The diurnal expression of Rgs16 was characterized in liver of C57BL/6 female mice (pair caged) with free access to food and water under conditions of 12 hr light/dark, and sacrificed every 4 hrs at nine time points throughout a 36-hour period (Fig 1A). Interestingly, Rgs16 mRNA accumulated toward the end of the light phase, just prior to when animals begin feeding. Rgs16 mRNA returned to basal levels during the dark phase, presumably after feeding, and remained at basal levels until the middle of the next light phase. Rgs16 mRNA levels were always up regulated by eight hr into the light phase (Zeitgeber time 8 hr; ZT8) but some variation in expression was observed at ZT12 (Fig 1A, compare ZT12 Day 1 vs Day 2). About half of the ad libitum fed mice we assayed at ZT12 expressed high levels (similar to ZT8) of Rgs16 mRNA in liver (n > 40), whereas the mice with lower expression probably began feeding prior to lights out (see below). The diurnal rhythm in Rgs16 expression was observed in male and female mice and rats ranging in age from four weeks to more than one year. Diurnal oscillation in mRNA expression in liver was not observed for any of the other 19 RGS genes expressed in mice 32.

Rgs16 is one of a small subset of genes that is diurnally regulated in both liver and the hypothalamic suprachiasmatic nuclei (SCN), site of the central circadian pacemaker 3334. We showed by in situ hybridization that Rgs16 mRNA is expressed in the SCN of C57BL/6 female mice in our colony in the same temporal pattern as previously reported (Fig. 1B; 35). Furthermore, this temporal pattern of Rgs16 expression in the SCN is maintained in ad libitum fed mice housed in constant darkness (CD) for two days prior to sacrifice on the third day; expression is elevated at 6 hr into the presumptive light phase (CD6) and declines to basal levels by 2 hr into the presumptive dark phase (CD14; Fig. 1C). Thus, Rgs16 expression in the SCN appears to be entrained similarly to other circadian regulated genes 3536.

To determine whether Rgs16 mRNA expression in liver was upregulated in anticipation of a meal, but returned to basal levels after feeding, we examined the effect of withholding food on Rgs16 mRNA levels and refeeding at different times in the light cycle. Fasting mice for various intervals caused an increase in Rgs16 mRNA expression through the early-middle hours of the first dark phase (Fig. 2A, lanes 1,4). The induction of Rgs16 mRNA expression early in the fasting period was consistently observed in separate groups of female mice fasted from ZT4; but expression levels began to vary as the mice were fasted through the dark phase until ZT12 of the following day (Fig. 2A, lanes 6–7; Fig. 2B; solid line). By contrast, phosphoenolpyruvate carboxykinase (PEPCK) expression never declined at any time in any of those fasted mice (Fig. 2B; dashed line). In all cases, Rgs16 (and PEPCK) mRNA expression returned to basal levels within four hours of providing chow ad libitum (Fig 2A, conditions 3,5,8) or within 90 min after gavage of a complete liquid diet (Fig. 2C). Gavage with water did not affect Rgs16 expression, suggesting that stomach dilation or gastrointestinal motility are not factors regulating liver Rgs16 expression during fasting and refeeding.

Metabolic functions of the liver are distributed between zones of hepatocytes organized within acini 37]. Lypolysis and gluconeogenesis occur preferentially in periportal hepatocytes, whereas glycolysis and lipogenesis occur preferentially in hepatocytes surrounding the central vein 37]. The hepatic cell types that expressed Rgs16 mRNA were identified by in situ hybridization. Interestingly, Rgs16 expression in fasted mice was localized to periportal hepatocytes that surround the portal triad, consisting of a portal vein, a hepatic artery, and a bile duct (Fig. 3A,B; same condition as Fig 2 condition 4). Rgs16 expression remained tightly restricted to periportal hepatocytes even after a 24 hr fast. By contrast, PEPCK mRNA was expressed in hepatocytes throughout the liver of fasted mice, although it was most abundant in periportal hepatocytes (Fig 3D). Periportal expression of Rgs16 and PEPCK was confirmed by histological examination. Consistent with previous Northern analyses, Rgs16 mRNA expression was not detected by in situ hybridization in liver of fed mice (Fig 3C; same conditions as Fig 2, lane 2). In additional control experiments, sense probes of Rgs16 and PEPCK did not hybridize to adjacent sections (data not shown). The restricted pattern of Rgs16 expression to periportal hepatocytes suggests that Rgs16 may regulate lipolysis and/or gluconeogensis in liver.

Regulation of Rgs16 by fasting and refeeding suggested that restricted feeding (RF), during 4 hours of the light phase (ZT5-ZT9), might shift Rgs16 expression in liver along with transcription factors that control the circadian clock in peripheral tissues 35. We characterized Rgs16 mRNA expression in C57BL/6 female mice over the first 4 days of RF (Fig. 4). As expected, Rgs16 was expressed in liver of fasted mice and declined to basal levels by the end of the 4 hr feeding period (ZT5-ZT9). Restricted feeding advances and intensifies Rgs16 expression in liver by the second or third day of RF (Fig. 4), coincident with increased locomoter activity as mice learn to anticipate feeding during the light phase 38.

On the first day of RF, Rgs16 mRNA expression in liver is no higher at ZT5 than in ad libitum fed mice (see Fig. 1, lane 1, 2), even though the RF mice were fasted through the dark phase and had lost 2.5 gm from their starting weight (Fig. 4, middle panel). This may reflect an underlying circadian regulation of liver gene expression as clock genes show a similar response on the first day of RF 353638. During the first 4 hr feeding period (day 1), female mice ate about 1.5 gm of chow and regained about 1 gm body weight (Fig. 4, bottom panel). However, they ate about half as much on day 1 as on subsequent days, presumably because they had not yet learned to anticipate fasting during the dark phase and feeding during the light phase. By day 2 RF, prior to feeding at ZT5, mice lost about 3.5 gm of their original weight, but they were alert and active, and ate voraciously upon refeeding, consuming about 0.7 gm chow within the first 30 min, 2.5 gm during 4 hr. This behavior was repeated days 3 and 4 of RF, and each day mice regained body weight to within about 1 gm of their starting weight.

Oscillations in Rgs16 mRNA expression are slightly delayed in the liver relative to the SCN in ad libitum fed mice maintained in a 12 hr light-dark cycle 353638. By contrast, restricted feeding during the light phase advances and intensifies Rgs16 expression in liver but does not alter expression in SCN (Fig. 4, top panel) presumably reflecting separate inputs of nutrients and light regulating Rgs16 expression in liver and SCN.

Transcription of the Rgs16 gene is induced during fasting and is inhibited after feeding. Body weight and food consumption of male C57BL/6 mice (individually caged) under RF conditions is shown (Fig. 5B). On day 3 of RF, fasted males were sacrificed at ZT5, or allowed to feed for 20, 40, or 60 min before sacrifice. Nuclear run-on assays showed that Rgs16 gene transcription declined about 5-fold from fasted levels within 20 min, and was not detectable above background by 60 min (Fig. 5A). By contrast, transcription of GAPDH, Rgs8, cyclophilin, and Gα11 remained essentially constant in liver of fed and fasted mice (Fig. 5A, and data not shown). Rgs16 mRNA levels declined about 4-fold within the first 20 min after refeeding, consistent with the decline in transcription during the same interval.

Rgs16 mRNA and protein expression in liver after a short fast was somewhat higher in mice maintained on normal chow compared with a high fat diet (Fig. 6). Feeding down regulated both Rgs16 mRNA and protein to basal levels within four hours (Figs. 2A, 6A, and data not shown). To compare the decline in Rgs16 mRNA and protein levels after feeding, female mice were fasted from ZT4 to ZT12; then, provided chow ad libitum at ZT12, and sacrificed to collect liver at the indicated times (Fig. 6A). Rgs16 mRNA and protein levels declined concomitantly within 20 min after feeding, falling to nearly basal levels within 60 min. A rapid decline in Rgs16 mRNA expression was also observed when female mice were refed by gavage (1 ml) of a complete liquid diet at ZT12 (Fig. 1). In summary, refeeding a complete chow or liquid diet down regulates Rgs16 in male and female mice (n >100) and rats (n = 6).

[³²P]-dCTP was purchased from Amersham Bioscience (Piscataway, NJ). TRIZOL was purchased from Invitrogen (Carlsbad, California) and GeneScreen nylon membranes were obtained from New England Nuclear (Shelton, CT). All other lab supplies were purchased from Sigma (St Louis, MO) or Fisher (Hampton, NH).

Mice were maintained at 20°C under a standard 12-hour light:dark cycle (12h L:D, lights on at 5 am). C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, Maine). Female C57BL/6 mice in feeding studies were pair-caged unless otherwise indicated; male mice were caged individually during restricted feeding studies. Mice were ad libitum fed standard mouse chow (Normal Chow) containing 6% total energy as fat (Teklad 7002, Harlan Teklad Laboratories, Indianapolis, IN), except where noted. The high-fat diet contains 41% calories as fat-40% carbohydrate-19% protein (Teklad #96001). Mice were six to eight weeks of age before being switched from a normal chow to high fat diet. Experimental research on animals followed internationally recognized guidelines and had UT Southwestern IACUC approval (APN#0602-05-01-2).

mRNA expression levels were determined using real time quantitative polymerase chain reaction. Cyclophilin was used as the normalizing gene. QPCR primers were designed using the Primer Express Software v 2.0 (Applied Biosystems, Foster City, CA) from published mRNA sequences. Rgs16 (NM_011267) QPCR primers: Forward – 5'cctggtacttgctactcgctttt3'; Reverse – 5'agcacgtcgtggagaggat3'; Cyclophilin (M60456) QPCR primers: Forward – 5'tggagagcaccaagacagaca3'; Reverse – 5'tgccggagtcgacaatgat3'. Total RNA was extracted from 50 mg liver as described below in Northern Blot Hybridization. Following DNase treatment, cDNA was synthesized from total RNA (2 μg) in 100 μL reactions using Superscript II reverse transcriptase kit (Invitrogen, Carlsbad, CA) and stored at -20°C until use. Polymerase chain reaction amplifications were performed in 96-well optical reaction plates (ABI) on the ABI Prism 7000 Sequence Detection system using the SYBR-Green (ABI) reaction conditions (1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min, 40 cycles at 95°C for 15 sec and 60°C for 1 min), the baseline and threshold were set to experimentally determined values and the data were analyzed using the Comparative C_T method (2−ΔΔCT MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaacqaIYaGmdaahaaWcbeqaaiabgkHiTiabfs5aejabfs5aejabboeadnaaBaaameaacqqGubavaeqaaaaaaaa@33ED@) as described 32. Relative Rgs16 mRNA fold induction was calculated compared to pooled RNA from fed mice (as in Fig. 2A, condition 2).

At time of collection, mice were sacrificed by cervical dislocation and individual livers were dissected, frozen in liquid nitrogen immediately, and stored at -80°C for future analysis. RNA extraction was performed using TRIZOL according to manufacture's protocol and liver RNA (20 μg per lane) was used for Northern analysis. Briefly, RNA samples were size separated by electrophoresis on a 1.0% agarose denaturing gel, transferred to a nylon membrane overnight, and probed with Rgs16 cDNA in 50% formamide. Radionucleotide hybridization probes were either random primed (Rgs16 cDNA; complete open reading frame) or end-labeled (18s rRNA oligonucleotide [GCCGTGCGTACTTAGACATGCATG]) as described 48. Northern blot hybridization filters were prehybridized at 42°C for six hours, hybridized overnight at 42°C, and then the membrane was washed twice in 2X SSC at 25°C, once in 2X SSC/2% SDS at 55°C, and once in 0.1X SSC at 25°C; filters were dried and exposed to Fuji RA film for at least 16 hours. Fold change (Δ) in Rgs16 mRNA levels are relative to basal expression at D12 (assayed by densitometry).

Mice were sacrificed by cervical dislocation and the livers were rapidly frozen on dry ice and stored at -80°C. Fresh frozen sections were cut in a cryostat and thaw-mounted onto SuperFrost Plus glass slides (Fisher Scientific, Pittsburgh, PA). Sections were pre-treated as described, including fixation, acetic anhydride and defatting steps 49. Slides with cover slip were incubated for 18 hrs at 60°C in a humidified chamber with buffer containing denatured salmon sperm DNA (0.033 mg/mL), yeast tRNA (0.15 mg/mL), dithiothreitol (40 μM), and a cRNA at 1 × 10⁷ cpm/mL, other conditions as described 49. Riboprobes were generated using an in vitro transcription kit (Ambion; Austin, TX) by using T3 or T7 RNA polymerase in the presence of ³²P-UTP, and purified using RNA quickspin columns. Sections were then treated with RNase A (20 mg/mL, 30 min at 45°C) and washed in descending concentrations of sodium citrate buffer to a stringency of 0.1X SSC at 60°C, and air-dried. Tissue sections were exposed to Biomax MR film (Kodak, Rochester, NY) followed by dipping in autoradiographic emulsion (NTB2, Kodak), exposed for an appropriate duration, developed, fixed, counterstained with cresyl violet acetate, a cover slip applied with DPX mounting media and visualized under bright and dark field microscopy (Olympus, Melville, NY). Adjacent sections from fresh-frozen livers were used as controls for the effects of perfusion on mRNA integrity and hybridization to sense probes.

Livers were rapidly excised and immediately frozen in liquid nitrogen. Liver (50 mg) was resuspended in 1% SDS that contained a cocktail of protease inhibitors, including leupeptin (10 μg/mL), soybean trypsin inhibitor (10 μg/mL), MG132 (16 μg/mL), phenylmethylsulfonyl fluoride (16 μg/mL), tosyl lysine choromethyl ketone (16 μg/mL), and tosyl phenylalanine choromethyl ketone (16 μg/mL). The samples were sonicated (Virtis, Gardiner, NY) and immediately boiled for three minutes. A Lowry protein assay was employed to quantitate the protein and ensure equal loading. The samples were separated by SDS-PAGE and transferred to nitrocellulose paper. Proteins were detected using Rgs16 antiserum (a gift from Carol Beadling, Cornell University). Rgs16 antiserum does not cross react with recombinant mouse Rgs4 or Rgs8 protein. Enhanced Chemiluminescence (Amersham-Pharmacia) was utilized to detect the rabbit HA-tagged secondary antibody. The membrane was exposed to ML film (Kodak Biomax) for 2–15 minutes. Autoradiographs were scanned with a BioRad Fluor-S MultiImager to determine signal intensities.

Nuclei from mouse livers were isolated as described 50, resuspend in glycerol storage buffer (50 mM Tris-HCl pH 8.3, 5 mM MgCl₂, 0.1 mM EDTA pH 8.0 and 40% glycerol) and flash-frozen in liquid nitrogen. Nuclei were stored at -80°C and used within 4 weeks. Mouse Rgs16, mouse Rgs8, rat GAPDH cDNA or empty plasmid vectors (5 μg) were slot-blotted onto nylon GeneScreen membrane (NEF 983, NEN life Science Products, Inc) according the manufacturer's protocol. The nuclear RNA elongation reaction, isolation of newly synthesized ³²P-RNA, and hybridization to cDNA plasmids were performed as described 51]. The amount of hybridizing ³²P-RNA was quantitated by densitometric scanning (using a Fujifilm FLA-5100 image reader) of phosphorimager screens exposed for 24 h. Data from different fasting and refeeding conditions were normalized to transcription of the GAPDH gene.

Experiments were conducted in groups of two or three mice per condition and repeated at least twice. Quantitative data for each condition or time point are represented as mean values ± SEM. GraphPad Prism software (GraphPad, San Diego, CA) was used to perform all statistical analyses. The two-tailed, unpaired Student's t-test was used to determine statistically significant differences (P < 0.05) between mean values.