<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1477-5751-7-9</ui>
   <ji>1477-5751</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Parwez</snm>
               <fnm>Qumar</fnm>
               <insr iid="I1"/>
               <email>qumar.parwez@t-online.de</email>
            </au>
            <au id="A2" ca="yes">
               <snm>Stemmler</snm>
               <fnm>Susanne</fnm>
               <insr iid="I2"/>
               <email>susanne.stemmler@rub.de</email>
            </au>
            <au id="A3">
               <snm>Epplen</snm>
               <mi>T</mi>
               <fnm>J&#246;rg</fnm>
               <insr iid="I2"/>
               <email>joerg.t.epplen@rub.de</email>
            </au>
            <au id="A4">
               <snm>Hoffjan</snm>
               <fnm>Sabine</fnm>
               <insr iid="I2"/>
               <email>Sabine.Hoffjan@ruhr-uni-bochum.de</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Private medical practice, Gladbeck, Germany</p>
            </ins>
            <ins id="I2">
               <p>Department of Human Genetics, Ruhr-University, Bochum, Germany</p>
            </ins>
         </insg>
         <source>Journal of Negative Results in BioMedicine</source>
         <issn>1477-5751</issn>
         <pubdate>2008</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>9</fpage>
         <url>http://www.jnrbm.com/content/7/1/9</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19014520</pubid>
               <pubid idtype="doi">10.1186/1477-5751-7-9</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>22</day>
               <month>1</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>13</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>13</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Parwez et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Atopic dermatitis (AD) is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO) and major basic protein (MBP). Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the <it>ECP, EDN, EPO </it>and <it>MBP </it>genes in a cohort of 361 German AD patients and 325 healthy controls.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Atopic dermatitis (AD) is a chronic inflammatory skin disease believed to arise from complex interactions between genetic and environmental factors <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. AD belongs to the group of allergic disorders, also including allergic asthma, allergic rhinitis and food allergy. As a main feature of allergic disorders, AD is often accompanied by eosinophilia <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO) and major basic protein (MBP). Eosinophil degranulation with deposition of these proteins in the skin has been shown to play an important role in AD <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Furthermore, serum and urine concentrations of eosinophil proteins are indirect measures of inflammatory activity in AD. For example, several studies have confirmed that urine EDN (also called EPX) is a useful <it>in vitro </it>parameter of inflammation in AD <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Measurement of ECP levels in serum also is a frequently used tool in monitoring AD activity <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B6">6</abbr></abbrgrp>.</p>
         <p>Recently, variation in genes encoding eosinophil granule proteins has been suggested as potential factor in the pathogenesis of allergic disorders. In particular, a non-synonymous polymorphism in the <it>ECP </it>gene was associated with allergic symptoms <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, and a polymorphism in the 3'UTR of this gene showed correlation with the cellular content of ECP <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. More recently, <it>ECP </it>haplotypes were found associated with asthma and serum ECP levels <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Variation in the <it>EDN </it>gene was evaluated for an association with tropical pulmonary eosinophilia but did not show an association with this disease in a small cohort <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>Since eosinophil degranulation seems to play an important role in AD, we speculated that variation in genes encoding eosinophil granule proteins might show an association with AD. We therefore genotyped selected single nucleotide polymorphisms (SNPs) within the <it>ECP, EDN, EPO </it>and <it>MBP </it>genes in a cohort of 361 German AD patients and 325 healthy controls.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Subjects</p>
            </st>
            <p>361 unrelated patients with AD, including 217 children and 144 adults, were recruited by a consultant specialist for AD (Q.P., Gladbeck, Germany). Mean age of the AD patients was 18 &#177; 7 years. The AD diagnosis was based on the criteria developed by Hanifin and Rajka <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. 325 control samples from adults of at least 40 years of age without known allergies, asthma or AD were collected in the same private practice as the AD patients. Mean age of the controls was 57 &#177; 13 years. We specifically chose to use non-allergic adults as controls because the risk remains very high for primarily asymptomatic children to develop an allergic disease during childhood or even adulthood <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. The control subjects underwent clinical examination in order to exclude symptoms of AD, asthma or allergic rhinitis. They further reported to have no allergic symptoms and no first degree relatives with known allergic diseases. All patients and control subjects were Germans of European origin. Informed consent was obtained from all subjects. The study was approved by the Ethics Committee of the University of Bochum, and the Declaration of Helsinki protocols were followed.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping</p>
            </st>
            <p>Genotyping for all polymorphisms was performed by polymerase chain reaction (PCR) with subsequent restriction enzyme digestion. Details for PCR conditions and restriction enzymes are summarized in table <tblr tid="T1">1</tblr>. PCR reactions were performed in a total volume of 10 &#956;l, containing 45 ng DNA, 2 mM of each dNTP, 1&#8211;3 mmol MgCl<sub>2</sub>, 5 pmol of the respective forward and reverse primer and 0.4 U Taq polymerase (Ares Bioscience, L&#252;dinghausen, Germany) on a Biometra Thermal Cycler (G&#246;ttingen, Germany). The PCR products were digested with the respective enzyme (table <tblr tid="T1">1</tblr>, 0.01 U/ng DNA) at 37&#176;C for three hours. The fragments were subsequently separated on 2.5&#8211;3.5% agarose gels in 1&#215;TBE buffer (30 min, 200 V) and visualized using ethidium bromide staining.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Polymorphisms typed in the <it>EDN, ECP, EPO </it>and <it>MBP </it>genes.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Rs number</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Location</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Amino acid</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Annealing temperature</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Restriction enzyme</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EDN</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs2013109</p>
                     </c>
                     <c ca="left">
                        <p>Intron 1</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: GGGTAAGTCAACGATCCCCAG</p>
                        <p>R: GGTCTTGGTTATGACACACACTGTAGT</p>
                     </c>
                     <c ca="center">
                        <p>69&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>HpyF10VI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EDN</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs10132319</p>
                     </c>
                     <c ca="left">
                        <p>Intron 1</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: GGGTAAGTCAACGATCCCCAG</p>
                        <p>R: GGTCTTGGTTATGACACACACTGTAGT</p>
                     </c>
                     <c ca="center">
                        <p>65&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>AciI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ECP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs17792481</p>
                     </c>
                     <c ca="left">
                        <p>Intron 1</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: TGAGGGAGAGGTGAGCTGAAGT</p>
                        <p>R: TGATGTGCTGGATGGCAAAC</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>MboI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ECP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs2073342</p>
                     </c>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>T124R</p>
                     </c>
                     <c ca="left">
                        <p>F: TACGCTGCCCTCATAACAGAACT</p>
                        <p>R: GAACTGGAACCACAGGATACCG</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>PstI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ECP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs2233860</p>
                     </c>
                     <c ca="left">
                        <p>3' UTR</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: GTATGCAGACAGACCAGGAAGGA</p>
                        <p>R: TTGGCAGATGAGTGATGATGAGTA</p>
                     </c>
                     <c ca="center">
                        <p>61&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>RsaI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EPO</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs11652709</p>
                     </c>
                     <c ca="left">
                        <p>Exon 4</p>
                     </c>
                     <c ca="left">
                        <p>Q122H</p>
                     </c>
                     <c ca="left">
                        <p>F: CTACCCTGGCCTGGAGTAGAAG</p>
                        <p>R: CACGCACTTGTTGTTGCACC</p>
                     </c>
                     <c ca="center">
                        <p>64&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>HpyF10VI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EPO</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs3785496</p>
                     </c>
                     <c ca="left">
                        <p>Intron 6</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: ACTGGTTGTCACTTCCCCTCTC</p>
                        <p>R: CAAAACCTTGCTTAAAACTCCCTT</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>MseI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>MBP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs490358</p>
                     </c>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: GGAAAAAACAGAGAAAGAAAGACTGAA</p>
                        <p>R: CACTCCCACGGTCCCCTAAT</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>BslI</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>MBP</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rs3741098</p>
                     </c>
                     <c ca="left">
                        <p>Intron 3</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>F: TGGTGGACAAAAACCTTACGTGTC</p>
                        <p>R: ATGCTGGGGGCATATCC<ul>G</ul>A</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                     <c ca="left">
                        <p>BsaHI</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Statistical analyses</p>
            </st>
            <p>Genotype and allele frequencies were ascertained by direct counting and subsequently analyzed according to the &#967;<sup>2 </sup>method. Deviations from Hardy-Weinberg equilibrium were evaluated using the DeFinetti program <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. P &lt; 0.05 was considered to be significant. Haplotype frequencies were estimated using the Haploview software and compared between cases and controls using a contingency &#967;<sup>2 </sup>test. We performed power analyses with the Genetic Power Calculator program <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>We genotyped a total of nine SNPs in four genes encoding eosinophil granule proteins (table <tblr tid="T1">1</tblr>). rs10132319 in intron 1 of the <it>EDN </it>gene turned out to be monomorphic in our cohort and thus was excluded from further analysis. All other SNPs were in Hardy-Weinberg equilibrium in cases and controls. None of the polymorphisms investigated here showed an association with AD in our cohort (table <tblr tid="T2">2</tblr>). Power analyses performed with the Genetic Power Calculator program <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> revealed, that given a multiplicative model with a genotypic relative risk of 2 for heterozygotes and 4 for homozygotes and a D' of 0.9, we have 89% power to detect a potential effect. Choosing more conservative parameters with a genotypic relative risk of 1.5/2.25 and D' of 0.8, would yield only 33% power.</p>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Genotype frequencies of <it>EDN, ECP, EPO </it>and <it>MBP </it>polymorphisms in AD patients and controls.</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c ca="left">
                     <p>
                        <b>Gene</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Polymorphism</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Genotypes</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>AD patients</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>controls</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>p-value</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>EDN</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>rs2013109</p>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>22 (6.1%)</p>
                  </c>
                  <c ca="center">
                     <p>23 (7.1%)</p>
                  </c>
                  <c ca="center">
                     <p>0.66</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>148 (41.0%)</p>
                  </c>
                  <c ca="center">
                     <p>123 (37.8%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>191 (52.9%)</p>
                  </c>
                  <c ca="center">
                     <p>179 (55.1%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>rs10132319</p>
                  </c>
                  <c ca="center">
                     <p>Not polymorphic</p>
                  </c>
                  <c ca="center">
                     <p>-</p>
                  </c>
                  <c ca="center">
                     <p>-</p>
                  </c>
                  <c ca="center">
                     <p>-</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ECP</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>rs2073342</p>
                  </c>
                  <c ca="center">
                     <p>A/A</p>
                  </c>
                  <c ca="center">
                     <p>53 (14.7%)</p>
                  </c>
                  <c ca="center">
                     <p>57 (17.6%)</p>
                  </c>
                  <c ca="center">
                     <p>0.45</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>A/C</p>
                  </c>
                  <c ca="center">
                     <p>185 (51.2%)</p>
                  </c>
                  <c ca="center">
                     <p>152 (47.1%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>123 (34.1%)</p>
                  </c>
                  <c ca="center">
                     <p>114 (35.3%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>rs2073342</p>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>26 (7.2%)</p>
                  </c>
                  <c ca="center">
                     <p>32 (9.8%)</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>158 (43.9%)</p>
                  </c>
                  <c ca="center">
                     <p>120 (36.9%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>176 (48.9%)</p>
                  </c>
                  <c ca="center">
                     <p>173 (53.2%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>rs2233860</p>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>15 (4.1%)</p>
                  </c>
                  <c ca="center">
                     <p>19 (5.9%)</p>
                  </c>
                  <c ca="center">
                     <p>0.55</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>123 (34.1%)</p>
                  </c>
                  <c ca="center">
                     <p>104 (32.1%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>223 (61.8%)</p>
                  </c>
                  <c ca="center">
                     <p>201 (62.0%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>EPO</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>rs11652709</p>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>34 (9.4%)</p>
                  </c>
                  <c ca="center">
                     <p>35 (10.8%)</p>
                  </c>
                  <c ca="center">
                     <p>0.42</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>170 (47.2%)</p>
                  </c>
                  <c ca="center">
                     <p>137 (42.3%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>156 (43.3%)</p>
                  </c>
                  <c ca="center">
                     <p>152 (46.9%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>rs3785496</p>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>23 (6.4%)</p>
                  </c>
                  <c ca="center">
                     <p>18 (5.6%)</p>
                  </c>
                  <c ca="center">
                     <p>0.89</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/A</p>
                  </c>
                  <c ca="center">
                     <p>142 (39.4%)</p>
                  </c>
                  <c ca="center">
                     <p>130 (40.1%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>A/A</p>
                  </c>
                  <c ca="center">
                     <p>195 (54.2%)</p>
                  </c>
                  <c ca="center">
                     <p>176 (54.3%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>MBP</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>rs490358</p>
                  </c>
                  <c ca="center">
                     <p>A/A</p>
                  </c>
                  <c ca="center">
                     <p>29 (8.0%)</p>
                  </c>
                  <c ca="center">
                     <p>27 (8.3%)</p>
                  </c>
                  <c ca="center">
                     <p>0.98</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="center">
                     <p>137 (38.0%)</p>
                  </c>
                  <c ca="center">
                     <p>121 (37.2%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>G/G</p>
                  </c>
                  <c ca="center">
                     <p>195 (54.0%)</p>
                  </c>
                  <c ca="center">
                     <p>177 (54.5%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>rs3741089</p>
                  </c>
                  <c ca="center">
                     <p>T/T</p>
                  </c>
                  <c ca="center">
                     <p>99 (27.6%)</p>
                  </c>
                  <c ca="center">
                     <p>99 (30.7%)</p>
                  </c>
                  <c ca="center">
                     <p>0.66</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>T/C</p>
                  </c>
                  <c ca="center">
                     <p>184 (51.2%)</p>
                  </c>
                  <c ca="center">
                     <p>158 (49.1%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>C/C</p>
                  </c>
                  <c ca="center">
                     <p>76 (21.2%)</p>
                  </c>
                  <c ca="center">
                     <p>65 (20.2%)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>Haplotype analyses in the <it>ECP </it>gene revealed four different haplotypes with a frequency above 1%: A-G-G, C-G-G, C-C-C and C-C-G, as described before <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Haplotype frequencies did not differ between AD patients and controls (table <tblr tid="T3">3</tblr>).</p>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Frequencies and p-values of <it>ECP </it>haplotypes in AD patients and controls.</p>
            </caption>
            <tblbdy cols="4">
               <r>
                  <c ca="center">
                     <p>
                        <b>Haplotype</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Frequency in AD patients (n = 361)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Frequency in controls (n = 325)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>p-value</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="4">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>A-G-G</p>
                  </c>
                  <c ca="center">
                     <p>0.401</p>
                  </c>
                  <c ca="center">
                     <p>0.408</p>
                  </c>
                  <c ca="center">
                     <p>0.762</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>C-G-G</p>
                  </c>
                  <c ca="center">
                     <p>0.305</p>
                  </c>
                  <c ca="center">
                     <p>0.304</p>
                  </c>
                  <c ca="center">
                     <p>0.934</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>C-C-C</p>
                  </c>
                  <c ca="center">
                     <p>0.209</p>
                  </c>
                  <c ca="center">
                     <p>0.214</p>
                  </c>
                  <c ca="center">
                     <p>0.830</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>C-C-G</p>
                  </c>
                  <c ca="center">
                     <p>0.080</p>
                  </c>
                  <c ca="center">
                     <p>0.070</p>
                  </c>
                  <c ca="center">
                     <p>0.439</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In the present study, we did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in a thoroughly characterized German cohort.</p>
         <p>In the <it>ECP </it>gene, the three polymorphisms were evaluated that had shown association to allergic phenotypes either in single SNP <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> or haplotype analysis <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> in previous studies. Genotype as well as haplotype frequencies in our cohort were very similar to the frequencies reported in these other studies, but did not differ between AD patients and controls. Thus, our results seem to contradict these earlier reports. Yet, none of the preceding studies specifically addressed the phenotype AD, but rather allergic symptoms in general <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> or allergic asthma <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Linkage studies have shown that there is surprisingly little overlap between the main susceptibility regions for asthma and AD, even though both diseases belong to the group of allergic disorders <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Thus, it is possible that <it>ECP </it>variation might influence the development of (allergic) asthma but have no measurable influence on AD development. Furthermore, the association of the <it>ECP </it>T124R SNP with allergic symptoms was demonstrated in a very small cohort (209 medical students and 76 asthmatic patients) <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, and it still remains to be investigated whether this association will hold true in a larger cohort of allergic patients. Clearly, additional studies in sufficiently large cohorts of patients with allergy, asthma and AD are needed to further elucidate the role of variation in this gene for the various allergic diseases.</p>
         <p>For the other three genes evaluated in this study, no association studies for AD or asthma have been published so far. Only the <it>EDN </it>gene (together with <it>ECP</it>) was evaluated for an association with tropical pulmonary eosinophilia but did not show an association with this disease in a small cohort <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. We nevertheless speculated that they might constitute interesting candidate genes for AD since eosinophil degranulation with deposition of all of these proteins in the skin has been shown to play an important role in AD <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Furthermore, several studies have confirmed that urine EDN is a useful <it>in vitro </it>parameter of inflammation in AD <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Interestingly, the <it>EPO </it>gene is located on chromosome 17q23, close to the regions of highest linkage to AD or AD severity in two genome-wide screens <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. Yet, none of the investigated polymorphisms in these genes showed differences in allele, genotype or haplotype distribution between AD patients and controls in our cohorts, suggesting that they may probably not play an important role in AD pathogenesis.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort. However, we cannot exclude a contribution of variation in these genes entirely. Additional association studies as well as functional assessment of the investigated polymorphisms might further elucidate their role in allergic diseases.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>AD: atopic dermatitis; ECP: eosinophil cationic protein; EDN: eosinophil derived neurotoxin; EPO: eosinophil peroxidase; MBP: major basic protein; PCR: polymerase chain reaction</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>QP recruited the patients and control subjects, collected clinical data, performed the experiments and drafted the manuscript. SS and JTE participated in the design and coordination of the study. SH was in charge of the design and coordination of the study as well as the statistical analyses and finalised the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Daniela Falkenstein for technical assistance and the patients for participating in this study.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The genetics of atopic dermatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Morar</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Willis-Owen</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Moffatt</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Cookson</snm>
                  <fnm>WO</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2006</pubdate>
            <volume>118</volume>
            <fpage>24</fpage>
            <lpage>34</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jaci.2006.03.037</pubid>
                  <pubid idtype="pmpid" link="fulltext">16815134</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Eosinophils and atopic dermatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Simon</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Braathen</snm>
                  <fnm>LR</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>HU</fnm>
               </au>
            </aug>
            <source>Allergy</source>
            <pubdate>2004</pubdate>
            <volume>59</volume>
            <fpage>561</fpage>
            <lpage>570</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1398-9995.2004.00476.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15147438</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Urine eosinophil protein X (EPX) is an in vitro parameter of inflammation in atopic dermatitis of the adult age</p>
            </title>
            <aug>
               <au>
                  <snm>Breuer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kapp</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Werfel</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Allergy</source>
            <pubdate>2001</pubdate>
            <volume>56</volume>
            <fpage>780</fpage>
            <lpage>784</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1398-9995.2001.056008780.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11488674</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Urinary eosinophil protein X and serum eosinophil cationic protein in infants and young children with atopic dermatitis: correlation with disease activity</p>
            </title>
            <aug>
               <au>
                  <snm>Pucci</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lombardi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Novembre</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Farina</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bernardini</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rossi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Favilli</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Vierucci</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2000</pubdate>
            <volume>105</volume>
            <fpage>353</fpage>
            <lpage>357</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0091-6749(00)90087-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10669858</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Urinary Eosinophil-derived Neurotoxin Concentrations in Patients with Atopic Dermatitis: A Useful Clinical Marker for Disease Activity</p>
            </title>
            <aug>
               <au>
                  <snm>Goto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Morioka</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Inamura</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kodaira</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Igarashi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Abe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kurosawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Allergol Int</source>
            <pubdate>2007</pubdate>
            <volume>56</volume>
            <fpage>433</fpage>
            <lpage>438</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2332/allergolint.O-07-489</pubid>
                  <pubid idtype="pmpid" link="fulltext">17965582</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Serum eosinophil cationic protein (ECP) is a sensitive measure for disease activity in atopic dermatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Czech</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Krutmann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schopf</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kapp</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Br J Dermatol</source>
            <pubdate>1992</pubdate>
            <volume>126</volume>
            <fpage>351</fpage>
            <lpage>355</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2133.1992.tb00677.x</pubid>
                  <pubid idtype="pmpid">1571256</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Polymorphism of the eosinophil cationic protein-gene is related to the expression of allergic symptoms</p>
            </title>
            <aug>
               <au>
                  <snm>Jonsson</snm>
                  <fnm>UB</fnm>
               </au>
               <au>
                  <snm>Bystrom</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stalenheim</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Venge</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Clin Exp Allergy</source>
            <pubdate>2002</pubdate>
            <volume>32</volume>
            <fpage>1092</fpage>
            <lpage>1095</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2222.2002.01410.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12100059</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A (G->C) transversion in the 3' UTR of the human ECP (eosinophil cationic protein) gene correlates to the cellular content of ECP</p>
            </title>
            <aug>
               <au>
                  <snm>Jonsson</snm>
                  <fnm>UB</fnm>
               </au>
               <au>
                  <snm>Bystrom</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stalenheim</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Venge</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>2006</pubdate>
            <volume>79</volume>
            <fpage>846</fpage>
            <lpage>851</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1189/jlb.0904517</pubid>
                  <pubid idtype="pmpid" link="fulltext">16434694</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Eosinophil cationic protein (ECP) polymorphisms and association with asthma, s-ECP levels and related phenotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Munthe-Kaas</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Gerritsen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Carlsen</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Undlien</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Egeland</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Skinningsrud</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Torres</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Carlsen</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>Allergy</source>
            <pubdate>2007</pubdate>
            <volume>62</volume>
            <fpage>429</fpage>
            <lpage>436</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1398-9995.2007.01327.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17362255</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Genetic polymorphisms of eosinophil-derived neurotoxin and eosinophil cationic protein in tropical pulmonary eosinophilia</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Kumaraswami</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Choi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Follmann</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Zimmerman</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Nutman</snm>
                  <fnm>TB</fnm>
               </au>
            </aug>
            <source>Am J Trop Med Hyg</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <fpage>125</fpage>
            <lpage>130</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16014847</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Diagnostic features of atopic dermatitis</p>
            </title>
            <aug>
               <au>
                  <snm>Hanifin</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Rajka</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Acta Derm Venereol</source>
            <pubdate>1980</pubdate>
            <volume>92</volume>
            <fpage>44</fpage>
            <lpage>7</lpage>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Clinical phenotypes of asthma</p>
            </title>
            <aug>
               <au>
                  <snm>Bel</snm>
                  <fnm>EH</fnm>
               </au>
            </aug>
            <source>Curr Opin Pulm Med</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>44</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00063198-200401000-00008</pubid>
                  <pubid idtype="pmpid" link="fulltext">14749605</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Incidence and remission of asthma: a retrospective study on the natural history of asthma in Italy</p>
            </title>
            <aug>
               <au>
                  <snm>De Marco</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Locatelli</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Cerveri</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bugiani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marinoni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Giammanco</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2002</pubdate>
            <volume>110</volume>
            <fpage>228</fpage>
            <lpage>235</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2002.125600</pubid>
                  <pubid idtype="pmpid" link="fulltext">12170262</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>DeFinetti program</p>
            </title>
            <url>http://ihg.gsf.de/cgi-bin/hw/hwa1.pl</url>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Genetic Power Calculator</p>
            </title>
            <url>http://pngu.mgh.harvard.edu/~purcell/gpc/cc2.html</url>
         </bibl>
         <bibl id="B16">
            <title>
               <p>The genetics of atopic dermatitis: recent findings and future options</p>
            </title>
            <aug>
               <au>
                  <snm>Hoffjan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Epplen</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <source>J Mol Med</source>
            <pubdate>2005</pubdate>
            <volume>83</volume>
            <fpage>682</fpage>
            <lpage>692</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00109-005-0672-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">15902388</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Genetic linkage of childhood atopic dermatitis to psoriasis susceptibility loci</p>
            </title>
            <aug>
               <au>
                  <snm>Cookson</snm>
                  <fnm>WO</fnm>
               </au>
               <au>
                  <snm>Ubhi</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lawrence</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Abecasis</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Walley</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Cox</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Coleman</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Leaves</snm>
                  <fnm>NI</fnm>
               </au>
               <au>
                  <snm>Trembath</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Moffatt</snm>
                  <fnm>MF</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2001</pubdate>
            <volume>27</volume>
            <fpage>372</fpage>
            <lpage>373</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/86867</pubid>
                  <pubid idtype="pmpid" link="fulltext">11279517</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Susceptibility loci for atopic dermatitis on chromosomes 3, 13, 15, 17 and 18 in a Swedish population</p>
            </title>
            <aug>
               <au>
                  <snm>Bradley</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Soderhall</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Luthman</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wahlgren</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Kockum</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Nordenskjold</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2002</pubdate>
            <volume>11</volume>
            <fpage>1539</fpage>
            <lpage>1548</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/11.13.1539</pubid>
                  <pubid idtype="pmpid" link="fulltext">12045207</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
