MCF-7 human breast adenocarcinoma cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂ in DMEM supplemented with 10% (v/v) fetal calf serum and sub-cultured using 0.25% trypsin with 1 mM EDTA (Life Technologies, Inc.,). Adriamycin-resistant MCF-7 cells (MCF-7/Adr) were established in our laboratory by intermittent exposure to adriamycin at 100 ng/mL for 1 h every week for 20 weeks. Afterward, MCF-7/Adr cells were routinely maintained in 200 ng/mL of adriamycin.

Cells were seeded into 96-well microtiter Falcon plates (Becton Dickinson, Franklin Lakes, NJ, USA) at 1.5–2.5 × 10³ cells/well in 0.1 mL of complete medium. The following day, cells were treated with adriamycin, paclitaxel, cisplatin, or 5-fluorouracil for 24 h, and subsequently cell viability was measured by MTT dye reduction assay. Experiments for resistance reversion were performed as follows: Cells were cultured as previously described and were pre-treated for 4 days with 10 μM hydralazine or for 24 h with verapamil at 5 μM. Following this, the medium was replaced with one containing adriamycin to then evaluate viability 24 h later. Briefly, 50 μL of 5 mg/mL MTT reagent in PBS were added to each well. Viable cells with active mitochondria reduce the MTT to an insoluble purple formazan precipitate that is solubilized by the subsequent addition of 150 μL of DMSO. The formazan dye was measured spectrophotometrically using an ELISA reader. All assays were performed in triplicate. The cytotoxic effect of each treatment was expressed as a percentage of cell viability relative to untreated control cells (percentage of control) and is defined as [(A_{570 nm-}treated cells)/A_{570 nm-}nontreated cells)] × 100.

Genomic DNA was obtained with the standard method of proteinase-K digestion and phenol-chloroform extraction. RNA was obtained using the Trizol Reagent (Gibco BRL, Grand Island, NY, USA) RNA extraction kit following manufacturer instructions.

Capillary electrophoresis. Quantification genomic 5-methylcytosine DNA content by capillary electrophoresis was performed as previously described 17. Briefly, DNA hydrolysis was carried out by incubating 40 μg of DNA in 2 mL of 88% v/v formic acid at 140°C in a sealed ampoule for 90 min. After hydrolysis, samples were reduced to dryness by speedvac concentration and redissolved in 30 μL of Milli-Q-grade water. An uncoated fused-silica capillary (60 cm × 75 μm; effective length, 44.5 cm) (Beckman-Coulter was used in a CE system (P/ACE MDQ, Beckman-Coulter) connected to a 32 Karat software data-processing station. The running buffer was 20 mM NaCO₃ (pH 9.6 ± 1) containing 80 mM SDS. Running conditions were 25°C with an operating voltage of 20 kV. On-column absorbance was monitored at 223 nm. Prior to each run, the capillary system was conditioned by washing with the running buffer for 2 min. Hydrolyzed samples previously filtered through 0.45-μm pore filters were injected under pressure (0.5 p.s.i.) for 15 sec. Results were expressed as absolute percentage of cytosine and 5-methylcytosine and assays were performed in triplicate.

Cytosine-extension assay. DNA methylation was also determined by this assay essentially as described 18. This assay is based on use of methylation-sensitive restriction endonuclease that leaves a 5'guanine overhang after DNA cleavage, with subsequent single nucleotide extension with radiolabeled [(3)H]dCTP. Briefly, 1 μg of DNA from cells was digested overnight with HpaII or MspI according to manufacturer instructions. Single nucleotide extension reaction was performed in a 25-μL reaction mixture containing 0.25 μg of DNA, 1X buffer II, 1 mM MgCl, and 0.25 U of DNA polymerase [³H]dCTP (Ci/mmol) (Perkin-Elmer, Branchburg, NJ,. USA), incubated at 56°C for 1 h, and subsequently placed on ice. The reaction mixture was then applied to Sephadex G25 column. For column chromatography, each Sephadex G25 column was centrifuged for 10 sec at 5,000 rpm to remove the buffer, and then loaded with the reaction mixture. After loading samples onto the column, radiolabeled DNA was collected by column centrifugation and mixed with liquid scintillation for determination of radioactivity. Assays were done by triplicate and results were expressed as percentage change from average controls

Dot blot assay. A total of 5 μg of DNA previously digested with EcoRI for 1 h was dot-blotted onto a nitrocellulose membrane (Bio-Rad) in a total volume of 2 μL per sample. Membranes were allowed to dry and then UV-crosslinked for 15 sec. Membrane blocking was done by soaking in 2.5% non-fat milk in TBS (1 h at room temperature) prior to incubation with a primary sheep polyclonal antibody (1:200 dilution dissolved in 2.5% TBS-T overnight at 4°C) against 5-methylcytosine (Maine biothecnology Services INC, Portland). Membranes were washed three times with TBS-T, 5 min each and then incubated with secondary antibody conjugated with HRP at 1:1000 dilution (Santa Cruz) for 30 min at RT, washed with TBS-T (once for 15 minm twice for 5 min and then once with TBS for 5 min. Membranes were incubated with ECL reagent for 1 min and expose X-ray film in the dark room. Signal intensity was quantified by densitometry. Assays were done by triplicate.

The in vitro methylation assay was performed as follows: total cell extract was obtained with lysis buffer (50 mM Tris-HCl pH 8.0, EDTA 1 mM, 0.001% Na azide, 10 % glycerol, 1 mM DTT, 0.06 mg/mL) (Sigma,). DNA methyltransferase activity was measured employing 500 ng of a 1,112-bp fragment of the type-I Herpes simplex virus tymidine kinase gene, which has a high GC content, in presence of 50 mg cellular protein obtained from MCF-7 or -7/Adr cells previously exposed to 0–20 μM hydralazine for 5 days. Final reaction volume (50 μL) was completed with 3 μL of S-adenosyl-L- [methyl-³H]methionine (1 mCi/mL) (Amersham, Buckinghamshire, UK). Reactions were conducted at 37°C for 2 h and stopped with 350 μL of stop solution (1% SDS, 2 mM EDTA, 0.04 g/mL 4-aminosalicylate, 125 mM NaCl, 0.25 mg/mL salmon testis DNA, 1 mg/mL proteinase K). DNA was purified using phenol-chloroform and precipitated with cold ethanol. DNA was resuspended in 30 μL of 0.3 M NaOH and spotted on Whatman DE81 filter paper disc (Whatman, Maidstone, UK). The disc was washed three times in 5% trichloroacetic acid (J.T. Baker, Xalostoc, Edo. de México. Mexico) with BSA (Research Organics, Cleveland, OH, USA) and three times in 70% ethanol, and dried. Radioactivity was measured in a Beckman liquid scintillation counter (LS 6000TA). A blank control reaction was carried out simultaneously using only lysis buffer. The results, expressed in dpm, were adjusted by subtracting the background level. Each assay was performed in triplicate.

Total RNA was reverse transcribed using a RT-PCR kit (Perkin Elmer) following manufacturer instructions. Primers and conditions for amplifications were as follows: dnmt1, sense AGCCTTCGGCTGACTGGCTGG antisense CTGCCCATCATCATGACCTGG product size 150 bp, annealing 60°C. dnmt3a, sense GACTGTATGGATGTTCTGTCAG antisense ATTTGTCCTGGCAGACGAAGCA product size 146 bp, annealing 50°C. dnmt3b, sense GCTGCAGACCAVCTCTGTGGCACG antisense GCCGCCTCTTCACCATCCCG product size 81 bp, annealing 50°C. mdr1, sense ATGTCGTTCAGATTTGGCCAAC antisense TCATAGATGCTGTCATTCCTGT product size 340 bp, annealing 53°C.

Adriamycin is a small heterocyclic amine (molecular mass, 580 daltons) with a pK_a of 8.3 that can diffuse across membranes in the uncharged form. Adriamycin fluorescence is excited between 350 and 550 nm and emits between 400 and 700 nm. MCF-7 and -MCF-7/Adr cells were cultured in flasks and then treated for 1 h with adriamicyn at 3 μM. Afterward, cells were harvested with 0.25% trypsin and 1 mM EDTA and centrifuged. Cell pellets were washed twice with cold PBS, resuspended in 0.3 mL of PBS, and transferred to 352063 Falcon tubes. After 30 min, cell fluorescence intensity (10⁴/mL) was determined by flow cytometry using a FAC-Scalibar (Becton Dickinson, San Jose, CA, USA).

MCF-7/Adr cells were transfected with the following phosphorothiorate antisense oligonucleotides as previously described 19: DNMT1-AS, 5'-AAGCATGAGCACCGTTCTCC-3'; DNMT1-MM (mismatch), 5'-AA

CG

C

G

C

C

C

C

G

G

C

C

G

GA

G

As expected, MCF-7 cells receiving weekly pulses of adriamycin acquired the resistant phenotype. MCF-7/Adr became resistant to adriamycin, exhibited over-expression of the mdr1 gene, and diminished intracellular accumulation of adriamycin as evaluated by flow cytometry. In addition, MCF-7/Adr demonstrated cross-resistance to paclitaxel but not to 5-fluorouracil and cisplatin (Figures 1a, b, c, and 1d).

To evaluate whether or not DNA hypermethylation is associated with drug resistance acquisition, global DNA methylation was evaluated in MCF-7 and MCF-7/Adr. As shown in Figure 2a, there was an increase of nearly 2% in the absolute percentage of 5-methylcytosine (5-^mC) content as evaluated by capillary electrophoresis. This observation was also corroborated by two additional methods: cytosine-extension assay (Figure 2b), and dot blot assay (Figure 2c).

The presence of global and gene promoter-specific DNA hypermethylation in MCF-7/Adr-resistant cells suggested changes in the methylation machinery. Thus, we analyzed dnmt gene expression as well as DNA methyltransferase enzymatic activity of MCF-7/Adr in comparison with wild-type cells. Because it is known that expression of dnmts changes according to cycling status, cells were growth-arrested by serum deprivation for 24 h (corroborated by flow cytometry, not shown), and then gene expression was analyzed. Results showed clear over-expression of dnmt1, -3a, and -b in resistant cells as compared with MCF-7 cells (Figure 3a). Corresponding with these findings, DNA methyltransferase enzymatic activity was 40% higher in MCF-7/Adr cells (Figure 3b).

Despite the clear association between development of drug resistance and DNA hypermethylation, it remains unclear whether DNA hypermethylation contributes to the development of drug resistance or whether it is solely a characteristic of the resistant phenotype. With this aim, MCF-7/Adr cells were transfected with antisense oligonucleotides against each of the dnmt genes. After 72 h of antisense treatment, once lack or a strong diminishing of respective transcripts was confirmed in cells (Figure 4a), global DNA methylation was assessed, as well as viability with and without adriamycin treatment. Results indicate that while treated cells with mismatch oligonucleotides exhibited no growth inhibition with or without adriamycin, the sole knocking out of dnmts in MCF-7/Adr cells led to a small growth inhibition that, nonetheless, increased when these cells were treated with adriamycin, as shown in Figure 4c. Interestingly, adriamycin sensitivity was more evident in dnmt1-, and less evident in -b, antisense-treated cells. Sensitivity to adriamycin by means of antisense treatment correlated with decreased global methylation (Figure 4b).

Because MCF-7/Adr antisense treatment not only leads to DNA demethylation but also to reversal of resistance, we sought to determine whether the demethylating agent hydralazine could also be able to restore sensitivity to adriamycin. First, we measured the DNA methyltransferase activity in MCF-7/Adr cells after hydralazine treatment. Results demonstrate that hydralazine induces dose-dependent decreases in DNA methyltransferase enzymatic activity, a 30% decrease at 10 μM, the dose used for demethylation in cell culture experiments (Figure 5a), and that it also reduces the global DNA methylation level to that observed in wild-type MCF-7 cells (Figures 5b,5c,5d). As expected, cell viability experiments showed that hydralazine rendered MCF-7/Adr cells sensitive to adriamycin at a level indistinguishable to that of wild-type MCF-7. This restoration of sensitivity by hydralazine was also observed when cells were treated with paclitaxel, on which adriamycin-resistant cells showed cross-resistance (Figure 6).

It is widely known that the MCF-7/Adr model expresses the mdr-phenotype characterized by mdr1 gene and protein over-expression. To gain further insight into the role that mdr plays in comparison with DNA hypermethylation for chemoresistance in this model, we decided to determine to what extent verapamil, a known allosteric inhibitor of the mdr protein, could reverse adriamycin resistance in MCF-7/Adr cells. As shown in Figure 7a, adriamycin accumulation in MCF-7/Adr cells was almost none. As expected, resistant verapamil-treated cells experienced an increase in intracellular adriamycin accumulation comparable to that with hydralazine. As there is no data to suggest direct interaction of hydralazine with mdr protein, we sought to determine whether hydralazine by its demethylating effect could inhibit mdr1 gene expression. Results demonstrate that hydralazine decreases rather than increases expression of the mdr1 (Figure 7b). Our data demonstrates that hydralazine by its effect on mdr1 gene expression increased cellular accumulation of adriamycin to the same extent as verapamil; hence, we decided to compare the individual ability of these compounds to reverse resistance to adriamycin. Interestingly, the results showed that despite that both drugs led to comparable accumulation of adriamycin, hydralazine rendered MCF-7/Adr more susceptible to adriamycin than verapamil (Figure 7c).