads reaching a purity of CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells above 95% for all samples. Spectratyping of the CDR3 (complementary determining region 3) region of the TCR beta chain was performed as previously described <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>. CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells preferentially used BV 8 and BV 13 after culture (Figure <figr fid="F1">1B</figr>). 64% and 59% of all donors had monoclonal expansions (clonality score 3) in BV8 or BV13, respectively. No differences in the spectratype scores were observed between the different age groups (data not shown). Previous work analyzing the V beta usage of CMV<sub>NLV</sub>-specific T cells shows that the broad repertoire of CMV-specific T cells, which is stimulated during primary infection rapidly focuses on individual BV families within the first weeks after infection <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Restimulation in vitro does not alter the T cell repertoire <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. In accordance with our results it has been shown that CMV<sub>NLV</sub>-specific T cells preferentially use BV 8, 13 and 6 in healthy adults as well as in immunosuppressed patients <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>The sequence of the CDR3 region of BV8<sup>+ </sup>T cell receptors of CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells changes with age</p>
            </st>
            <p>In order to characterize the repertoire of CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells in more detail we sequenced the CDR3-region of the T cell receptor of in vitro expanded and purified BV8<sup>+ </sup>T cells. We chose this BV family as the most dominant family within CMV<sub>NLV</sub>-specific T cells. TCR sequences were amplified from cDNA and were cloned into a bacterial vector. Plasmid-DNA was isolated and sequenced by standard procedures. Figure <figr fid="F2">2</figr> shows the amino acid sequences of the antigen binding site for CMV<sub>NLV</sub>-specific T cell receptors. In accordance with literature on CDR3-sequences from healthy and HIV-infected adults <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp> the highly conserved CDR3-sequence motif SANYGYT was detected in all young donors. 72% of all bacterial clones derived from young individuals share this sequence motif. 28% of all sequences were private, which means that they were not conserved between different donors. However, we now show that with increasing age the dominance of the clonotype SANYGYT decreases, as this sequence is only present in 21% or 36% of the bacterial clones obtained from middle-aged and elderly donors, respectively. Interestingly, a second dominant clonotype with a shorter CDR3-region and the CDR3-sequence motif SVNEAF appears in middle-aged and elderly donors. Exchanges of one or two aminoacids were considered as minor variations. The age-dependency of CDR3-sequences was analyzed in a cross-table with calculation of Pearson-Chi-square and was shown to be significant (p &lt; 0.01). The CDR3-sequence motif SVNEAF has been detected in previous studies in adult persons <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>, but was not identified as a conserved sequence. None of this previous work refers to the age of the donors and it can thus be assumed that most of the donors studied were young adults. We now for the first time report that a CMV<sub>NLV</sub>-specific BV8<sup>+ </sup>clonotype with the CDR3 sequence SVNEAF becomes dominant with increasing age, while the frequency of the "youth related" clonotype SANYGYT decreases.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Sequence analysis of the CDR3-region of BV8<sup>+ </sup>CMV<sub>NVL</sub>-specific T cells from different age-groups</p>
               </caption>
               <text>
                  <p><b>Sequence analysis of the CDR3-region of BV8<sup>+ </sup>CMV<sub>NVL</sub>-specific T cells from different age-groups</b>. PCR-products were generated of the relevant TCR-sequences and cloned into a bacterial vector. 4 arbitrarily chosen bacterial clones are shown for each donor. Two dominant sequences and a variety of individually used sequences were detected. Conserved sequences were categorized as "SANYGYT" (light grey) and "SVNEAF" (dark grey). Discordance of one or two amino acids from the conserved dominant sequences was considered as minor variation, and these clones were included in these two categories. Sequences with greater variations were considered as private clones.</p>
               </text>
               <graphic file="1742-4933-5-14-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>CMV-specific BV8+ CD8<sup>+ </sup>T cells with the TCR-sequence SVNEAF have a higher antigen avidity than corresponding cells with the sequence SANYGYT</p>
            </st>
            <p>In order to further investigate CMV<sub>NLV</sub>-specific BV8<sup>+ </sup>T cells with different conserved CDR3-sequences we analyzed the antigen avidity of T cells with either the CDR3-sequence-motif SANYGYT or SVNEAF. For this purpose cultures were selected, in which BV8<sup>+ </sup>CMV<sub>NLV</sub>-specific T cells had a monoclonal profile with the CDR3-sequence SANYGYT or SVNEAF, respectively. Binding and dissociation of pMHC pentamers to the T cell receptor of in vitro expanded BV8<sup>+ </sup>CMV<sub>NLV</sub>-specific T cells were analyzed. Staining with increasing amounts of CMV<sub>NLV</sub>-pentamer shows that pentamer binding and therefore avidity of the TCR is significantly increased for T cells with the CDR3-sequence SVNEAF compared to corresponding cells with the CDR3-sequence SANYGYT (Figure <figr fid="F3">3A</figr>; note the logarithmic scale). The kinetics of TCR-pMHC dissociation provides information on the stability of the TCR-pMHC complexes. T cells were stained with saturated amounts of CMV<sub>NLV</sub>-pentamer and anti-HLA-A2*0201 antibodies were added to prevent re-binding of dissociated pentamers. We could show that CMV-pentamers dissociated more slowly from CMV-specific CD8<sup>+ </sup>T cells with the CDR3-sequence SVNEAF, whereas TCR-pMHC complexes on cells with the sequence SANYGYT were less stable (Figure <figr fid="F3">3B</figr>). In summary these data show that the interaction between pMHC complexes and the TCR is stronger and more stable for T cells that express a TCR with the antigen-binding-motif SVNEAF indicating higher avidity of these T cells.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Higher antigen avidity of CMV-specific CD8<sup>+ </sup>T cells with the CDR3-sequence SVNEAF</p>
               </caption>
               <text>
                  <p><b>Higher antigen avidity of CMV-specific CD8<sup>+ </sup>T cells with the CDR3-sequence SVNEAF</b>. CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were stimulated in vitro with CMV<sub>NLV</sub>-peptide for two weeks. Donors with a monoclonal profile of BV8<sup>+ </sup>CMV<sub>NLV</sub>-specific T cells with the CDR3-sequence SANYGYT or SVNEAF respectively were selected. BV8<sup>+ </sup>T cells were identified by FACS-staining and results are shown for BV8<sup>+ </sup>gated, CMV<sub>NLV</sub>-specific-T cells only. (A) CMV<sub>NLV</sub>-specific BV8<sup>+ </sup>T cells were stained with different concentrations of CMV<sub>NLV</sub>-pentamer. The mean fluorescence intensity (MFI; note the logarithmic scale) of bound pentamer is indicated for donors with the CDR3-sequence SANYGYT (light grey) or SVNEAF (dark grey). n = 3; mean &#177; SEM. * <it>p </it>&lt; 0.05 (Student's t-test for unpaired data). (B) CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were stained with saturated amounts of CMV<sub>NLV</sub>-pentamer (1.25 &#956;g/ml) and the dissociation rates of pentamers from CMV-specific CD8<sup>+ </sup>T cells were determined for donors with the CDR3-sequence SANYGYT (light grey) or SVNEAF (dark grey). Dissociation of pentamers was assessed by FACS analysis at different time points (range 0&#8211;180 min). Mean fluorescence intensity (MFI) of pentamer-positive T cells at time point 0 (maximum pentamer binding) was considered as 100%. n = 3; mean &#177; SEM. * <it>p </it>&lt; 0.05 (Student's t-test for unpaired data).</p>
               </text>
               <graphic file="1742-4933-5-14-3"/>
            </fig>
            <p>High avidity CD8<sup>+ </sup>T cells are essential for clearance of viral infections <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp> and for the elimination of tumour cells <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. Therefore, anti-tumour vaccination aims to induce high avidity tumour-specific T cells. In concordance, immunotherapy for viral diseases such as EBV- or CMV-reactivation and infection in immunosuppressed patients after haematopoietic stem cell transplantation benefits from selection of virus-specific T cells with high avidity <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Regarding our data, the question arises, why the high avidity clonotype SVNEAF is absent in young individuals while it is dominant in a subset of the middle-aged and elderly persons. In view of the well known decline of immune function with age <abbrgrp><abbr bid="B42">42</abbr></abbrgrp> it seems likely that a subgroup of elderly persons suffers from high CMV-activity and pronounced viral reactivation <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, which necessitated the expansion of the high avidity BV8<sup>+ </sup>CMV<sub>NLV</sub>-specific clonotype for viral control. Due to its high avidity this clonotype expands and presumably exerts increased effector functions in vivo leading to protection from CMV-disease. However, accumulation of CMV-specific T cells of this specific clonotype may be particularly prone to inhibit T cells of other specificities <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. CMV-seropositivity has also been associated with non-responsiveness to anti-influenza vaccination <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> and with frailty <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. The price for good protection against CMV -as provided by CMV-specific cytotoxic T lyphocytes with high avidity- might thus be accelerated immunosenescence and potentially lower responses to other pathogens.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Blood donors</p>
            </st>
            <p>Peripheral blood was obtained from healthy, CMV-seropositive, HLA A*0201- positive donors of different age groups (Table <tblr tid="T1">1</tblr>). A medical history was obtained and only individuals without malignancies, acute diseases or advanced stages of severe chronic diseases, such as chronic inflammatory disease, atherosclerotic disease, congestive heart failure, poorly controlled diabetes mellitus, renal or hepatic disease or chronic obstructive pulmonary disease and persons without immunosuppressive therapy were included in the study. The study was approved by the local ethical committee and all participants gave their written informed consent. Peripheral blood mononuclear cells (PBMC) were isolated by density gradient centrifugation (FicollHypac; Amersham Biosciences). CMV-specific antibody levels were determined by enzyme-linked immunosorbent assay (Enzygnost<sup>&#174; </sup>anti-CMV/immunoglobulin G; Dade Behring) according to the manufacturer's protocol. Recent primary infection with CMV is associated with the presence of low-avidity CMV-specific antibodies. In a fluorescence-based assay (Euroimmun) the avidity of CMV-specific IgG was measured by analyzing the stability of the antigen-antibody-complex in the presence of urea. Low-avidity antibodies show a "relative avidity index" (RAI; optical density in the presence of urea compared to optical density without urea) of &lt;40%. For all samples tested the RAI was >45% indicating past infection and excluding recent primary infection.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Gender and age of blood donors</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>male/female</p>
                     </c>
                     <c ca="center">
                        <p>median age (years)</p>
                     </c>
                     <c ca="center">
                        <p>age range (years)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>young (&#8804; 39 y)</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>4/6</p>
                     </c>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="center">
                        <p>28&#8211;37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>middle-aged (40&#8211;64 y)</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>3/4</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>42&#8211;53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>elderly (&#8805; 65 y)</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>7/8</p>
                     </c>
                     <c ca="center">
                        <p>70</p>
                     </c>
                     <c ca="center">
                        <p>65&#8211;87</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Cultivation of CD8<sup>+ </sup>T lymphocytes and enrichment of CMV<sub>NLV</sub>-specific T cells</p>
            </st>
            <p>CD8<sup>+ </sup>T cells were isolated using anti-CD8-conjugated microbeads and the magnetic-activated cell sorting (MACS) system (Milteny Biotech) according to the specifications given by the manufacturer. CD8<sup>+ </sup>T cells were cultivated in RPMI 1640 (Cambrex) supplemented with 10% FCS (Sigma-Aldrich) and 1% penicillin-streptamycin (Cambrex) at 37&#176;C and 5% CO<sub>2</sub>. T cells were stimulated for 14 days with 0.1 &#956;g/ml of the immunodominant peptide NLVPMVATV (Bachem) derived from the CMV-encoded protein pp65 in the presence of IL-2 (20 ng/ml) and irradiated (30 Gy) autologous PBMC in a CD8<sup>+ </sup>: PBMC ratio of 1:1. IL-2 (20 ng/ml) was added every three days and cells were restimulated with peptide and irradiated autologous PBMC after 7 days. Percentages of CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were determined prior to culture and after 14 days of stimulation by immunofluorescence surface staining with APC-coupled pentamers containing the CMV<sub>NLV </sub>peptide (Pro5<sup>&#174; </sup>MHC, Proimmune). After 14 days of cultivation CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were purified using APC-conjugated CMV-pentamer, anti-APC-antibodies coupled with magnetic beads and MACS-technology. Purity of CMV<sub>NLV</sub>-specific T cells was >95% in all cases.</p>
         </sec>
         <sec>
            <st>
               <p>Isolation of RNA and cDNA synthesis</p>
            </st>
            <p>RNA was isolated from CMV<sub>NLV</sub>-specific T cells using the RNeasy Plus Mini Kit (QIAGEN) and cDNA-synthesis was performed using a Reverse Transcription system with Oligo(dT)-primers (Promega).</p>
         </sec>
         <sec>
            <st>
               <p>CDR3 spectratyping of V beta families</p>
            </st>
            <p>PCR fragments were amplified from cDNA for 24 V beta families (BV) and complementarity determining region (CDR3) spectratyping was performed as previously described <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>. Analysis of the raw data was performed with the GeneScan 3.7 analysis software package (PE Applied Biosystems) using the Local Southern method for fragment size estimation <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. The occurrence of dominant clonal expansions was quantified for each V beta family by assigning scores for clonality (1 = Gaussian distribution; 2 = several peaks; 3 = one peak; compare with <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>) and intensity as measured in relative fluorescence units (RFU) (0 = &lt; 500 RFU; 1 = 500&#8211;3000 RFU; 2 = 3000&#8211;8000; 3 = >8000). If necessary, PCR-products were diluted prior to spectratyping and the dilution factor was taken into account for the calculation of the intensity score. Diversity and intensity scores were added and BV families with a total score of &#8805; 5 were considered as predominant. This score equally weights monoclonal BV families with intermediate intensity (3+2) as well as oligoclonal BV families with high intensity (2+3). Both categories as well as monoclonal BV families with high intensity (3+3) were considered as predominant.</p>
         </sec>
         <sec>
            <st>
               <p>Bacterial cloning of TCR-sequences and sequence analysis</p>
            </st>
            <p>T cell receptor sequences of the BV8 family were amplified using a forward primer specific for the BV8 family (5' CGTTCCGATAGATGATTCAGG 3') and a reverse primer (5' CTGGGTCCACTCGTCATTCT 3') located in the constant region of the TCR beta chain. PCR fragments were cloned into the pCR<sup>&#174;</sup>-II-TOPO<sup>&#174; </sup>vector (Invitrogen) via TA-cloning and the vector was transformed into chemically competent E. coli (One Shot TOP10, Invitrogen). For each donor several positive clones were picked and plasmid DNA was extracted using standard procedures (QIAprep Spin Miniprep Kit, QIAGEN). TCR-sequences were determined by standard sequencing procedures (QIAGEN) and sequence data were analyzed using the Bioedit Sequence Alignment Editor 7.0.5.3.</p>
         </sec>
         <sec>
            <st>
               <p>Measurement of TCR binding kinetics</p>
            </st>
            <p>CMV<sub>NLV</sub>-specific CD8<sup>+ </sup>T cells were harvested after 14 days of culture and used for pentamer binding and dissociation assays as previously described <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp> with minor modifications. Briefly, T cells were stained with increasing amounts (range 0.1 to 5 &#956;g/ml) of CMV<sub>NLV</sub>-pentamers. Mean fluorescence intensity (MFI) of pentamer-binding CD8<sup>+ </sup>T cells was measured by a FACSCalibur flow cytometer (BD Pharmingen). For the analysis of pentamer dissociation T cells were stained with saturated amounts of CMV<sub>NLV</sub>-pentamers (1.25 &#956;g/ml). 25 &#956;g/ml unlabelled anti-HLA-A2*0201 antibodies (clone BB7.2) were added to prevent re-binding of dissociated pentamers. Dissociation of pentamers was assessed by FACS analysis at different time points (range 0&#8211;180 min). The MFI of pentamer-positive T cells at time point 0 (maximum pentamer binding) was considered as 100%.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>AS carried out the TCR avidity studies. BW carried out cloning and sequencing experiments and prepared the manuscript. DW carried out cloning and sequencing experiments. DHB performed FACS-analysis. SR participated in the analysis of sequence data. CG collected blood from healthy donors and performed HLA-analysis. HS collected blood from healthy donors and performed HLA-analysis. WP performed the spectratyping. RW performed antibody analysis. BGL designed the study and supervised the preparation the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work has been supported by the Austrian Science Fund (project S9308-B05) and part of this project was supported by, and carried out within the EU-funded Network of Excellence LifeSpan (FP6 036894). We thank Michael Keller and Brigitte Jenewein for outstanding technical support. DHB is supported by a FLARE (Future Leaders of Ageing Research in Europe) post-doctoral fellowship funded by the Austrian Federal Ministry of Science and Research.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Ageing and infection</p>
            </title>
            <aug>
               <au>
                  <snm>Gavazzi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Krause</snm>
                  <fnm>KH</fnm>
               </au>
            </aug>
            <source>Lancet Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <fpage>659</fpage>
            <lpage>666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1473-3099(02)00437-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">12409046</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>The epidemiology of herpes zoster and potential cost-effectiveness of vaccination in England and Wales</p>
            </title>
            <aug>
               <au>
                  <snm>Edmunds</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Brisson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Vaccine</source>
            <pubdate>2001</pubdate>
            <volume>19</volume>
            <fpage>3076</fpage>
            <lpage>3090</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0264-410X(01)00044-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">11312002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Current management of herpes zoster: the European view</p>
            </title>
            <aug>
               <au>
                  <snm>Volpi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gross</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Hercogova</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>RW</fnm>
               </au>
            </aug>
            <source>Am J Clin Dermatol</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>317</fpage>
            <lpage>325</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2165/00128071-200506050-00005</pubid>
                  <pubid idtype="pmpid">16252931</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Tuberculosis in the elderly</p>
            </title>
            <aug>
               <au>
                  <snm>Rajagopalan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yoshikawa</snm>
                  <fnm>TT</fnm>
               </au>
            </aug>
            <source>Z Gerontol Geriatr</source>
            <pubdate>2000</pubdate>
            <volume>33</volume>
            <fpage>374</fpage>
            <lpage>380</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s003910070034</pubid>
                  <pubid idtype="pmpid">11130191</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Tuberculosis in aging adults</p>
            </title>
            <aug>
               <au>
                  <snm>Yoshikawa</snm>
                  <fnm>TT</fnm>
               </au>
            </aug>
            <source>J Am Geriatr Soc</source>
            <pubdate>1992</pubdate>
            <volume>40</volume>
            <fpage>178</fpage>
            <lpage>187</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1740604</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Ageing and life-long maintenance of T-cell subsets in the face of latent persistent infections</p>
            </title>
            <aug>
               <au>
                  <snm>Nikolich-Zugich</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Nat Rev Immunol</source>
            <pubdate>2008</pubdate>
            <volume>8</volume>
            <fpage>512</fpage>
            <lpage>522</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nri2318</pubid>
                  <pubid idtype="pmpid" link="fulltext">18469829</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Human immunosenescence: is it infectious?</p>
            </title>
            <aug>
               <au>
                  <snm>Pawelec</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Akbar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Caruso</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Solana</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Grubeck-Loebenstein</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wikby</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Immunol Rev</source>
            <pubdate>2005</pubdate>
            <volume>205</volume>
            <fpage>257</fpage>
            <lpage>268</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.0105-2896.2005.00271.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15882359</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Chronic herpesvirus reactivation occurs in aging</p>
            </title>
            <aug>
               <au>
                  <snm>Stowe</snm>
                  <fnm>RP</fnm>
               </au>
               <au>
                  <snm>Kozlova</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Yetman</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Walling</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Goodwin</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Glaser</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Exp Gerontol</source>
            <pubdate>2007</pubdate>
            <volume>42</volume>
            <fpage>563</fpage>
            <lpage>570</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1992441</pubid>
                  <pubid idtype="pmpid" link="fulltext">17337145</pubid>
                  <pubid idtype="doi">10.1016/j.exger.2007.01.005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Hierarchical and redundant lymphocyte subset control precludes cytomegalovirus replication during latent infection</p>
            </title>
            <aug>
               <au>
                  <snm>Polic</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hengel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Krmpotic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Trgovcich</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pavic</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Luccaronin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jonjic</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Koszinowski</snm>
                  <fnm>UH</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>1998</pubdate>
            <volume>188</volume>
            <fpage>1047</fpage>
            <lpage>1054</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2212537</pubid>
                  <pubid idtype="pmpid" link="fulltext">9743523</pubid>
                  <pubid idtype="doi">10.1084/jem.188.6.1047</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Cytotoxic T-lymphocyte response to cytomegalovirus after human allogeneic bone marrow transplantation: pattern of recovery and correlation with cytomegalovirus infection and disease</p>
            </title>
            <aug>
               <au>
                  <snm>Reusser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Riddell</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Meyers</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Greenberg</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1991</pubdate>
            <volume>78</volume>
            <fpage>1373</fpage>
            <lpage>1380</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1652311</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor</p>
            </title>
            <aug>
               <au>
                  <snm>Walter</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Greenberg</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Gilbert</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Finch</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Riddell</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>1995</pubdate>
            <volume>333</volume>
            <fpage>1038</fpage>
            <lpage>1044</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJM199510193331603</pubid>
                  <pubid idtype="pmpid" link="fulltext">7675046</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>The immunogenicity of human and murine cytomegaloviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Reddehase</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Curr Opin Immunol</source>
            <pubdate>2000</pubdate>
            <volume>12</volume>
            <fpage>390</fpage>
            <lpage>396</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0952-7915(00)00106-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">10899017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Cytomegalovirus seropositivity drives the CD8 T cell repertoire toward greater clonality in healthy elderly individuals</p>
            </title>
            <aug>
               <au>
                  <snm>Khan</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Shariff</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cobbold</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bruton</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ainsworth</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Sinclair</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Nayak</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Moss</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2002</pubdate>
            <volume>169</volume>
            <fpage>1984</fpage>
            <lpage>92</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12165524</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Memory CD8+ T cells vary in differentiation phenotype in different persistent virus infections</p>
            </title>
            <aug>
               <au>
                  <snm>Appay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Dunbar</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Callan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Klenerman</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Papagno</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ogg</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lechner</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Spina</snm>
                  <fnm>CA</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nat Med</source>
            <pubdate>2002</pubdate>
            <volume>8</volume>
            <fpage>379</fpage>
            <lpage>385</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm0402-379</pubid>
                  <pubid idtype="pmpid" link="fulltext">11927944</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Functional heterogeneity and high frequencies of cytomegalovirus-specific CD8(+) T lymphocytes in healthy seropositive donors</p>
            </title>
            <aug>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Wills</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Appay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>O'Callaghan</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rowland-Jones</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Moss</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2000</pubdate>
            <volume>74</volume>
            <fpage>8140</fpage>
            <lpage>8150</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">112348</pubid>
                  <pubid idtype="pmpid" link="fulltext">10933725</pubid>
                  <pubid idtype="doi">10.1128/JVI.74.17.8140-8150.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Long-term cytomegalovirus infection leads to significant changes in the composition of the CD8+ T-cell repertoire, which may be the basis for an imbalance in the cytokine production profile in elderly persons</p>
            </title>
            <aug>
               <au>
                  <snm>Almanzar</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Schwaiger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jenewein</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Keller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herndler-Brandstetter</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wurzner</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schonitzer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Grubeck-Loebenstein</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2005</pubdate>
            <volume>79</volume>
            <fpage>3675</fpage>
            <lpage>3683</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1075718</pubid>
                  <pubid idtype="pmpid" link="fulltext">15731261</pubid>
                  <pubid idtype="doi">10.1128/JVI.79.6.3675-3683.2005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>High frequency of cytomegalovirus-specific cytotoxic T-effector cells in HLA-A*0201-positive subjects during multiple viral coinfections</p>
            </title>
            <aug>
               <au>
                  <snm>Jin</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Demoitie</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Donahoe</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Ogg</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Bonhoeffer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kakimoto</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Moss</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Dyer</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kurilla</snm>
                  <fnm>MG</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2000</pubdate>
            <volume>181</volume>
            <fpage>165</fpage>
            <lpage>175</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/315201</pubid>
                  <pubid idtype="pmpid" link="fulltext">10608763</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Human CD28-CD8+ T cells contain greatly expanded functional virus-specific memory CTL clones</p>
            </title>
            <aug>
               <au>
                  <snm>Weekes</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Carmichael</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Wills</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Mynard</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1999</pubdate>
            <volume>162</volume>
            <fpage>7569</fpage>
            <lpage>7577</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10358214</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Herpesvirus-specific CD8 T cell immunity in old age: cytomegalovirus impairs the response to a coresident EBV infection</p>
            </title>
            <aug>
               <au>
                  <snm>Khan</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hislop</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gudgeon</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cobbold</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khanna</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nayak</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Rickinson</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Moss</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2004</pubdate>
            <volume>173</volume>
            <fpage>7481</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15585874</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Inflamm-aging. An evolutionary perspective on immunosenescence</p>
            </title>
            <aug>
               <au>
                  <snm>Franceschi</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bonafe</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Valensin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Olivieri</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>De</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Ottaviani</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>De</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Ann N Y Acad Sci</source>
            <pubdate>2000</pubdate>
            <volume>908</volume>
            <fpage>244</fpage>
            <lpage>254</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10911963</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>How chronic inflammation can affect the brain and support the development of Alzheimer's disease in old age: the role of microglia and astrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Blasko</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Stampfer-Kountchev</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Robatscher</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Veerhuis</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Eikelenboom</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Grubeck-Loebenstein</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Aging Cell</source>
            <pubdate>2004</pubdate>
            <volume>3</volume>
            <fpage>169</fpage>
            <lpage>176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1474-9728.2004.00101.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15268750</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Age-related change in peripheral blood T-lymphocyte subpopulations and cytomegalovirus infection in the very old: the Swedish longitudinal OCTO immune study</p>
            </title>
            <aug>
               <au>
                  <snm>Olsson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wikby</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Johansson</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lofgren</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nilsson</snm>
                  <fnm>BO</fnm>
               </au>
               <au>
                  <snm>Ferguson</snm>
                  <fnm>FG</fnm>
               </au>
            </aug>
            <source>Mech Ageing Dev</source>
            <pubdate>2000</pubdate>
            <volume>121</volume>
            <fpage>187</fpage>
            <lpage>201</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0047-6374(00)00210-4</pubid>
                  <pubid idtype="pmpid">11164473</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Expansions of peripheral blood CD8 T-lymphocyte subpopulations and an association with cytomegalovirus seropositivity in the elderly: the Swedish NONA immune study</p>
            </title>
            <aug>
               <au>
                  <snm>Wikby</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Johansson</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Olsson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lofgren</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nilsson</snm>
                  <fnm>BO</fnm>
               </au>
               <au>
                  <snm>Ferguson</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Exp Gerontol</source>
            <pubdate>2002</pubdate>
            <volume>37</volume>
            <fpage>445</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0531-5565(01)00212-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">11772532</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL</p>
            </title>
            <aug>
               <au>
                  <snm>Wills</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Carmichael</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Mynard</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Weekes</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Plachter</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1996</pubdate>
            <volume>70</volume>
            <fpage>7569</fpage>
            <lpage>7579</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">190825</pubid>
                  <pubid idtype="pmpid" link="fulltext">8892876</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Recognition of human cytomegalovirus gene products by HCMV-specific cytotoxic T cells</p>
            </title>
            <aug>
               <au>
                  <snm>Boppana</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Britt</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1996</pubdate>
            <volume>222</volume>
            <fpage>293</fpage>
            <lpage>296</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1996.0424</pubid>
                  <pubid idtype="pmpid" link="fulltext">8806513</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Lack of antibody production following immunization in old age: association with CD8(+)CD28(-) T cell clonal expansions and an imbalance in the production of Th1 and Th2 cytokines</p>
            </title>
            <aug>
               <au>
                  <snm>Saurwein-Teissl</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lung</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Marx</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gschosser</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Asch</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Blasko</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Parson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bock</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Schonitzer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Trannoy</snm>
                  <fnm>E</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Immunol</source>
            <pubdate>2002</pubdate>
            <volume>168</volume>
            <fpage>5893</fpage>
            <lpage>5899</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12023394</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>CD25-expressing CD8+ T cells are potent memory cells in old age</p>
            </title>
            <aug>
               <au>
                  <snm>Herndler-Brandstetter</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schwaiger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Veel</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fehrer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cioca</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Almanzar</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Keller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pfister</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Parson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wurzner</snm>
                  <fnm>R</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>175</volume>
            <fpage>1566</fpage>
            <lpage>1574</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16034095</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Rapid CD8+ T cell repertoire focusing and selection of high-affinity clones into memory following primary infection with a persistent human virus: human cytomegalovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Day</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Carmichael</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>ten</snm>
                  <fnm>BI</fnm>
               </au>
               <au>
                  <snm>Waller</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Wills</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2007</pubdate>
            <volume>179</volume>
            <fpage>3203</fpage>
            <lpage>3213</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17709536</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Characterization of human cytomegalovirus peptide-specific CD8(+) T-cell repertoire diversity following in vitro restimulation by antigen-pulsed dendritic cells</p>
            </title>
            <aug>
               <au>
                  <snm>Peggs</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Verfuerth</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pizzey</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ainsworth</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Moss</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mackinnon</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>213</fpage>
            <lpage>223</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood.V99.1.213</pubid>
                  <pubid idtype="pmpid" link="fulltext">11756174</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Characterization of antigen-specific repertoire diversity following in vitro restimulation by a recombinant adenovirus expressing human cytomegalovirus pp65</p>
            </title>
            <aug>
               <au>
                  <snm>Hamel</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Rohrlich</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Baron</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bonhomme</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rieux-Laucat</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Necker</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lemonnier</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ferradini</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cavazzana-Calvo</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Eur J Immunol</source>
            <pubdate>2003</pubdate>
            <volume>33</volume>
            <fpage>760</fpage>
            <lpage>768</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/eji.200323628</pubid>
                  <pubid idtype="pmpid" link="fulltext">12616496</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Selection of T cell clones expressing high-affinity public TCRs within Human cytomegalovirus-specific CD8 T cell responses</p>
            </title>
            <aug>
               <au>
                  <snm>Trautmann</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Rimbert</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Echasserieau</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Saulquin</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Neveu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Dechanet</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cerundolo</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bonneville</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>175</volume>
            <fpage>6123</fpage>
            <lpage>6132</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16237109</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The memory cytotoxic T-lymphocyte (CTL) response to human cytomegalovirus infection contains individual peptide-specific CTL clones that have undergone extensive expansion in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Weekes</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Wills</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Mynard</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Carmichael</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1999</pubdate>
            <volume>73</volume>
            <fpage>2099</fpage>
            <lpage>2108</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">104454</pubid>
                  <pubid idtype="pmpid" link="fulltext">9971792</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses</p>
            </title>
            <aug>
               <au>
                  <snm>Price</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Brenchley</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Ruff</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Betts</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Roederer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Koup</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Migueles</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Gostick</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wooldridge</snm>
                  <fnm>L</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Exp Med</source>
            <pubdate>2005</pubdate>
            <volume>202</volume>
            <fpage>1349</fpage>
            <lpage>1361</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2212993</pubid>
                  <pubid idtype="pmpid" link="fulltext">16287711</pubid>
                  <pubid idtype="doi">10.1084/jem.20051357</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>High-avidity CTL exploit two complementary mechanisms to provide better protection against viral infection than low-avidity CTL</p>
            </title>
            <aug>
               <au>
                  <snm>Derby</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>exander-Miller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tse</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Berzofsky</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2001</pubdate>
            <volume>166</volume>
            <fpage>1690</fpage>
            <lpage>1697</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11160212</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Protective immunity does not correlate with the hierarchy of virus-specific cytotoxic T cell responses to naturally processed peptides</p>
            </title>
            <aug>
               <au>
                  <snm>Gallimore</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dumrese</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hengartner</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zinkernagel</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Rammensee</snm>
                  <fnm>HG</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>1998</pubdate>
            <volume>187</volume>
            <fpage>1647</fpage>
            <lpage>1657</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2212291</pubid>
                  <pubid idtype="pmpid" link="fulltext">9584143</pubid>
                  <pubid idtype="doi">10.1084/jem.187.10.1647</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>In vivo induction of a high-avidity, high-frequency cytotoxic T-lymphocyte response is associated with antiviral protective immunity</p>
            </title>
            <aug>
               <au>
                  <snm>Sedlik</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dadaglio</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Saron</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Deriaud</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Rojas</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Casal</snm>
                  <fnm>SI</fnm>
               </au>
               <au>
                  <snm>Leclerc</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>2000</pubdate>
            <volume>74</volume>
            <fpage>5769</fpage>
            <lpage>5775</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">112070</pubid>
                  <pubid idtype="pmpid" link="fulltext">10846055</pubid>
                  <pubid idtype="doi">10.1128/JVI.74.13.5769-5775.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Selective expansion of high- or low-avidity cytotoxic T lymphocytes and efficacy for adoptive immunotherapy</p>
            </title>
            <aug>
               <au>
                  <snm>Alexander-Miller</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Leggatt</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Berzofsky</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <fpage>4102</fpage>
            <lpage>4107</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">39494</pubid>
                  <pubid idtype="pmpid" link="fulltext">8633023</pubid>
                  <pubid idtype="doi">10.1073/pnas.93.9.4102</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Isolation of high avidity melanoma-reactive CTL from heterogeneous populations using peptide-MHC tetramers</p>
            </title>
            <aug>
               <au>
                  <snm>Yee</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Savage</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>PP</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Greenberg</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1999</pubdate>
            <volume>162</volume>
            <fpage>2227</fpage>
            <lpage>2234</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9973498</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>High avidity CTLs for two self-antigens demonstrate superior in vitro and in vivo antitumor efficacy</p>
            </title>
            <aug>
               <au>
                  <snm>Zeh</snm>
                  <fnm>HJ</fnm>
                  <suf>III</suf>
               </au>
               <au>
                  <snm>Perry-Lalley</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dudley</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Rosenberg</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1999</pubdate>
            <volume>162</volume>
            <fpage>989</fpage>
            <lpage>994</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9916724</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Antimelanoma activity of CTL generated from peripheral blood mononuclear cells after stimulation with autologous dendritic cells pulsed with melanoma gp100 peptide G209-2M is correlated to TCR avidity</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Linette</snm>
                  <fnm>GP</fnm>
               </au>
               <au>
                  <snm>Longerich</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Haluska</snm>
                  <fnm>FG</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2002</pubdate>
            <volume>169</volume>
            <fpage>531</fpage>
            <lpage>539</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12077285</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Cellular immunotherapy for viral infection after HSC transplantation</p>
            </title>
            <aug>
               <au>
                  <snm>Moss</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rickinson</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nat Rev Immunol</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>9</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nri1526</pubid>
                  <pubid idtype="pmpid" link="fulltext">15630425</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Biology of immune responses to vaccines in elderly persons</p>
            </title>
            <aug>
               <au>
                  <snm>Weinberger</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Herndler-Brandstetter</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schwanninger</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Weiskopf</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Grubeck-Loebenstein</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2008</pubdate>
            <volume>46</volume>
            <fpage>1078</fpage>
            <lpage>1084</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/529197</pubid>
                  <pubid idtype="pmpid" link="fulltext">18444828</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Association between cytomegalovirus infection, enhanced proinflammatory response and low level of anti-hemagglutinins during the anti-influenza vaccination&#8211;an impact of immunosenescence</p>
            </title>
            <aug>
               <au>
                  <snm>Trzonkowski</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mysliwska</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Szmit</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wieckiewicz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lukaszuk</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Brydak</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Machala</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mysliwski</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Vaccine</source>
            <pubdate>2003</pubdate>
            <volume>21</volume>
            <fpage>3826</fpage>
            <lpage>3836</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0264-410X(03)00309-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12922116</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Chronic cytomegalovirus infection and inflammation are associated with prevalent frailty in community-dwelling older women</p>
            </title>
            <aug>
               <au>
                  <snm>Schmaltz</snm>
                  <fnm>HN</fnm>
               </au>
               <au>
                  <snm>Fried</snm>
                  <fnm>LP</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>QL</fnm>
               </au>
               <au>
                  <snm>Walston</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leng</snm>
                  <fnm>SX</fnm>
               </au>
               <au>
                  <snm>Semba</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>J Am Geriatr Soc</source>
            <pubdate>2005</pubdate>
            <volume>53</volume>
            <fpage>747</fpage>
            <lpage>754</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1532-5415.2005.53250.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15877548</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
