To search for plant homologues of mammalian Raptor, we surveyed the completed Arabidopsis genome and found two loci that might encode proteins highly similar to Raptor at the north ends of chromosomes 3 and 5. We did not find an expressed sequence tag (EST) for the first locus (AtRaptor1A; At5g01770). However, we used the 5'-rapid amplification of cDNA ends (RACE) to establish that the locus is transcribed to an mRNA with a 5' end consistent with the predicted open reading frame (ORF) of AtRaptor1A. The AtRaptor1A protein is predicted to be 1,346 amino acids in length. The second locus (AtRaptor1B; At3g08850) was represented by a single EST (accession no. AY769948). We used 5' RACE to confirm that the EST contained the full ORF of AtRaptor1B. The AtRaptor1B locus is transcribed to a 4.8 kb mRNA containing 23 exons, and the protein is predicted to be 1,344 amino acids in length. Predicted AtRaptor1A and AtRaptor1B proteins show 80% identity over their entirety.

To determine the time of divergence between the two AtRaptor loci, we searched for Raptor homologues in available plant genome data using AtRaptor1A and AtRaptor1B as query sequences. Full-length Raptor loci were discovered in the available rice (Oryza sativa subspecies japonica) and alfalfa (Medicago truncatula) genome sequences. Using AtRaptor1B and partial cDNA sequence (where available) as guides, we determined putative protein sequences from these loci. Alignment of these sequences with AtRaptor1A, AtRaptor1B, mammalian Raptor, the budding yeast Raptor homologue KOG1 and the fission yeast Raptor homologue Mip1p showed that there is a striking degree of conservation among all Raptor homologues (Fig. 1A; for the complete alignment [see additional file 1]). AtRaptor1B and the Saccharomyces cereviseae Raptor homologue KOG1, the most divergent member included in the analysis, show 28% identity throughout their length. All plant Raptor homologues encode the

R

N

C

C

To gain insight into the function of the AtRaptor proteins, we searched for insertion alleles of each locus among the publicly available sequenced T-DNA insertion lines. Insertion mutant lines SALK_043920 and SALK_078159, with disruptions to the AtRaptor1A and AtRaptor1B loci, were obtained from the Arabidopsis Biological Resource Center (USA). Lines homozygous for each insertion (referred to as 1A -/- and 1B -/-, respectively) were identified via polymerase chain reaction (PCR), and RNA from floral buds of insertion homozygotes was used for reverse-transcriptase-PCR (RT-PCR) to assay for accumulation of wild-type transcripts from the disrupted locus. AtRaptor1A transcripts could not be detected in 1A -/- buds, but were detected in 1B -/- buds. AtRaptor1B transcripts were not detected in 1B -/- buds, but were detected in 1A -/- buds. Both transcripts were detected in wild-type Columbia (Col) buds (Fig. 2).

As a first step toward characterizing these mutant lines, Col, 1A-/- and 1B-/- seedlings were germinated on culture medium. Col and 1A-/- seedlings were phenotypically indistinguishable. However, B-/- seedlings showed distinct root growth defects: roots were thick, coiled and densely covered with hairs, and the roots had difficulty penetrating the medium (Fig. 3A). Plate-grown 1B -/- seedlings were repeatedly shorter than Col or 1A-/- seedlings. Although dark grown 1B-/- seedlings were also shorter than Col or 1A-/-, the difference in size was much less (Fig. 3B). While dark-grown etiolated seedlings grow primarily through the expansion and division of embryonic hypocotyl cells, light-grown seedlings grow primarily through the production of cells from the root apical meristem. Thus the difference in size between Col, 1A-/- and 1B-/- seedlings results primarily from a reduction in root apical meristem growth rather than a general defect in cell expansion or metabolism.

The roots of 1B-/- seedlings grown on 90° inclined plates were morphologically wild type but shorter than Col roots. When the plates were rotated to lay flat horizontally, new growth from the root apex of 1B-/- seedlings produced thick, coiled roots (though the roots were not densely covered in hairs), while the previously produced root tissue remained morphologically wild type (Fig. 3C). Only those sections of the root not in contact with the medium were hairy (Fig. 3A). Thus the root growth disturbance was a defect in growth into agar rather than in gravitropism, though in the absence of resistance, roots still grew more slowly than wild type.

Col and 1B-/- root apical meristems (RAM) were examined using bright-field microscopy (Fig. 3I). 1B-/- seedling RAMs contained all cell types present in Col RAMs but their root morphology was much more blunt; this difference appeared to be localized to the 1B-/- zone of elongation. 1B-/- root tips showed a tendency to shed their root caps, although shedding was sometimes observed in Col root tips as well.

To measure developmental defects resulting from AtRaptor insertions, we grew Col, 1A-/- and 1B-/- lines on soil, and scored their rates of leaf initiation, time to floral bud initiation, rate of cauline leaf initiation, time to flowering and number of floral shoot apices. 1B-/- plants were smaller, had a slower rate of leaf initiation, and bolted and flowered later than did Col or 1A-/- plants (Fig. 4A–C).

Mature 1B-/- plants were conspicuously bushier than Col or 1A-/- homozygotes (Fig. 5). The primary shoot apex was shorter than that of Col plants and ended prematurely in a terminal inflorescence of infertile flowers. The growth of the plant was then taken over by axillary shoots and by secondary shoots from the basal rosette.

To quantify this phenotype, Col and 1B-/- lines were grown to maturity in 16-hr days, and shoot architecture for an individual plant was scored at the shattering of the first silique. 1B-/- plants showed reduced shoot height, reduced primary stem length, increased axillary branch number and an increased number of secondary shoots compared to Col and 1A-/- plants (Fig. 5B, E). 1B-/- branch numbers, though variable, were significantly larger than those of wild type or 1A-/-. Student's t-Tests of sample pairs assuming equal variance yielded P-values of 0.0027 and 0.0004 for 1B-/- vs. Col and 1B-/- vs. 1A-/- axillary branch number, respectively, and 0.0026 and 0.0013 for 1B-/- vs. Col and 1B-/- vs. 1A-/- secondary shoot number. Axillary branch length did not differ significantly from Col values (Fig. 5F). This phenotype became more pronounced later in plant development and was more conspicuous under short days.

To confirm that the collection of phenotypes observed in the AtRaptor1B-/- homozygotes was due to the mutant 1B allele, 1B-/- plants were transformed with a construct containing the AtRaptor1B ORF and 5' UTR and driven by the AtRaptor1B promoter. Some of these transformants showed wild-type transition to bolting, shoot branching and root growth (data not shown). We conclude that the 1B-/- phenotypes described above result from homozygosity for the lesion at the AtRaptor1B locus.

A combination of in situ RNA hybridization and in silico expression analysis was used to determine the RNA accumulation pattern of AtRaptor transcripts in Arabidopsis. The AtRaptor1B cDNA sequence was used to generate an AtRaptor probe to assay transcript accumulation in the shoot tips of wild-type plants. Since AtRaptor1A and AtRaptor1B show 80% identity through the length of their transcripts, this probe likely detected expression of both loci.AtRaptor transcripts were detected throughout the shoot tip, in all organs of the differentiating floral bud, and deep into the differentiated inflorescence stem (Fig. 6A). Signal intensity faded with the distance from the shoot apex. This accumulation pattern differed from that of actin (Fig. 6B), which was more prominent in dividing cells of the apex. Notably, AtRaptor accumulation is not restricted to the primary shoot apex.

To obtain an estimate of the relative levels of AtRaptor1A and AtRaptor1B in the signal seen in Fig. 6A, AtRaptor1A and AtRaptor1B locus IDs were used to query the Genevestigator Arabidopsis thaliana Microarray Database and Analysis Toolbox 27. AtRaptor1A and AtRaptor1B accumulate in all developmental stages (Fig. 6C). However, AtRaptor1B accumulation levels are consistently fourfold higher than those of AtRaptor1A. A second analysis of accumulation by tissue rather than developmental stage produced similar results. We conclude that AtRaptor1A and AtRaptor1B show similar expression patterns.

The high degree of similarity between AtRaptor1A and AtRaptor1B led us to suspect that they may be at least partially functionally redundant. To eliminate all AtRaptor activity in a single line, 1A-/- and 1B-/- lines were crossed. No 1A-/- 1B-/- plants could be identified among the F₂ of this cross on soil. Phenotypically wild-type 1A-/- 1B+/- plants were identified via PCR using the primer pairs described in Materials and Methods and their progeny (205 seedlings) were examined on agar plates. Of these, 165 seedlings (80%) appeared wild type (Fig. 7A). It was determined by PCR that these seedlings carried a wild-type 1B allele (32/32 tested). The remaining seedlings (40/205; 20%) germinated but showed minimal postembryonic shoot meristem growth (Fig. 7A). It was determined by PCR that these seedlings were genetically 1A-/- 1B-/- (32/32 tested). This genotyping confirmed that the seedling arrest mutant phenotype co-segregated with homozygosity for the AtRaptor1B mutant allele in the AtRaptor1A mutant background. We concluded that this seedling phenotype corresponded to the 1A-/- 1B-/- double mutant.

We examined 1A-/- 1B-/- double mutant seedling roots via bright field microscopy to ascertain the extent of their post-embryonic growth defect. 1A-/- 1B-/- roots were conspicuously narrower than wild type. The columella, quiescent center, vasculature, pericycle, endodermis and cortex are present though all smaller than wild type; the outer layer of cells is difficult to identify. Further up the root, root hairs were clearly visible, indicating that the RAM had produced some mature root cell types (Fig. 7D, E).

To gain a better understanding of the double mutant shoot apical meristem (SAM) defect, Col and 1A-/- 1B-/- 7-day seedlings were fixed and coated, and their shoot apexes were observed with a scanning electron microscope. In Col seedlings, leaves 1 and 2, with trichomes, were clearly visible; primordia for leaves 3, 4 and 5 were visible under higher magnification. 1A-/- 1B-/- shoot apexes showed minimal SAM activity: leaves 1 and 2 were produced, but were smaller than wild type and did not separate to reveal any further leaf primordia (Fig. 7F, G, H, I).

In order to determine whether a plant hormone or signaling molecule could restore post-embryonic growth to these arrested seedlings, progeny of 1A-/- 1B+/- individuals were germinated on plates containing a variety of plant hormones and signaling molecules and scored for their total seedling lengths at 10 days post germination. Signaling molecules tested included the gibberellin GA3 (100 nM to 10 μM), abscisic acid (100 nM to 10 μM), the auxin 2,4-D (1 nM to 10 μM), the ethylene precursor ACC (1 μM and 10 μM), sucrose (1%) and glucose (6%). We also attempted dark treatment. None of these treatments restored wild-type SAM growth to the quarter of the progeny showing seedling arrest. 1A-/- 1B-/- seedlings did show a significant response to sucrose (Fig. 7B, C). Addition of 1% sucrose, which is a growth signaling factor as well as a carbon source 28, to the growth medium promoted growth in Col, 1A-/-, 1B-/- and 1A-/- 1B-/-. In sibling seedlings, the addition of sucrose elicited a twofold increase in seedling length; in the double mutants the increase was five-fold. Germination on 6% sucrose, which signals growth arrest in Col plants 28, yielded sibling plants 1–1.5× the size of seedlings grown on 1/2 Murashige & Skoog (MS) salts with no sucrose added. 1A-/- 1B-/- seedlings on 6% sucrose were 2.3× the length of those grown on 1/2 MS salts. A similar result was observed among 1A-/- 1B+/- progeny germinated in the dark on 1/2 MS salts plates, and the length of 1A-/- 1B-/- seedlings was increased more than 3× under these conditions. The absolute length of the double mutant seedlings was in all cases still substantially smaller that that of sibling seedlings for a given treatment, and the increase in length was largely due to hypocotyl elongation or root growth. Minimal SAM activity was observed.

The mutant lines SALK_043920 and SALK_078159, in which Agrobacterium-mediated T-DNA insertions disrupted the AtRaptor1A and AtRaptor1B loci in the Columbia (Col) genetic background, were generated by Joseph R. Ecker and the Salk Institute Genomic Analysis Laboratory (USA) and distributed by the Arabidopsis Biological Resource Center (USA) 31. Lines were genotyped using the following primers: 1Asm5 5'aaaaagtctcttagatgtagtttcagatg 3' and 1Asm3 5' attcagaatatacaatccaagcattagt 3' to identify the AtRaptor1A wild-type locus; 1Bsm5 5' ctgaccataacattctcttgtaggtaagg 3' and 1Bsm3 5' aggcctgaactctaatgaacaaactctcc 3' to identify the AtRaptor1B wild-type locus; and 1Bsm5 or 1Asm5 and pROK-737 (5' gggaattcactggccgtcgttttacaa 3') to identify the respective AtRaptor mutant alleles. Mutant lines were crossed to Col wild type plants; the AtRaptor1B mutant phenotype cosegregated with the 1B insertion allele in the F₂ population.

Plants were grown in a greenhouse with supplemental light to 16 hrs, with temperatures held at 22°C days and 17°C nights. Seeds for plate-grown seedlings were surface sterilized with 20% Chlorox, washed in H₂0, stratified for four days at 4°C and grown on 1/2× MS salts, 0.3% Phytagel under 12 hr. daylight cycles.

Buds from Col and insertion line homozygotes were snap-frozen in liquid N₂. Total RNA was extracted from 0.3 g of tissue using TRIzol Reagent (Invitrogen) according to manufacturer's instructions. Resuspended RNA was thrice treated with DNA-free™ DNase treatment (Ambion). RNA was quantified with a spectrophotometer. cDNA was generated from 2 μg of total RNA using Omniscript Reverse Transcriptase (Qiagen) and a poly-dT₁₈ primer. PCR was performed using ExTaq polymerase (Takara) in a PTC-100 thermocycler. Primer sequences were as follows: 1A+1828, 5' gctgcgtttattttggctgttattgtc 3' and 1A-2800, 5' ctaggccagccagaggagtgtgagatg 3'; 1B+1379, 5' aggccggcaaaacgatcgtaagacatt 3' and 1B-2774, 5' catcagcccagaggagccaagagg 3'. PCR cycling parameters were 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 62°C for 30 sec, and 72°C for 1 min.

EST clone RZL03b06 corresponding to the 5' end of AtRaptor1B was ordered from Kazusa DNA Research Institute and sequenced (Accession number AY769948). RNA ligase-mediated RACE was performed on total RNA extracted from bulk shoot tissues using a GeneRacer™ Kit (Invitrogen) according to manufacturer's instructions in order to confirm that RZL03b06 represented a full-length clone.

Primers were designed to amplify the region from the end of the transcript adjacent to the AtRaptor1B locus to a site within the ORF, spanning a region from 1145 bases upstream of the transcript initiation site through to the sixth exon of the AtRaptor1B transcript. Primers used and restriction sites added are as follows: 1B-8189BglII 5' agatctgaggaaccagaagaaccc 3'; 1B+5104HindIII 5' aagcttcggcggagtaggaaaac 3'. PCR was performed using ExTaq polymerase (Takara) in a PTC-100 thermocycler on Col-0 genomic DNA with the following parameters: 96°C for 5 min, then 35 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 2 min, followed by a final step of 72°C for 10 minutes. HindIII BglII digested fragments of the resulting PCR products were ligated into pCambia1301.

Next, the 1301B construct was digested with PmlI and PmeI. The EST containing the AtRaptor1B ORF was digested with PmeI and SmaI, and the resulting fragment was ligated into 1301B to create the complementation vector 1301B:Raptor. 1301B:Raptor was transformed into Agrobacterium line GV3101, and then into Col or 1B-/- plants via floral dip 32.

SEM fixation was performed using standard methods 33. Bright field microscopy was performed on a Zeiss microscope, and images were collected on a BioRad Confocal System.

Digoxigenin-labelled probes were hybridized to paraffin-sectioned material using previously described methods 34.

Locus identifiers were submitted to the Genevestigator Arabidopsis thaliana microarray database and analysis toolbox 27 at https://www.genevestigator.ethz.ch, where they were assayed against 1434 developmental and tissue-specific Arabidopsis microarray experiment results 35363738.