Phylogenetic analysis indicated that env sequences (C1-V2 region) for all clones from each patient clustered together along with the consensus sequence obtained for bulk envelope sequences amplified directly from plasma by RT-PCR (Fig. 1). Viruses with both R5 and X4 tropism (see below) were isolated from 4 patients. For patients 1 and 2, sequences for viruses with R5 tropism appeared to be phylogenetically distinct from those of viruses with X4 (patient 2) or dual (patient 1) tropism, and the sequence diversity among viruses with similar tropism was lower than that of the entire viral population. In contrast, for patients 4 and 5, envelope sequences in the V1-V2 region for viruses with R5 tropism were not segregated from those of viruses with X4 (patient 4) or dual (patient 5) tropism. For patient 2, the consensus env sequence for plasma viruses clustered with the sequences of viruses with X4 tropism at month 26, but clustered with the sequences of viruses with R5 tropism at month 34.

The nucleotide diversity of env sequences extending from V1 to the middle of V4, calculated by the method of Tajima-Nei, ranged from 0.018 – 0.060, values typical of those obtained for sequences amplified from plasma by RT-PCR. The greatest diversity was observed for patient 3, despite that all viruses from this patient showed strict R5 tropism.

To explore the functional capacities of Env proteins expressed by these clonal viruses, we generated recombinant reporter viruses in which the env sequence (gp120 + the extracellular domain of gp41) was derived from the different clonal viruses, and evaluated the ability of these luciferase-expressing viruses to infect U373 cells stably expressing CD4 and either CCR5 or CXCR4 co-receptors. All of the 70 recombinant viruses were infectious (Fig. 2). Viruses with strict R5 tropism were identified in all patients (n = 53), but clones with R5X4 tropism (n = 5) and/or strict X4 tropism (n = 12) were also identified in 4 of the 5 patients studied. The infectivity of dual-tropic viruses tended to be similar in the U373-R5 and U373-X4 target cells (compare gray symbols in Figs. 2A and 2B). Without exception, the infectivity of clones with R5 tropism was at least 5-fold lower than the infectivity of recombinant viruses carrying the Env from the laboratory-adapted strain NL-AD8 [mean infectivity in U373-R5 cells: 22524 (RLU/sec)/(ng p24/ml)]. The infectivity of some clones with X4 tropism was equivalent to that observed for recombinant viruses carrying the Env from pNL4-3 [mean infectivity in U373-X4 cells: 2650 (RLU/sec)/(ng p24/ml)].

Considerable variability was observed in the infectivity of viruses carrying different env sequences from the same patient. When U373-R5 cells were used as targets, the difference in infectivity between the most and least infectious viruses from each of the 5 patients averaged 1.0 ± 0.26 log₁₀ (range 0.8 – 1.3 log₁₀ difference). Some inter-patient variability in infectivity was also observed. When considered as a group, no significant differences in the infectivity of clones carrying Env proteins from patients 1–4 were observed, but the infectivity of clones from each of these patients was significantly greater than that of clones from patient 5 (p < 0.05 for all comparisons).

The intracellular portion of gp41 is known to interact with Gag. To avoid potential incompatibilities between these viral proteins 4344, we initially evaluated the infectivity of recombinant viruses in which both the intracellular portion of gp41 and Gag were derived from the pNL4-3 viral strain. Changes in the intracellular domain of gp41, however, have also been reported to influence Env function 45464748, and it was important to evaluate the possibility that incompatibilities between the extracellular domains of Env in some of the viruses and the intracellular domain of gp41 from pNL4-3 contributed to the wide range of infectivities observed. To do so, we compared the infectivity of selected recombinant viruses in which the intracellular domain of gp41 was derived either from pNL4-3 or from the primary viral isolate. As shown in Fig. 3, the infectivities of the two constructs were strongly correlated (Spearman r = 0.86; p < 0.0001). Viruses that demonstrated relatively poor infectivity when the intracellular domain of gp41 was derived from pNL4-3 did not show improved infectivity when the homologous intracellular domain of gp41 was used (e.g., the viruses with Env from patient 5 and the least infectious virus from patient 4). Indeed, the use of the homologous intracellular domain of gp41 led to a moderate loss in infectivity for the viruses from patient 4 and some viruses from patient 5, consistent with the possibility that incompatibilities existed in these cases between the gp41 sequences and the gag protein from pNL4-3.

For all 70 recombinant viruses, the amount of luciferase activity resulting from infection of U373 cells was greater than that seen after infection of MT4-R5 cells. For each patient, a significant correlation was observed between the infectivity of viruses with R5-exclusive tropism for U373-R5 and MT4-R5 target cells (p < 0.05 for all comparisons). As was observed when U373 cells were used as targets, viruses carrying different env sequences from the same patient showed considerable variability in infectivity when MT4-R5 cells were infected (Fig. 4A). The difference in infectivity between the most and least infectious R5 viruses from each of the 5 patients averaged 1.2 ± 0.31 log₁₀ (range 0.8 – 1.5 log₁₀ difference). As indicated above, the infectivity of viruses from patient 5 were strikingly lower than that of viruses from other patients when U373-R5 cells were used as targets. This difference was less striking when MT4-R5 cells were infected (compare Figs. 2A and 4A), although the infectivity of R5 viruses from patient 5 remained significantly lower than that of R5 viruses from patients 2 and 3 (p < 0.05 for both comparisons).

Interestingly, considerable variability was observed when luciferase activity obtained following infection of the two cell types was expressed as a ratio (Fig. 4B). This ratio did not correlate with the infectivity of the viruses for U373 cells (Spearman r = 0.10, p = 0.49), but only viruses with relatively low infectivity for MT4-R5 cells [i.e., <110 (RLU/sec)/(ng p24/ml)] had values for this ratio that were greater than 20 (Fig. 5). The level of expression of both CD4 and CCR5 was approximately two-fold higher on U373-R5 cells than on MT4-R5 cells (Fig. 6). Thus, a possible explanation for these observations is that the infectivity of viruses for which a high ratio was observed are particularly sensitive to the levels of expression of CD4 and/or co-receptor, although other differences between U373-R5 cells and MT4-R5 cells may also influence the ability of viruses carrying different envelopes to infect these cell types.

It is noteworthy that the proportion of viruses with a relatively high infectivity ratio was different in different patients. The infectivity ratios of clones from patients 1, 3 and 4 were significantly greater than that of patient 2 (p < 0.001, p < 0.001 and p < 0.05, respectively), and the infectivity ratio of clones from patient 3 was also significantly greater than that of patient 5 (p < 0.05).

In parallel with studies evaluating the infectivity of recombinant viruses carrying env sequences derived from clonal viruses, we evaluated the infectivity of recombinant viruses expressing env sequences amplified by RT-PCR from viral RNA extracted from the same plasma specimen from which the clonal viruses had been derived. The infectivity of viruses carrying plasma-derived env sequences for U373-R5 cells, although detectable in all cases except patient 2, was generally low, and was less than that of the clonal viruses from the same patient, usually by a substantial margin (Fig. 2A). The infectivity of viruses expressing plasma-derived env sequences for U373-X4 cells was detectable in only two samples (Fig. 2B). In both of these cases (patient 2, M26 and patient 4), clonal viruses with X4 exclusive tropism had been identified. The failure to detect infectivity of viruses carrying plasma-derived env sequences in other samples from which clonal viruses with strict X4 or dual tropism were identified may reflect the somewhat lower infectivity of the viruses with X4 tropism (e.g., patient 2, M34 and patient 5) and/or a lower proportion of viruses with X4 tropism in the sample (e.g., patient 1). As was observed for viruses carrying env sequences derived from clonal viruses, the infectivity of viruses carrying plasma-derived env sequences for MT4-R5 cells was usually reduced compared to that observed for U373 cells (Fig. 4A). Indeed, for patients 1 and 5, low level infectivity was detected toward U373-R5 cells, but infectivity was below detection when MT4-R5 cells were targeted.

Because the infectivity of clonal viruses carrying different env sequences from a given patient varied over a wide range, these viruses were useful in exploring the possible relationship between infectivity and sensitivity to inhibition by entry inhibitors. To do so, clonal viruses with R5-tropism that exhibited a spectrum of infectivities towards U373-R5 cells and/or MT4-R5 cells were selected from 4 of the patients (Figs. 7A and 7B). For each of these 20 viruses, the IC50s were determined on U373-R5 target cells for two entry inhibitors (enfuvirtide and TAK-799), soluble CD4, and neutralizing monoclonal antibodies recognizing either gp120 (2G12, 48d) or gp41 (2F5). No significant correlations were observed between the IC50s of these six inhibitors and the infectivity of the clonal viruses for either U373-R5 cells or MT4-R5 cells (data not shown, p > 0.09 for all Spearman correlations).

Viruses from different patients did, however, demonstrate differential sensitivity to these entry inhibitors, independent of infectivity (Fig. 7). Thus, significant differences in the median sensitivity to entry inhibitors by clonal viruses from different patients was observed by ANOVA for all entry inhibitors except TAK-799 (p values for Kruskal-Wallis test: p < 0.001 – 0.05), and for each of these inhibitors, significant differences in were also identified in pair-wise comparisons of IC50s for viruses from different patients (Fig. 7).

Nucleotide sequences for env extending from the signal peptide to mid C4 region were available for all clones. The PSSM score developed by Jensen et al. 49 correctly distinguished all clones with R5-exclusive tropism and X4-exclusive tropism, even though viruses from two of the patients were non-B subtypes. Three of the 6 Env proteins with dual tropism, however, were predicted to exhibit R5-exclusive tropism (one clone each from patients 1, 2 and 5). The amino acid sequence of the V3 region of these dual-tropic clones from patients 1 and 2 differed at 6 and 1 positions, respectively, compared to that of the most similar R5-tropic Env identified in that patient, and these differences may explain the change in tropism. The V3 region of the misidentified dual-tropic envelope sequence from patient 5, however, was identical to that of other Env with R5-exclusive tropism, indicating that sequences outside V3 influenced the tropism of this Env.

In general, viruses with strict R5-tropism from the same individual expressed a relatively small number of haplotypes within a given variable (V) region. For example, the number of distinct haplotypes identified for the V3 region ranged from 1 (patient 1) to 4 (patient 2). Significant differences in the infectivity of R5-tropic viruses as a function of haplotype were observed for the variable regions 2 and 3 (V2 and V3) of patient 2 (p < 0.02 and p < 0.03 respectively using the Kruskal-Wallis test). As shown in Fig. 8, the viruses from this patient expressing V3 region haplotypes 2 and 3 were significantly less infectious than those expressing haplotype 1 (p < 0.01 using the Mann-Whitney test), and viruses expressing the V2 region haplotype 4 were less infectious than those expressing the V2 region haplotypes 1 – 3 (p < 0.001). Most of the viruses expressing the V2 haplotype associated with low infectivity (haplotype 4) also expressed V3 haplotypes associated with low infectivity. However, one of the viruses expressed this V2 haplotype in association with the V3 haplotype 1, which was usually associated with good infectivity (red arrow in Fig. 8A). The infectivity of this virus was, nevertheless, low (red arrow in Fig. 8B), suggesting that expression of the V2 haplotype 4 was a major determinant for low infectivity in this patient. It is noteworthy that clones from patient 2 expressing the V2 haplotype 4 were obtained only from the plasma sample obtained at month 34, and 9/13 clones with R5-tropism isolated at this time point expressed this V2 haplotype.

No significant associations between infectivity and haplotype were observed for the variable regions expressed by the other patients, and no association between infectivity and the haplotypes in the constant regions were identified. One factor that could confound such analyses is the presence of deleterious mutations elsewhere in the envelope sequence. In this regard, we found that four of the 53 viruses with strict R5 tropism had V3 sequences containing a single amino acid polymorphism not seen in any other sequence from that patient. The recombinant viruses carrying 3 of these unique V3 polymorphisms had the lowest infectivity for U373-R5 cells of any virus evaluated from that sample.

Clonal viral populations were obtained from five patients chronically infected with HIV-1. Clinical information of these patients is summarized in Table 1. All patients were evaluated at the Hôpital Bichat – Claude Bernard, and informed consent was obtained prior to participation in the study. Three of the patients were not receiving treatment with antiretroviral drugs at the time of initial evaluation (patients 1–3). Patient 1 had never been treated. Patient 2 had received intermittent treatment with several regimens containing nucleoside analog reverse transcriptase (RT) inhibitors and protease inhibitors over a two year period, but had discontinued therapy 2 months before evaluation. Patient 3 had been treated for 1 year with AZT+3TC+efavirenz, but treatment had been discontinued for 3 years prior to evaluation. Patients 4 and 5 had a ≥ 2 year history of treatment failure. Both had been treated initially with nucleoside analog RT inhibitors, and subsequently received regimens also including non-nucleoside RT inhibitors, protease inhibitors and/or enfuvirtide in various combinations, but plasma virus had never become undetectable. Neither patient had received antiviral agents that target viral entry for at least 1 year prior to evaluation. For patient 2, clonal viral populations were obtained from two different plasma samples obtained eight months apart.

Clonal viral populations were obtained as previously described 4142. Briefly, MT4-R5 cells, expressing CCR5 and CXCR4 receptors, were resuspended at 2 × 10⁶ cells/ml in complete medium containing 1% (v/v) DMSO, and 0.25 ml aliquots were distributed in 24-well plates. An equal volume of plasma, diluted in complete medium containing (final concentration) 1% DMSO and 2 μg/ml DEAE-dextran, was added to each well. The plates were centrifuged (860 xg; 2 hours; 22°C), and cultured for 4 hours at 37°C to permit viral entry. Cells were recovered, washed once, and 200 μl aliquots containing 2 × 10⁴ cells were distributed into 96-well plates. The cultures were maintained at 37°C in 5% CO₂, and were passaged with a 1:10 dilution every 7 days. Cultures were inspected by light microscopy, and when patent cytopathic changes were observed, the culture supernatant and the cell pellet from infected wells were recovered separately and frozen at -80°C. If viral replication was observed in >20% of the wells, the experiment was repeated after further dilution of the plasma. The days in culture at which the clones from different patients emerged is shown in Table 1. Seventy-five percent of all clones had emerged by day 24.

Findings in this and our prior studies 4142 supported the conclusion that viral evolution was not occurring during culture. In control experiments, pNL4-3-derived viruses containing protease mutations that substantially impaired viral fitness (replicative capacity 10–20% of wild-type virus) were used in our protocol to generate clonal viruses, and the protease region from 36 different clones was sequenced. Without exception, these sequences were identical to the original plasmid (14,256 bases) and no evidence of reversion of the deleterious mutations was observed, despite that reversion of any of the mutations would have substantially improved fitness. In addition, proviral DNA (including env) was amplified and sequenced for every clone used in our study, and without exception, no ambiguous bases were identified. The absence of detectable polymorphisms is consistent with the interpretation that variants were not emerging during culture to the extent that their presence was detectable by bulk sequencing (i.e., >10%).

We have previously described a pNL4-3-derived proviral vector in which the env sequence coding for most of gp120 and the ectodomain of gp41 (nucleotides 6480 to 8263) has been deleted and replaced by a linker sequence containing a unique MluI restriction site 34. To create a similar vector expressing Renilla luciferase in place of Nef, the BamHI – NcoI fragment was removed, and the remaining fragment was ligated with the BamHI – KpnI fragment from pTN7-NL 63 and the KpnI – NcoI fragment from pNL4-3, creating (pNL4-3-ΔectoENV-lucR). An analogous proviral vector was also constructed in which all of the env sequence except for that coding the 13 N-terminal amino acids of gp120 and the 29 C-terminal amino acids of gp41 (nucleotides 6344–8691) has been deleted and replaced by a linker sequence containing a unique NheI restriction site (pNL4-3-ΔENV-lucR).

DNA was extracted from the infected cell pellets using a QIAamp Viral DNA mini kit (Qiagen, Valencia, CA), resuspended in 100 μl of 10 mM Tris buffer containing 1 mM EDTA, and used as a template to amplify env fragments. To amplify the 2.2 kb fragment that spans the env region deleted from the pNL4-3-ΔectoENV-lucR vector and also containing 147 bp (N-terminal) and 258 bp (C-terminal) extensions to allow homologous recombination with this vector, reactions (50 μl) contained 2 μl DNA, 200 μM each dNTPs, 1.5 mM Mg²⁺, 0.5 μM each oligonucleotides E5 (5'-GTCTATTATGGGGTACCTGTGTGGA) and FuB (5'-GGTGGTAGCTGAAGAGGCACAGG), 1U Phusion hot start DNA polymerase (Finnzymes, Espoo, Finland), and 1X Phusion HF reaction buffer. Cycling conditions were as follows: 98°C for 30 sec, followed by 5 cycles at 98°C for 5 sec, 72°C for 5 sec and 72°C for 90 sec each; 5 cycles at 98°C for 5 sec, 70°C for 5 sec and 72°C for 90 sec each; 30 cycles at 98°C for 5 sec, 68°C for 20 sec and 72°C for 90 sec each; with a final step at 72°C for 10 min. PCR products were purified by QIAquick PCR Purification Kit (Qiagen). Aliquots of the purified DNA was electrophoresed into agarose gels and stained with ethidium bromide to verifiy that a single band of appropriate size had been amplified and to permit quantification of the product. The 2.6 kb fragment that spans the env region deleted from the pNL4-3-ΔENV-lucR vector and also comprises 143 bp (N-terminal) and 104 bp (C-terminal) extensions to allow homologous recombination with this vector was amplified using similar conditions, except that oligonucleotides EB1 (5'GAAAGAGCAGAAGACAGTGGCAATGA) and EB2 (5'-ACTTGCCACCCATCTTATAGCAAA) were used, and cycling conditions were: 98°C for 30 sec, followed by 40 cycles at 98°C for 5 sec, 70°C for 20 sec and 72°C for 90 sec each; and a final step at 72°C for 10 min.

To amplify env sequences present in plasma, RNA was isolated from plasma using a QIAamp RNA Blood Mini Kit (Qiagen), and cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA) and random hexamer primers. Env sequences were amplified in a single reaction using the protocol described above.

293T cells and U373-CD4 cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum, 100 U/ml penicillin G and 100 μg/ml streptomycin (complete medium). MT4-R5 cells were cultured in similarly supplemented RPMI-1640 medium. For U373-CD4 cells stably expressing CCR5 or CXCR4 64, medium also contained 10 μg/ml puromycin and 100 μg/ml hygromycin B.

The techniques used to produce recombinant viruses have previously been described 346566. Briefly, 293T cells that had been grown to 80% confluency in T25 flasks were co-transfected with 8 μg of MluI-linearized pNL4-3-ΔectoENV-lucR vector (or NheI-linearized pNL4-3-ΔENV-lucR vector) and 1 μg of the corresponding PCR product using the calcium phosphate precipitation method, and cultured in 3 ml of complete medium. After 18 h, cells were washed with phosphate-buffered saline (PBS) and culture medium was replaced. Forty-four h after transfection culture medium was recovered and centrifuged (800 xg; 10 min), and p24 antigen present in the supernatant was measured using an enzyme-linked immunosorbent assay (Innotest HIV antigen mAB, Innogenetics, Gent, Belgium).

The infectivity of recombinant viruses for different target cell types was determined by measuring luciferase activity. To do so, target cells were plated in black-wall, clear bottom 96-well plates (Greiner, Courtaboeuf, France). U373 cells were plated at 2 × 10³ cells/well 48 h prior to infection; MT4-R5 cells were plated at 5 × 10⁴ cells/well on the day of infection. Medium was removed and replaced with 60 μl of complete medium containing serial two-fold dilutions of freshly harvested supernatants from transfected cells containing 0.069 – 50 ng p24/ml. Forty-four hours after infection, 20 μl of 4X luciferase lysis buffer (Renilla luciferase assay system, Promega, Charbonnières, France) was added to each well, and plates were maintained at room temperature for 30 min. Wells were sequentially injected with 100 μl of luciferase substrate (Promega), and 3 seconds later, light emission (relative light units, RLU) was measured over a two sec interval using a Microlumat LB96P luminometer (Berthold, Oak Ridge, TN). Each sample was evaluated in triplicate. RLU were plotted as a function of amount of p24 used to infect the cells, and infectivity was defined as the slope [(RLU/sec)/(ng p24/ml)] as determined by linear regression; in this analysis, each replicate RLU value was treated as an individual point.

In preliminary experiments, we compared the infectivity of viruses obtained after transfection of 293T cells with proviral plasmids, and viruses created by recombination between env sequences amplified from the same plasmid and the pNL4-3-derived ΔEnv vector according to our protocol. The infectivity of the viruses produced through recombination was 89 ± 37% (mean ± SD; n = 5) of that observed for viruses obtained directly by transfection (p > 0.2 by paired t-test).

For each viral Env protein studied, infectivity was determined for each cell type in at least three independent experiments. Infection was considered undetectable if the RLU observed for the highest concentration of p24 evaluated was less than 500 RLU/sec (i.e., infectivity <2 (RLU/sec)/(ng p24/ml). The mean coefficient of variation for clonal Env proteins with detectable infectivity was as follows: U373-R5 cells (n = 58), 42%; U373-X4 cells (n = 17), 50%; MT4-R5 cells (n = 70), 37%.

To measure the susceptibility of recombinant viruses to inhibition by enfuvirtide and TAK-799, U373-R5 cells were plated at a density of 6 × 10³ cells/well as described above, and infected with the same dose of recombinant virus in the absence or the presence of increasing concentrations of enfuvirtide (1.6 to 5,000 ng/ml; T20, American Peptide Company, Sunnyvale, CA) or TAK-799 (0.8 to 2500 nM; NIH AIDS Research and Reference Reagent Program). Forty four hours after infection, luciferase activity was measured as described above. For each virus, an amount of p24 was used that gave approximately 5 × 10⁴ RLU/second for cells infected in the absence of inhibitor. Each experimental condition was evaluated in triplicate. To determine the concentration of inhibitor required for reduce viral infectivity by 50% (IC50), data was fitted to a sigmoid dose-response curve with variable slope.

The susceptibility of recombinant viruses to inhibition by soluble CD4 (R&D Systems, Minneapolis, MN) and monoclonal antibodies 48d (human anti-gp120, NIH AIDS Research and Reference Reagent Program), 2G12 (human anti-gp120, Polymun Scientific, Vienna, Austria) and 2F5 (human anti-gp41, Polymun Scientific) was measured by similar techniques, except that recombinant viruses were preincubated for 1 h at 37°C with serial three-fold dilutions of soluble CD4 or monoclonal antibodies, before using 60 μl of the mixture to infect target cells. For each viral Env, infectivity was determined for each inhibitor cell type in at least two, and usually three independent experiments. The mean coefficient of variation for the six entry inhibitors ranged from 25% (enfuvirtide) to 64% (soluble CD4).

U373 cells were detached by incubation in PBS containing 0.8% EDTA. Cells were resuspended in PBS containing 20% human serum (1 × 10⁶ cells; 100 μl) and 10 μl of one of the following monoclonal antibodies: phycoerythrin-conjugated mouse anti-human CCR5 (clone 2D7), phycoerythrin-conjugated mouse anti-human CXCR4 (clone 12G5), FITC-conjugated mouse anti-human CD4 (clone RPA-T4), or similarly conjugated isotype-matched control antibodies (BD Biosciences, San Jose, CA). Following a 1 h incubation at 4°C, cells were washed once and analyzed using a FACSCalibur flow cytometer (BD Biosciences). Analysis was restricted to viable cells, identified on the basis of forward and 90° scatter.

Results are expressed as mean ± SD unless otherwise indicated. Comparisons between groups were performed using the Kruskal-Wallis test. Post test comparisons, performed only if p < 0.05, were made using Dunn's multiple comparison test. Correlations were evaluated using the Spearman test. Nucleotide diversity was determined using the method of Tajima and Nei 67.