<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1476-4598-7-11</ui>
   <ji>1476-4598</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Gene expression profiles in primary pancreatic tumors and metastatic lesions of Ela-<it>c-myc </it>transgenic mice</p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>Thakur</snm>
               <fnm>Archana</fnm>
               <insr iid="I1"/>
               <email>athakur@med.wayne.edu</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Bollig</snm>
               <fnm>Aliccia</fnm>
               <insr iid="I1"/>
               <email>abollig@med.wayne.edu</email>
            </au>
            <au id="A3">
               <snm>Wu</snm>
               <fnm>Jiusheng</fnm>
               <insr iid="I1"/>
               <email>jwu@med.wayne.edu</email>
            </au>
            <au id="A4" ca="yes">
               <snm>Liao</snm>
               <mi>J</mi>
               <fnm>Dezhong</fnm>
               <insr iid="I1"/>
               <email>djliao@hi.umn.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Pathology, Karmanos Cancer Institute, Wayne State University School of Medicine, 110 E. Warren Ave., Detroit, Michigan 48201, USA</p>
            </ins>
         </insg>
         <source>Molecular Cancer</source>
         <issn>1476-4598</issn>
         <pubdate>2008</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>11</fpage>
         <url>http://www.molecular-cancer.com/content/7/1/11</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18218118</pubid>
               <pubid idtype="doi">10.1186/1476-4598-7-11</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>03</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>24</day>
               <month>1</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>24</day>
               <month>1</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Thakur et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Pancreatic carcinoma usually is a fatal disease with no cure, mainly due to its invasion and metastasis prior to diagnosis. We analyzed the gene expression profiles of paired primary pancreatic tumors and metastatic lesions from Ela-<it>c-myc </it>transgenic mice in order to identify genes that may be involved in the pancreatic cancer progression. Differentially expressed selected genes were verified by semi-quantitative and quantitative RT-PCR. To further evaluate the relevance of some of the selected differentially expressed genes, we investigated their expression pattern in human pancreatic cancer cell lines with high and low metastatic potentials.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Data indicate that genes involved in posttranscriptional regulation were a major functional category of upregulated genes in both primary pancreatic tumors (PT) and liver metastatic lesions (LM) compared to normal pancreas (NP). In particular, differential expression for splicing factors, RNA binding/pre-mRNA processing factors and spliceosome related genes were observed, indicating that RNA processing and editing related events may play critical roles in pancreatic tumor development and progression. High expression of insulin growth factor binding protein-1 (Igfbp1) and Serine proteinase inhibitor A1 (Serpina1), and low levels or absence of Wt1 gene expression were exclusive to liver metastatic lesion samples.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We identified Igfbp1, Serpina1 and Wt1 genes that are likely to be clinically useful biomarkers for prognostic or therapeutic purposes in metastatic pancreatic cancer, particularly in pancreatic cancer where c-Myc is overexpressed.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Pancreatic cancer (PC) is the fourth leading cause of cancer death in the United States and has no cure, partly because the tumor is at advanced stage or has already metastasized at the time of diagnosis <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Like many other types of cancer, pancreatic cancer also shows high frequencies of overexpression and/or amplification of the c-<it>myc </it>oncogene. In one study, 43.5% of primary tumors and 31.6% of metastases showed c-Myc overexpression, in association with 32.5% and 29.4% of gene amplification in the primary and metastatic lesions, respectively <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. c-Myc and cyclin D1 gene amplification was report 54% and 28% in 31 pancreatic cancer cell lines, respectively, indicating a high frequency of concomitant amplification of both genes <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Moreover, simultaneous amplification of activated k-<it>ras </it>and c-<it>myc </it>has been found in both primary tumor and lymph node metastasis, suggesting that c-Myc may collaborate with other oncogenes to promote development and progression of pancreatic cancer <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. More direct evidence for a critical role for c-Myc in pancreatic carcinogenesis comes from Ela-c-<it>myc </it>transgenic mice that develop PC between 2&#8211;7 months of age with 100% incidence rate <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. One-half of the pancreatic tumors that form in this mouse model are acinar cell adenocarcinomas, while the remaining half of the tumors are mixed ductal and acinar cell carcinomas embedded in dense stroma. We have recently described detailed morphological traits of the pancreatic tumors developed in this transgenic model <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp> and, for the first time, observed spontaneous metastasis to the liver in this model. These transgenic mice are among the few animal models of liver metastasis of spontaneous PC. The whole carcinogenic process, from initiation to metastasis, is short (in only a few months time) and is initiated by only one gene.</p>
         <p>The most devastating aspect of all types of cancer, particularly pancreatic cancer, is the emergence of metastases in organs distant from the primary tumor, and this remains the primary cause for the poor survival of patients with pancreatic cancer <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Therefore, a search for molecular markers that can predict poor prognosis and also serve as novel targets for the development of therapies against this most aggressive disease is warranted. Transgenic animals have been widely used to dissect the role of genes and molecular pathways in cancer <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Our transgenic model will help in understanding the molecular mechanisms by which metastases are generated, which is crucial for the prevention and treatment of metastatic disease. In this study we attempted to identify genes that may be responsible for the liver metastasis of pancreatic tumors in Ela-<it>myc </it>transgenic mice.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>cDNA Microarray Analysis and Global Gene Expression Profiles</p>
            </st>
            <p>Microarray signal values were calculated from the multiple probes present on each chip for each condition and each condition was repeated at least three times. The relative intensity (fold change) of gene expression levels in the primary tumors (PT) compared to the normal pancreas (NP) is shown in Figure <figr fid="F1">1A</figr> (left panel) and fold change in gene expression in liver metastatic (LM) lesions compared to PT are presented in Figures <figr fid="F1">1A</figr> (right panel).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Gene expression profiles</p>
               </caption>
               <text>
                  <p><b>Gene expression profiles</b>. <b>A) </b>Histogram showing a similar (left) and differential (right) gene expression profiles of primary pancreatic tumors and liver metastatic lesions from Ela-<it>c-Myc </it>transgenic mice compared to normal pancreas from wild type littermates. <b>B) </b>Hierarchical clustering of differentially expressed genes. Clustering tree illustrate the expression pattern and similarity in primary pancreatic tumors (labeled as PT) and liver metastatic lesions (labeled as LM) compared to normal pancreas (labeled as NP) indicated by color bars. <b>C) </b>Shows only the differentially expressed gene profile with at least a four-fold change (&#8804;4 or &#8805;4) indicated by color bars. (blue-down regulated and red up-regulated).</p>
               </text>
               <graphic file="1476-4598-7-11-1"/>
            </fig>
            <p>Cluster analysis was used to display the gene expression data of those, which showed 4-fold higher or 4-fold lower expression levels in PT and LM compared to NP samples. Before clustering, a filtering procedure eliminated genes with uniformly low expression or with low expression variation across the replicates. A large number of genes in PT and LM showed different expression from NP. However, the majority of genes did not show obvious distinction in their expression pattern between the PT and LM (Fig. <figr fid="F1">1B</figr>), except for a small number of genes (boxed area in Fig. <figr fid="F1">1B</figr> expanded in Fig. <figr fid="F1">1C</figr>), suggesting that the LM largely retain the properties of the primary tumors.</p>
         </sec>
         <sec>
            <st>
               <p>Identification of potential tumor promoting genes in c-myc-induced pancreatic tumors</p>
            </st>
            <p>Expressed genes were categorized on the basis of their functional properties, which showed at least 4-fold higher, or 4-fold lower expression levels in primary or metastatic pancreatic tumors compared to normal pancreas. Table <tblr tid="T1">1</tblr> shows genes whose expression was upregulated in PT compared to NP (relative fold change) and also shows the relative fold change in LM compared to PT samples. Many upregulated genes such as Birc5, Ccna2, Ccnb1, Ccnb2, Mcm7, Nap1l1, Rad51, Smc4l1, Smc2l1, Rsk4, sfrs1, and sfrs2 (please see Table <tblr tid="T1">1</tblr> for their full names) showed 5&#8211;20 fold higher expression levels, very few showed exceptionally high fold changes, for example calcium binding protein-S100g showed 109 fold higher expression level in PT than in NP. A large number of upregulated genes in PT belonged to the functional categories known for cell proliferation and cell cycle regulation, chromosomal organization and biogenesis, and RNA processing and modification. In Table <tblr tid="T2">2</tblr>, we show the genes whose expression was down regulated in PT compared to NP samples (relative fold change) as well as the fold change in LM compared to PT samples. Down regulation of some of the genes in Table <tblr tid="T2">2</tblr> including Col4a4, Pcdh17, Muc2, Muc13 (please see Table <tblr tid="T2">2</tblr> for their full names) has been shown to modulate cell adhesion and apoptosis.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Upregulated genes in primary pancreatic tumors. Relative fold change in primary pancreatic tumors compared to normal pancreas (PT/NP) and in liver metastatic lesions compared to primary pancreatic tumors (LM/PT).</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Entrez Gene</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change LM*/PT*</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change PT/NP*</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Gene Symbol</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene description</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ref.*</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Mitochondrial ribosomal subunits</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>77721</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>4.2</p>
                     </c>
                     <c ca="left">
                        <p>Mrps5</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein S5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>69527</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>4.5</p>
                     </c>
                     <c ca="left">
                        <p>Mrps9</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein S9</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>94063</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="left">
                        <p>Mrpl16</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein L16</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56284</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>5.0</p>
                     </c>
                     <c ca="left">
                        <p>Mrpl19</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein L19</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>66407</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="left">
                        <p>Mrps15</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein S15</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>64655</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>7.6</p>
                     </c>
                     <c ca="left">
                        <p>Mrps22</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein S22</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>64658</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="left">
                        <p>Mrps25</p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ribosomal protein S25</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Nucleolar and nucleosome assembly proteins</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>53605</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>13.5</p>
                     </c>
                     <c ca="left">
                        <p>Nap1l1</p>
                     </c>
                     <c ca="left">
                        <p>Nucleosome assembly protein 1-like 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10, 11</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>110109</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>4.3</p>
                     </c>
                     <c ca="left">
                        <p>Nol1</p>
                     </c>
                     <c ca="left">
                        <p>Nucleolar protein 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>52530</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>10.0</p>
                     </c>
                     <c ca="left">
                        <p>Nola2</p>
                     </c>
                     <c ca="left">
                        <p>Nucleolar protein family A, member 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>100608</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>9.4</p>
                     </c>
                     <c ca="left">
                        <p>Noc4l</p>
                     </c>
                     <c ca="left">
                        <p>Nucleolar complex associated 4 homolog</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>55989</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="center">
                        <p>6.3</p>
                     </c>
                     <c ca="left">
                        <p>Nol5</p>
                     </c>
                     <c ca="left">
                        <p>Nucleolar protein 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67134</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>7.8</p>
                     </c>
                     <c ca="left">
                        <p>Nol5a</p>
                     </c>
                     <c ca="left">
                        <p>Nucleolar protein 5A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Small nuclear ribonucleoprotein complex</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>68981</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>8.7</p>
                     </c>
                     <c ca="left">
                        <p>Snrpa1</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein polypeptide A'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20638</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>8.3</p>
                     </c>
                     <c ca="left">
                        <p>Snrpb</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20641</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>7.1</p>
                     </c>
                     <c ca="left">
                        <p>Snrpd1</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein D1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67332</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>7.4</p>
                     </c>
                     <c ca="left">
                        <p>Snrpd3</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein D3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>69878</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.9</p>
                     </c>
                     <c ca="left">
                        <p>Snrpf</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein polypeptide F</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>666609</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>7.6</p>
                     </c>
                     <c ca="left">
                        <p>Snrpg</p>
                     </c>
                     <c ca="left">
                        <p>small nuclear ribonucleoprotein polypeptide G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Splicing factor</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>110809</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="left">
                        <p>Sfrs1</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor, arginine/serine-rich 1 (ASF/SF2)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20382</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>5.1</p>
                     </c>
                     <c ca="left">
                        <p>Sfrs2</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor, arginine/serine-rich 2 (SC-35)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20383</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>5.0</p>
                     </c>
                     <c ca="left">
                        <p>Sfrs3</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor, arginine/serine-rich 3 (SRp20)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>81898</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>5.2</p>
                     </c>
                     <c ca="left">
                        <p>Sf3b1</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor 3b, subunit 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>66125</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>8.0</p>
                     </c>
                     <c ca="left">
                        <p>Sf3b5</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor 3b, subunit 5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>225027</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="left">
                        <p>Sfrs7</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor, arginine/serine-rich 7</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>RNA binding and pre-mRNA processing factors</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>28000</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>4.7</p>
                     </c>
                     <c ca="left">
                        <p>Prpf19</p>
                     </c>
                     <c ca="left">
                        <p>PRP19/PSO4 pre-mRNA processing factor 19 homolog</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>68988</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>5.0</p>
                     </c>
                     <c ca="left">
                        <p>Prpf31</p>
                     </c>
                     <c ca="left">
                        <p>PRP31 pre-mRNA processing factor 31 homolog (yeast)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56194</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>5.8</p>
                     </c>
                     <c ca="left">
                        <p>Prpf40a</p>
                     </c>
                     <c ca="left">
                        <p>PRP40 pre-mRNA processing factor 40 homolog A (yeast)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56275</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="left">
                        <p>Rbm14</p>
                     </c>
                     <c ca="left">
                        <p>RNA binding motif protein 14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67071</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>16.2</p>
                     </c>
                     <c ca="left">
                        <p>Rps6ka6 (Rsk4)</p>
                     </c>
                     <c ca="left">
                        <p>Ribosomal protein S6 kinase polypeptide 6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Spliceosome complex</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>81898</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>5.2</p>
                     </c>
                     <c ca="left">
                        <p>Sf3b1</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor 3b, subunit 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>66125</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>8.0</p>
                     </c>
                     <c ca="left">
                        <p>Sf3b5</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor 3b, subunit 5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20382</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="left">
                        <p>Sfrs2</p>
                     </c>
                     <c ca="left">
                        <p>Splicing factor, arginine/serine-rich 2 (SC-35)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>68981</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>8.7</p>
                     </c>
                     <c ca="left">
                        <p>Snrpa1</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein polypeptide A'</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20638</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>8.3</p>
                     </c>
                     <c ca="left">
                        <p>Snrpb</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20641</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>7.1</p>
                     </c>
                     <c ca="left">
                        <p>Snrpd1</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein D1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>69878</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.9</p>
                     </c>
                     <c ca="left">
                        <p>Snrpf</p>
                     </c>
                     <c ca="left">
                        <p>Small nuclear ribonucleoprotein polypeptide F</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>666609</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>7.6</p>
                     </c>
                     <c ca="left">
                        <p>Snrpg</p>
                     </c>
                     <c ca="left">
                        <p>small nuclear ribonucleoprotein polypeptide G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell proliferation and cell cycle regulation related genes</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12428</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>16.6</p>
                     </c>
                     <c ca="left">
                        <p>Ccna2</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin A2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>268697</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>11.2</p>
                     </c>
                     <c ca="left">
                        <p>Ccnb1</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin B1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12429</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>17.9</p>
                     </c>
                     <c ca="left">
                        <p>Ccnb1-rs1</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin B1, related sequence 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12442</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>17.8</p>
                     </c>
                     <c ca="left">
                        <p>Ccnb2</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin B2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>15, 25</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12448</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.3</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="left">
                        <p>Ccne2</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin E2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12449</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>8.9</p>
                     </c>
                     <c ca="left">
                        <p>Ccnf</p>
                     </c>
                     <c ca="left">
                        <p>Cyclin F</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17216</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>9.0</p>
                     </c>
                     <c ca="left">
                        <p>Mcm2</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>14</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17215</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>8.6</p>
                     </c>
                     <c ca="left">
                        <p>Mcm3</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17217</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>8.6</p>
                     </c>
                     <c ca="left">
                        <p>Mcm4</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 4</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17218</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>11.8</p>
                     </c>
                     <c ca="left">
                        <p>Mcm5</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17219</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>20.1</p>
                     </c>
                     <c ca="left">
                        <p>Mcm6</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17220</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>11.0</p>
                     </c>
                     <c ca="left">
                        <p>Mcm7</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 7</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>14</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>70024</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.3</p>
                     </c>
                     <c ca="left">
                        <p>Mcm10</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11799</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>11.1</p>
                     </c>
                     <c ca="left">
                        <p>Birc5</p>
                     </c>
                     <c ca="left">
                        <p>Baculoviral IAP repeat-containing 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12211</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>4.4</p>
                     </c>
                     <c ca="left">
                        <p>Birc6</p>
                     </c>
                     <c ca="left">
                        <p>Baculoviral IAP repeat-containing 6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12189</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="left">
                        <p>Brca1</p>
                     </c>
                     <c ca="left">
                        <p>Breast cancer 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>70099</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>17.3</p>
                     </c>
                     <c ca="left">
                        <p>Smc4l1</p>
                     </c>
                     <c ca="left">
                        <p>Structural maintenance of chromosomes 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19361</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>15.1</p>
                     </c>
                     <c ca="left">
                        <p>Rad51</p>
                     </c>
                     <c ca="left">
                        <p>RAD51 homolog (S. cerevisiae)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell adhesion and migration</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12774</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.7</p>
                     </c>
                     <c ca="left">
                        <p>Ccr5</p>
                     </c>
                     <c ca="left">
                        <p>Chemokine (C-C motif) receptor 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56492</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>6.6</p>
                     </c>
                     <c ca="left">
                        <p>Cldn18</p>
                     </c>
                     <c ca="left">
                        <p>Claudin 18</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell communication and signal trasduction</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>75590</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="center">
                        <p>30.3</p>
                     </c>
                     <c ca="left">
                        <p>Dusp9</p>
                     </c>
                     <c ca="left">
                        <p>Dual specificity phosphatase 9</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67071</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>16.2</p>
                     </c>
                     <c ca="left">
                        <p>Rps6ka6 (Rsk4)</p>
                     </c>
                     <c ca="left">
                        <p>Ribosomal protein S6 kinase polypeptide 6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12774</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.7</p>
                     </c>
                     <c ca="left">
                        <p>Ccr5</p>
                     </c>
                     <c ca="left">
                        <p>Chemokine (C-C motif) receptor 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56275</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="left">
                        <p>Rbm14</p>
                     </c>
                     <c ca="left">
                        <p>RNA binding motif protein 14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12309</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="center">
                        <p>109.4</p>
                     </c>
                     <c ca="left">
                        <p>S100g</p>
                     </c>
                     <c ca="left">
                        <p>S100 calcium binding protein G</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10, 25</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Apoptosis regulation related</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11799</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>11.1</p>
                     </c>
                     <c ca="left">
                        <p>Birc5</p>
                     </c>
                     <c ca="left">
                        <p>Baculoviral IAP repeat-containing 5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17218</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>11.8</p>
                     </c>
                     <c ca="left">
                        <p>Mcm5</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 5,</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17319</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>6.8</p>
                     </c>
                     <c ca="left">
                        <p>Mif</p>
                     </c>
                     <c ca="left">
                        <p>Macrophage migration inhibitory factor</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Chromosome organization and biogenesis</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14211</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>12.7</p>
                     </c>
                     <c ca="left">
                        <p>Smc2l1</p>
                     </c>
                     <c ca="left">
                        <p>Structural maintenance of chromosomes 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>70099</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>17.3</p>
                     </c>
                     <c ca="left">
                        <p>Smc4l1</p>
                     </c>
                     <c ca="left">
                        <p>Structural maintenance of chromosomes 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>226026</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>5.4</p>
                     </c>
                     <c ca="left">
                        <p>Smc5l1</p>
                     </c>
                     <c ca="left">
                        <p>Structural maintenance of chromosomes 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19361</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>15.1</p>
                     </c>
                     <c ca="left">
                        <p>Rad51</p>
                     </c>
                     <c ca="left">
                        <p>RAD51 homolog (S. cerevisiae)</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>12</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12189</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="left">
                        <p>Brca1</p>
                     </c>
                     <c ca="left">
                        <p>Breast cancer 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>53605</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>13.5</p>
                     </c>
                     <c ca="left">
                        <p>Nap1l1</p>
                     </c>
                     <c ca="left">
                        <p>Nucleosome assembly protein 1-like 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10, 11</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17216</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>9.0</p>
                     </c>
                     <c ca="left">
                        <p>Mcm2</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 2 mitotin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17218</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>11.8</p>
                     </c>
                     <c ca="left">
                        <p>Mcm5</p>
                     </c>
                     <c ca="left">
                        <p>Minichromosome maintenance deficient 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Transcriptional regulator</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22431</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="center">
                        <p>2.7</p>
                     </c>
                     <c ca="left">
                        <p>Wt1</p>
                     </c>
                     <c ca="left">
                        <p>Wilms' tumor suppressor gene</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>57</b>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>NP = Normal pancreas; PT = Primary pancreatic tumor; LM = liver metastatic lesion; Ref</b>.* = References identifying genes previously shown to have deregulated expression in pancreatic cancer</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Downregulated genes in primary pancreatic tumors. Relative fold change in primary pancreatic tumors compared to normal pancreas (PT/NP) and in liver metastatic lesions compared to primary pancreatic tumors (LM/PT)</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Entrez Gene#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change LM/PT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change PT/NP</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Gene Symbol</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene description</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ref.*</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell adhesion, motility and migration</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12340</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.84</p>
                     </c>
                     <c ca="center">
                        <p>-11.6</p>
                     </c>
                     <c ca="left">
                        <p>Capza1</p>
                     </c>
                     <c ca="left">
                        <p>Capping protein (actin filament) muscle Z-line, alpha 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12829</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>-10.8</p>
                     </c>
                     <c ca="left">
                        <p>Col4a4</p>
                     </c>
                     <c ca="left">
                        <p>Procollagen, type IV, alpha 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13643</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-7.6</p>
                     </c>
                     <c ca="left">
                        <p>Efnb3</p>
                     </c>
                     <c ca="left">
                        <p>Ephrin B3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>215384</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.03</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Fcgbp</p>
                     </c>
                     <c ca="left">
                        <p>Fc fragment of IgG binding protein</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16855</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-6.4</p>
                     </c>
                     <c ca="left">
                        <p>Lgals4</p>
                     </c>
                     <c ca="left">
                        <p>Lectin, galactose binding, soluble 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17831</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Muc2</p>
                     </c>
                     <c ca="left">
                        <p>Mucin 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>219228</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.51</p>
                     </c>
                     <c ca="center">
                        <p>-18.8</p>
                     </c>
                     <c ca="left">
                        <p>Pcdh17</p>
                     </c>
                     <c ca="left">
                        <p>Protocadherin 17</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>68799</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.20</p>
                     </c>
                     <c ca="center">
                        <p>-7.2</p>
                     </c>
                     <c ca="left">
                        <p>Rgmb</p>
                     </c>
                     <c ca="left">
                        <p>RGM domain family, member B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16855</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-6.4</p>
                     </c>
                     <c ca="left">
                        <p>Lgals4</p>
                     </c>
                     <c ca="left">
                        <p>Lectin, galactose binding, soluble 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell communication and signal trasduction</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12154</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Bmp10</p>
                     </c>
                     <c ca="left">
                        <p>Bone morphogenetic protein 10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13643</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-7.6</p>
                     </c>
                     <c ca="left">
                        <p>Efnb3</p>
                     </c>
                     <c ca="left">
                        <p>Ephrin B3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14463</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.01</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Gata4</p>
                     </c>
                     <c ca="left">
                        <p>GATA binding protein 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15874</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Iapp</p>
                     </c>
                     <c ca="left">
                        <p>Islet amyloid polypeptide</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16333</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>-23.2</p>
                     </c>
                     <c ca="left">
                        <p>Ins1</p>
                     </c>
                     <c ca="left">
                        <p>Insulin I</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14526</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-21.6</p>
                     </c>
                     <c ca="left">
                        <p>Gcg</p>
                     </c>
                     <c ca="left">
                        <p>Glucagon</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>70497</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.86</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Arhgap17</p>
                     </c>
                     <c ca="left">
                        <p>Rho GTPase activating protein 17</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>232201</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.83</p>
                     </c>
                     <c ca="center">
                        <p>-7.6</p>
                     </c>
                     <c ca="left">
                        <p>Arhgap25</p>
                     </c>
                     <c ca="left">
                        <p>Rho GTPase activating protein 25</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>110052</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-8.4</p>
                     </c>
                     <c ca="left">
                        <p>Dek</p>
                     </c>
                     <c ca="left">
                        <p>DEK oncogene (DNA binding)</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14915</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>-13.6</p>
                     </c>
                     <c ca="left">
                        <p>Guca2a</p>
                     </c>
                     <c ca="left">
                        <p>Guanylate cyclase activator 2a (guanylin)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>212307</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.81</p>
                     </c>
                     <c ca="center">
                        <p>-7.2</p>
                     </c>
                     <c ca="left">
                        <p>Mapre2</p>
                     </c>
                     <c ca="left">
                        <p>Microtubule-associated protein, RP/EB family, member 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20844</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.15</p>
                     </c>
                     <c ca="center">
                        <p>-13.6</p>
                     </c>
                     <c ca="left">
                        <p>Stam</p>
                     </c>
                     <c ca="left">
                        <p>Signal transducing adaptor molecule</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>66042</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>-14.8</p>
                     </c>
                     <c ca="left">
                        <p>Sostdc1</p>
                     </c>
                     <c ca="left">
                        <p>Sclerostin domain containing 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>68799</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.20</p>
                     </c>
                     <c ca="center">
                        <p>-7.2</p>
                     </c>
                     <c ca="left">
                        <p>Rgmb</p>
                     </c>
                     <c ca="left">
                        <p>RGM domain family, member B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>80718</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-6.4</p>
                     </c>
                     <c ca="left">
                        <p>Rab27b</p>
                     </c>
                     <c ca="left">
                        <p>RAB27b, member RAS oncogene family</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>18386</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.93</p>
                     </c>
                     <c ca="center">
                        <p>-6</p>
                     </c>
                     <c ca="left">
                        <p>Oprd1</p>
                     </c>
                     <c ca="left">
                        <p>Opioid receptor, delta 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67709</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.88</p>
                     </c>
                     <c ca="center">
                        <p>-13.6</p>
                     </c>
                     <c ca="left">
                        <p>Reg4</p>
                     </c>
                     <c ca="left">
                        <p>Regenerating islet-derived family, member 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell cycle and cell proliferation</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>76499</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-8.8</p>
                     </c>
                     <c ca="left">
                        <p>Clasp2</p>
                     </c>
                     <c ca="left">
                        <p>CLIP associating protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16333</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>-23.2</p>
                     </c>
                     <c ca="left">
                        <p>Ins1</p>
                     </c>
                     <c ca="left">
                        <p>Insulin I</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16334</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Ins2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin II</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>212307</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.81</p>
                     </c>
                     <c ca="center">
                        <p>-7.2</p>
                     </c>
                     <c ca="left">
                        <p>Mapre2</p>
                     </c>
                     <c ca="left">
                        <p>Microtubule-associated protein, RP/EB family, member 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22268</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.90</p>
                     </c>
                     <c ca="center">
                        <p>-6</p>
                     </c>
                     <c ca="left">
                        <p>Upk1b</p>
                     </c>
                     <c ca="left">
                        <p>Uroplakin 1B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14526</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-21.6</p>
                     </c>
                     <c ca="left">
                        <p>Gcg</p>
                     </c>
                     <c ca="left">
                        <p>Glucagon</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>212307</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.81</p>
                     </c>
                     <c ca="center">
                        <p>-7.2</p>
                     </c>
                     <c ca="left">
                        <p>Mapre2</p>
                     </c>
                     <c ca="left">
                        <p>Microtubule-associated protein, RP/EB family, member 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>57263</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.11</p>
                     </c>
                     <c ca="center">
                        <p>-28</p>
                     </c>
                     <c ca="left">
                        <p>Retnlb</p>
                     </c>
                     <c ca="left">
                        <p>Resistin like beta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12154</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Bmp10</p>
                     </c>
                     <c ca="left">
                        <p>Bone morphogenetic protein 10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17831</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Muc2</p>
                     </c>
                     <c ca="left">
                        <p>Mucin 2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>19</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17063</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-60</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Muc13</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Mucin 13, epithelial transmembrane</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Transporter and binding activity</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11773</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>-14.8</p>
                     </c>
                     <c ca="left">
                        <p>Ap2m1</p>
                     </c>
                     <c ca="left">
                        <p>Adaptor protein complex AP-2, mu1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>80718</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-6.4</p>
                     </c>
                     <c ca="left">
                        <p>Rab27b</p>
                     </c>
                     <c ca="left">
                        <p>RAB27b, member RAS oncogene family</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56185</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-19.2</p>
                     </c>
                     <c ca="left">
                        <p>Hao3</p>
                     </c>
                     <c ca="left">
                        <p>Hydroxyacid oxidase (glycolate oxidase) 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>110052</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-8.4</p>
                     </c>
                     <c ca="left">
                        <p>Dek</p>
                     </c>
                     <c ca="left">
                        <p>DEK oncogene (DNA binding)</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12829</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>-10.8</p>
                     </c>
                     <c ca="left">
                        <p>Col4a4</p>
                     </c>
                     <c ca="left">
                        <p>Procollagen, type IV, alpha 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16467</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.13</p>
                     </c>
                     <c ca="center">
                        <p>-11.6</p>
                     </c>
                     <c ca="left">
                        <p>Atcay</p>
                     </c>
                     <c ca="left">
                        <p>Ataxia, cerebellar, Cayman type homolog (human)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13487</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.95</p>
                     </c>
                     <c ca="center">
                        <p>-20</p>
                     </c>
                     <c ca="left">
                        <p>Slc26a3</p>
                     </c>
                     <c ca="left">
                        <p>Solute carrier family 26, member 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>216156</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.92</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Wdr18</p>
                     </c>
                     <c ca="left">
                        <p>WD repeat domain 18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>69008</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.23</p>
                     </c>
                     <c ca="center">
                        <p>-6.4</p>
                     </c>
                     <c ca="left">
                        <p>Cab39l</p>
                     </c>
                     <c ca="left">
                        <p>Calcium binding protein 39-like</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12351</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.84</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Car4</p>
                     </c>
                     <c ca="left">
                        <p>Carbonic anhydrase 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>72832</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.93</p>
                     </c>
                     <c ca="center">
                        <p>-14.8</p>
                     </c>
                     <c ca="left">
                        <p>Crtac1</p>
                     </c>
                     <c ca="left">
                        <p>Cartilage acidic protein 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>75600</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.20</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Calml4</p>
                     </c>
                     <c ca="left">
                        <p>Calmodulin-like 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Apoptosis</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15874</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Iapp</p>
                     </c>
                     <c ca="left">
                        <p>Islet amyloid polypeptide</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17831</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Muc2</p>
                     </c>
                     <c ca="left">
                        <p>Mucin 2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>19</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>71361</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.15</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Amid</p>
                     </c>
                     <c ca="left">
                        <p>Apoptosis-inducing factor, mitochondrion-associated 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16334</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>-40</p>
                     </c>
                     <c ca="left">
                        <p>Ins2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin II</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17063</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>-60</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Muc13</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Mucin 13, epithelial transmembrane</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Transcription activity</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>109275</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.94</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Actr5</p>
                     </c>
                     <c ca="left">
                        <p>ARP5 actin-related protein 5 homolog (yeast)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>71458</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.89</p>
                     </c>
                     <c ca="center">
                        <p>-6</p>
                     </c>
                     <c ca="left">
                        <p>Bcor</p>
                     </c>
                     <c ca="left">
                        <p>Bcl6 interacting corepressor</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14463</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.01</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Gata4</p>
                     </c>
                     <c ca="left">
                        <p>GATA binding protein 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Epigenetic and chromatin modification</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>213742</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-8.8</p>
                     </c>
                     <c ca="left">
                        <p>Xist</p>
                     </c>
                     <c ca="left">
                        <p>Inactive X specific transcripts</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>75796</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.86</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Cdyl2</p>
                     </c>
                     <c ca="left">
                        <p>Chromodomain protein, Y chromosome-like 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Inflammatory and immune response</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>21786</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.90</p>
                     </c>
                     <c ca="center">
                        <p>-10.8</p>
                     </c>
                     <c ca="left">
                        <p>Tff3</p>
                     </c>
                     <c ca="left">
                        <p>Trefoil factor 3, intestinal</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15101</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.90</p>
                     </c>
                     <c ca="center">
                        <p>-7.6</p>
                     </c>
                     <c ca="left">
                        <p>H60</p>
                     </c>
                     <c ca="left">
                        <p>Histocompatibility 60</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>94071</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Clec2h</p>
                     </c>
                     <c ca="left">
                        <p>C-type lectin domain family 2, member h</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell differentiation</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12154</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Bmp10</p>
                     </c>
                     <c ca="left">
                        <p>Bone morphogenetic protein 10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14463</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.01</p>
                     </c>
                     <c ca="center">
                        <p>-8</p>
                     </c>
                     <c ca="left">
                        <p>Gata4</p>
                     </c>
                     <c ca="left">
                        <p>GATA binding protein 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>72324</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.86</p>
                     </c>
                     <c ca="center">
                        <p>-4</p>
                     </c>
                     <c ca="left">
                        <p>Plxdc1</p>
                     </c>
                     <c ca="left">
                        <p>Plexin domain containing 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20755</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.31</p>
                     </c>
                     <c ca="center">
                        <p>-16</p>
                     </c>
                     <c ca="left">
                        <p>Sprr2a</p>
                     </c>
                     <c ca="left">
                        <p>Small proline-rich protein 2A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22268</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.90</p>
                     </c>
                     <c ca="center">
                        <p>-6</p>
                     </c>
                     <c ca="left">
                        <p>Upk1b</p>
                     </c>
                     <c ca="left">
                        <p>Uroplakin 1B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>75770</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>-8.4</p>
                     </c>
                     <c ca="left">
                        <p>Brsk2</p>
                     </c>
                     <c ca="left">
                        <p>BR serine/threonine kinase 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Maintenance of cell polarity and shape</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>76499</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.02</p>
                     </c>
                     <c ca="center">
                        <p>-8.8</p>
                     </c>
                     <c ca="left">
                        <p>Clasp2</p>
                     </c>
                     <c ca="left">
                        <p>CLIP associating protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20755</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.31</p>
                     </c>
                     <c ca="center">
                        <p>-16</p>
                     </c>
                     <c ca="left">
                        <p>Sprr2a</p>
                     </c>
                     <c ca="left">
                        <p>Small proline-rich protein 2A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>Ref</b>.* = References identifying genes previously shown to have deregulated expression in pancreatic cancer</p>
               </tblfn>
            </tbl>
            <p>Selected genes (highlighted in Table <tblr tid="T1">1</tblr>, <tblr tid="T2">2</tblr> and <tblr tid="T3">3</tblr>) from various functional categories were further verified by RT-PCR for their expression patterns (Fig. <figr fid="F2">2A</figr>). This selection was based on results in the literature indicating a direct or indirect role for each candidate gene in RNA processing, cell signaling, cell proliferation or apoptosis and cell adhesion and motility activities resulting in tumor growth and tumor progression. Many of these genes listed in Table <tblr tid="T1">1</tblr>and <tblr tid="T2">2</tblr>, such as Birc5, Brca1, Ccnb2, CXCR4, Mcm2, Mcm4, Mcm7, Nap1l1, Rad51, Sf3b, S100g <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>have been shown to be upregulated, while Cldn18, Muc2, Muc13, and b-myc <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>are shown to be down regulated in human pancreatic cancer as well as other types of cancer (please see Table <tblr tid="T1">1</tblr> and <tblr tid="T2">2</tblr>for their full names). However, strong expression of Muc13 in 50% of samples as well as b-<it>myc </it>in pancreatic cancer cells was unexpected and needs further characterization.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Selected genes showing up- or down regulation of mRNA expression by semi quantitative RT-PCR</p>
               </caption>
               <text>
                  <p><b>Selected genes showing up- or down regulation of mRNA expression by semi quantitative RT-PCR</b>. <b>A) </b>All selected genes showed expression pattern similar to microarray data upon confirmation by sqRT-PCR. A representative data from four Ela-<it>c-myc </it>pancreatic tumors, liver metastatic lesions and normal pancreas is presented. <b>B) </b>RT-PCR showing representative differentially expressed genes in liver metastatic lesions compared to primary pancreatic tumors and normal pancreas. <b>C) </b>Two genes, Igfbp1 and Serpina1a, were verified in human pancreatic cancer cell lines with high (High-met) and low metastatic (Low-met) potentials. Expression patterns of both genes were consistent with the murine microarray and RT-PCR data. <b>D) </b>RT-PCR was performed on RNA from primary pancreatic tumors (PT), liver metastatic lesions (LM) and normal pancreas (NP) with three overlapping primer sets spanning the region from exon 1 to 10. Primary pancreatic tumors showed presence of both wild type Wt1 and Wt1 variant without exon 5, while metastatic lesions either lacked expression or had low levels of Wt1 gene expression (showed a smaller size non-specific PCR product only).</p>
               </text>
               <graphic file="1476-4598-7-11-2"/>
            </fig>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Upregulated genes in liver metastatic lesions. Relative fold change in liver metastatic lesions compared to primary pancreatic tumors (LM/PT) and in primary pancreatic tumors compared to normal pancreas (PT/NP)</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Entrez Gene #</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change LM/PT</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change PT/NP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene Symbol</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene description</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ref.*</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Transporter activity</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>27413</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.1</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Abcb11</p>
                     </c>
                     <c ca="left">
                        <p>ATP-binding cassette, sub-family B (MDR/TAP), member 11</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12870</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11.8</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Cp</p>
                     </c>
                     <c ca="left">
                        <p>Ceruloplasmin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>107141</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.2</p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="left">
                        <p>Cyp2c37</p>
                     </c>
                     <c ca="left">
                        <p>Cytochrome P450, family 2. subfamily c, polypeptide 37</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>76279</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9.1</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Cyp2d26</p>
                     </c>
                     <c ca="left">
                        <p>Cytochrome P450, family 2. subfamily d, polypeptide 26</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13107</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.8</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Cyp2f2</p>
                     </c>
                     <c ca="left">
                        <p>Cytochrome P450, family 2, subfamily f, polypeptide 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14263</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11.3</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Fmo5</p>
                     </c>
                     <c ca="left">
                        <p>Flavin containing monooxygenase 5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>268756</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9.0</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Gulo</p>
                     </c>
                     <c ca="left">
                        <p>Gulonolactone (L-) oxidase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20493</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>8.3</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Slc10a1</p>
                     </c>
                     <c ca="left">
                        <p>Solute carrier family 10 member 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>69354</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>8.3</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Slc38a4</p>
                     </c>
                     <c ca="left">
                        <p>Solute carrier family 38, member 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>28253</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Slco1b2</p>
                     </c>
                     <c ca="left">
                        <p>Solute carrier organic anion transporter family, member 1b2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cellular metabolism</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>67758</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>10.6</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Aadac</p>
                     </c>
                     <c ca="left">
                        <p>Arylacetamide deacetylase (esterase)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>208665</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11.4</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Akr1d1</p>
                     </c>
                     <c ca="left">
                        <p>Aldo-keto reductase family 1, member D1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11806</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>43.3</p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="left">
                        <p>Apoa1</p>
                     </c>
                     <c ca="left">
                        <p>Apolipoprotein A-I</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>238055</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>12.2</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Apob</p>
                     </c>
                     <c ca="left">
                        <p>Apolipoprotein B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12116</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>33.0</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Bhmt</p>
                     </c>
                     <c ca="left">
                        <p>Betaine-homocysteine methyltransferase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14121</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9.3</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>Fbp1</p>
                     </c>
                     <c ca="left">
                        <p>Fructose bisphosphatase 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>227231</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>33.6</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Cps1</p>
                     </c>
                     <c ca="left">
                        <p>Carbamoyl-phosphate synthetase 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>231396</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>14.8</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Ugt2b36</p>
                     </c>
                     <c ca="left">
                        <p>UDP glucuronosyltransferase 2 family, polypeptide B36</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15233</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.9</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Hgd</p>
                     </c>
                     <c ca="left">
                        <p>Homogentisate 1, 2-dioxygenase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15483</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.2</p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="left">
                        <p>Hsd11b1</p>
                     </c>
                     <c ca="left">
                        <p>Hydroxysteroid 11-beta dehydrogenase 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13850</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.8</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Ephx2</p>
                     </c>
                     <c ca="left">
                        <p>Epoxide hydrolase 2, cytoplasmic</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13077</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.0</p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="left">
                        <p>Cyp1a2</p>
                     </c>
                     <c ca="left">
                        <p>Cytochrome P450, family 1, subfamily a, polypeptide 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>54150</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>18.2</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Rdh7</p>
                     </c>
                     <c ca="left">
                        <p>Retinol dehydrogenase 7</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>72094</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.4</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Ugt2a3</p>
                     </c>
                     <c ca="left">
                        <p>UDP glucuronosyltransferase 2 family, polypeptide A3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>103149</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.3</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Upb1</p>
                     </c>
                     <c ca="left">
                        <p>Ureidopropionase, beta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16922</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.4</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Phyh</p>
                     </c>
                     <c ca="left">
                        <p>Phytanoyl-CoA hydroxylase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Calcium binding activity</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19733</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11.6</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Rgn</p>
                     </c>
                     <c ca="left">
                        <p>Regucalcin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14067</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.9</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>F5</p>
                     </c>
                     <c ca="left">
                        <p>Coagulation factor V</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16426</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>48.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Itih3</p>
                     </c>
                     <c ca="left">
                        <p>Inter-alpha trypsin inhibitor, heavy chain 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell organization and biogenesis</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11625</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>40.5</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Ahsg</p>
                     </c>
                     <c ca="left">
                        <p>Alpha-2-HS-glycoprotein</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19699</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Reln</p>
                     </c>
                     <c ca="left">
                        <p>Reelin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16008</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Igfbp2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin-like growth factor binding protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14080</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>74.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Fabp1</p>
                     </c>
                     <c ca="left">
                        <p>Fatty acid binding protein 1, liver</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Protease Inhibitor activity</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20700</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>24.9</p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Serpina1a</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Serine (or cysteine) peptidase inhibitor, clade A, member 1a</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>25, 51</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20702</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>100.1</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Serpina1c</p>
                     </c>
                     <c ca="left">
                        <p>Serine (or cysteine) peptidase inhibitor, clade A, member 1c</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>59083</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>22.8</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Fetub</p>
                     </c>
                     <c ca="left">
                        <p>Fetuin beta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Inflammatory and Immune response</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12628</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.4</p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="left">
                        <p>Cfh</p>
                     </c>
                     <c ca="left">
                        <p>Complement component factor h</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17175</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.5</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Masp2</p>
                     </c>
                     <c ca="left">
                        <p>Mannan-binding lectin serine peptidase 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11625</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>40.5</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Ahsg</p>
                     </c>
                     <c ca="left">
                        <p>Alpha-2-HS-glycoprotein</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15439</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>14.4</p>
                     </c>
                     <c ca="center">
                        <p>7.6</p>
                     </c>
                     <c ca="left">
                        <p>Hp</p>
                     </c>
                     <c ca="left">
                        <p>Haptoglobin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>18405</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>15.8</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="left">
                        <p>Orm1</p>
                     </c>
                     <c ca="left">
                        <p>Orosomucoid 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12583</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>8.4</p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="left">
                        <p>Cdo1</p>
                     </c>
                     <c ca="left">
                        <p>Cysteine dioxygenase 1, cytosolic</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>13850</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.8</p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="left">
                        <p>Ephx2</p>
                     </c>
                     <c ca="left">
                        <p>Epoxide hydrolase 2, cytoplasmic</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11699</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>90.2</p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="left">
                        <p>Ambp</p>
                     </c>
                     <c ca="left">
                        <p>Alpha 1 microglobulin/bikunin</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>28</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell Adhesion</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12558</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Cdh2</p>
                     </c>
                     <c ca="left">
                        <p>Cadherin 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14067</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.9</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>F5</p>
                     </c>
                     <c ca="left">
                        <p>Coagulation factor V</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16008</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Igfbp2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin-like growth factor binding protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19699</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Reln</p>
                     </c>
                     <c ca="left">
                        <p>Reelin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17175</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.5</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Masp2</p>
                     </c>
                     <c ca="left">
                        <p>Mannan-binding lectin serine peptidase 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14080</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>74.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Fabp1</p>
                     </c>
                     <c ca="left">
                        <p>Fatty acid binding protein 1, liver</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell growth and cell cycle</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14080</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>74.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Fabp1</p>
                     </c>
                     <c ca="left">
                        <p>Fatty acid binding protein 1, liver</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16008</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Igfbp2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin-like growth factor binding protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11625</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>40.5</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Ahsg</p>
                     </c>
                     <c ca="left">
                        <p>Alpha-2-HS-glycoprotein</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell motility and migration</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12558</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Cdh2</p>
                     </c>
                     <c ca="left">
                        <p>Cadherin 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19699</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Reln</p>
                     </c>
                     <c ca="left">
                        <p>Reelin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16841</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.8</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Lect2</p>
                     </c>
                     <c ca="left">
                        <p>Leukocyte cell-derived chemotaxin 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20315</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.5</p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c ca="left">
                        <p>Cxcl12</p>
                     </c>
                     <c ca="left">
                        <p>Chemokine (C-X-C motif) ligand 12</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12738</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.8</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Cldn2</p>
                     </c>
                     <c ca="left">
                        <p>Claudin 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell communication and Signal Transduction</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>208665</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11.4</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Akr1d1</p>
                     </c>
                     <c ca="left">
                        <p>Aldo-keto reductase family 1, member D1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22139</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>38.8</p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Ttr</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Transthyretin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16008</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Igfbp2</p>
                     </c>
                     <c ca="left">
                        <p>Insulin-like growth factor binding protein 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20526</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>13.1</p>
                     </c>
                     <c ca="center">
                        <p>0.3</p>
                     </c>
                     <c ca="left">
                        <p>Slc2a2</p>
                     </c>
                     <c ca="left">
                        <p>Solute carrier family 2, member 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>238055</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>12.2</p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="left">
                        <p>Apob</p>
                     </c>
                     <c ca="left">
                        <p>Apolipoprotein B</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>50765</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.4</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>Trfr2</p>
                     </c>
                     <c ca="left">
                        <p>Transferrin receptor 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>107146</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.7</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>Glyat</p>
                     </c>
                     <c ca="left">
                        <p>Glycine-N-acyltransferase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>51811</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.7</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>Clec4f</p>
                     </c>
                     <c ca="left">
                        <p>C-type lectin domain family 4, member f</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>14080</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>74.7</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="left">
                        <p>Fabp1</p>
                     </c>
                     <c ca="left">
                        <p>Fatty acid binding protein 1, liver</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>56720</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.0</p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="left">
                        <p>Tdo2</p>
                     </c>
                     <c ca="left">
                        <p>Tryptophan 2,3-dioxygenase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11625</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>40.5</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="left">
                        <p>Ahsg</p>
                     </c>
                     <c ca="left">
                        <p>Alpha-2-HS-glycoprotein</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>353283</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.1</p>
                     </c>
                     <c ca="center">
                        <p>42.0</p>
                     </c>
                     <c ca="left">
                        <p>Eras</p>
                     </c>
                     <c ca="left">
                        <p>ES cell-expressed Ras</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>19699</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.5</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="left">
                        <p>Reln</p>
                     </c>
                     <c ca="left">
                        <p>Reelin</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>16006</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>28.1</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="left">
                        <p>I<b>gfbp1</b></p>
                     </c>
                     <c ca="left">
                        <p>Insulin-like growth factor binding protein 1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>28,30,31</b>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>Ref</b>.* = References identifying genes previously shown to have deregulated expression in pancreatic cancer</p>
               </tblfn>
            </tbl>
            <p>We evidenced notable changes in the family members of insulin-like growth factor (Igf). While Igf1 expression was slightly decreased in tumors compared with normal pancreas in the wild type littermates, Igf2 expression was dramatically increased (Fig <figr fid="F3">3A</figr>). All three receptors for Igf1 and Igf2 showed only slight increase in their expression, on the other hand all Igf binding proteins (Igfbp1, Igfbp2, Igfbp3, Igf2bp1 etc.) were downregulated compared to normal pancreas. Western blot analysis confirmed increased expression of cleaved, active form of Igf2 (Fig <figr fid="F3">3B</figr>).</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Expression of IGF family genes and proteins</p>
               </caption>
               <text>
                  <p><b>Expression of IGF family genes and proteins</b>. <b>A) </b>Microarray data show that expression of Igf2 is about 10 fold higher in pancreatic tumors compared to liver metastatic lesions and normal pancreas from Ela-<it>myc </it>transgenic mice. While other IGF family proteins only showed modest change. <b>B) </b>Western blot analysis of Insulin like growth factors and their receptor proteins. Western blot was performed in cell lysates prepared from primary pancreatic tumors (PT), liver metastatic lesions (LM) from Ela-<it>c-myc </it>transgenic mice and normal pancreas (NP) from wild type littermates. Consistent with microarray data, PT samples showed noticeably higher protein levels compared to NP samples. A representative data from four PT and four NP samples are presented.</p>
               </text>
               <graphic file="1476-4598-7-11-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Identification of potential metastasis promoting genes in c-<it>myc </it>induced pancreatic tumors</p>
            </st>
            <p>As mentioned above, we identified a small number of genes that were under various functional categories in metastatic tissues, which were either significantly upregulated or downregulated compared to PT. Interestingly, genes that were downregulated in liver metastatic lesions were comparatively much fewer than upregulated genes. Table <tblr tid="T3">3</tblr> shows 4-fold higher and Table <tblr tid="T4">4</tblr>, 4-fold lower expression levels in LM compared to PT. Most of the highly upregulated genes such as Cp, Apoa1, Ttr in liver metastatic lesions are known biomarkers for the detection of ovarian or other types of cancer <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. Other highly upregulated genes were related to protease inhibition such as Serpina1a, Serpina1c, Ambp <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>and insulin growth factor binding proteins such as Igfbp1 and Ifgbp2 <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>, which have been shown to be upregulated in human pancreatic cancer as well as in the animal models of either pancreatic cancer or other types of cancer. For the verification of some of these genes, we selected two upregulated and two downregulated genes, that showed striking differences from primary pancreatic tumors. In line with our mocroarray data, all LM samples verified by RT-PCR showed highly consistent results (Figure <figr fid="F2">2B</figr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Downregulated genes in liver metastatic lesions. Relative fold change in liver metastatic lesions compared to primary pancreatic tumors (LM/PT) and in primary pancreatic tumors compared to normal pancreas (PT/NP)</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Entrez Gene #</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>LM/PT</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>PT/NP</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Gene Symbol</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Gene description</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ref.*</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell communication and Signal transduction</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22329</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="center">
                        <p>23.5</p>
                     </c>
                     <c ca="left">
                        <p>Vcam1</p>
                     </c>
                     <c ca="left">
                        <p>Vascular cell adhesion molecule 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>58194</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="center">
                        <p>4.0</p>
                     </c>
                     <c ca="left">
                        <p>Sh3kbp1</p>
                     </c>
                     <c ca="left">
                        <p>SH3-domain kinase binding protein 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15186</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c ca="center">
                        <p>15.0</p>
                     </c>
                     <c ca="left">
                        <p>Hdc</p>
                     </c>
                     <c ca="left">
                        <p>Histidine decarboxylase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11438</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="left">
                        <p>Chrna4</p>
                     </c>
                     <c ca="left">
                        <p>Cholinergic receptor, nicotinic, alpha polypeptide 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12524</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="center">
                        <p>4.6</p>
                     </c>
                     <c ca="left">
                        <p>Cd86</p>
                     </c>
                     <c ca="left">
                        <p>CD86 antigen</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>93761</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="center">
                        <p>4.2</p>
                     </c>
                     <c ca="left">
                        <p>Smarca1</p>
                     </c>
                     <c ca="left">
                        <p>SWI/SNF related, regulator of chromatin, subfamily a, member 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell motility and migration</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12767</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="center">
                        <p>4.7</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Cxcr4</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Chemokine (C-X-C motif) receptor 4</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>25</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>17381</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.8</p>
                     </c>
                     <c ca="center">
                        <p>7.6</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Mmp12</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Matrix metallopeptidase 12</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11438</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="left">
                        <p>Chrna4</p>
                     </c>
                     <c ca="left">
                        <p>Cholinergic receptor, nicotinic, alpha polypeptide 4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell Adhesion</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>12505</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="center">
                        <p>5.3</p>
                     </c>
                     <c ca="left">
                        <p>Cd44</p>
                     </c>
                     <c ca="left">
                        <p>CD44 antigen</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>11</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>22329</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c ca="center">
                        <p>23.5</p>
                     </c>
                     <c ca="left">
                        <p>Vcam1</p>
                     </c>
                     <c ca="left">
                        <p>Vascular cell adhesion molecule 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Cell death and apoptosis</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>18616</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="center">
                        <p>11.2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Peg3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Paternally expressed 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>11801</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.6</p>
                     </c>
                     <c ca="center">
                        <p>31.1</p>
                     </c>
                     <c ca="left">
                        <p>Cd5l</p>
                     </c>
                     <c ca="left">
                        <p>CD5 antigen-like</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>58194</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="center">
                        <p>4.0</p>
                     </c>
                     <c ca="left">
                        <p>Sh3kbp1</p>
                     </c>
                     <c ca="left">
                        <p>SH3-domain kinase binding protein 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Inflammatory and Immune response</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>20210</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c ca="center">
                        <p>14.1</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Saa3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Serum amyloid A 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>58194</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="center">
                        <p>4.0</p>
                     </c>
                     <c ca="left">
                        <p>Sh3kbp1</p>
                     </c>
                     <c ca="left">
                        <p>SH3-domain kinase binding protein 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>15186</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c ca="center">
                        <p>15.0</p>
                     </c>
                     <c ca="left">
                        <p>Hdc</p>
                     </c>
                     <c ca="left">
                        <p>Histidine decarboxylase</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>Ref</b>.* = References identifying genes previously shown to have deregulated expression in pancreatic cancer</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Decreased or lost expression of Wt1 mRNA in primary pancreatic tumors</p>
            </st>
            <p>Wt1 is a transcription factor and has been found to be overexpressed in several types of cancers with poor prognosis. Our microarray data showed two-fold higher expression of the Wt1 gene in PT samples compared to NP samples. RT-PCR with a pair of primers that amplify exons 1 to 7 could detect Wt1 mRNA in PT but not in NP and LM (Fig. <figr fid="F2">2D</figr>). Interestingly, liver metastatic lesions expressed a lower molecular species of mRNA. We purified the higher band from primary tumors and the lower band from liver metastatic lesions and sequenced the PCR products. The results showed that the Wt1 mRNA in PT contained both wild type Wt1 and Wt1 variant without exon 5 (-51 nt). The slight difference in length could be visualized on agarose gel when the PCR products were separated further (Fig. <figr fid="F2">2D</figr>, amplified zone). On the other hand, sequencing results of the band in liver metastatic lesions showed that it was a product of Uroc1 (urocanase domain containing 1) gene, not Wt1. Comparison of the primer sequences with the mouse Uroc1 cDNA (NM_144940) showed high homology, and therefore a non-specific band (Uroc1) was amplified with this primer pair. Since human Uroc1 gene is highly expression in hepatoblastoma than in fetal liver <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>, it is possible that Uroc1 is preferentially expressed in liver tumors and thus may serve as a marker. PCR with another pair of primers that amplified nt1444-1943 region of the mRNA also showed that LM expressed much lower levels of Wt1. Considering that a tissue is heterogeneous in cell types, it is reasonable to assume that the Wt1 mRNA detected in LM was derived from stromal tissue whereas the cancer cells might have lost Wt1 expression.</p>
         </sec>
         <sec>
            <st>
               <p>Real-time Quantitative Reverse Transcription-PCR Validation</p>
            </st>
            <p>To confirm the array gene expression data, we performed quantitative reverse transcription-PCR (qRT-PCR) for a selected set (n = 10) of genes and the representative data for three genes are shown in Table <tblr tid="T4">4</tblr>. Although the extent of measured values detected by the two methods varied, an overall pattern concordance between qRT-PCR and Affymetrix cDNA array experiments was observed (i.e., same trend of induction or suppression was detected by both methods for each target genes). This difference may be due to probe design or the GeneChip system hybridization conditions. For all qRT-PCR, primers specific to &#946;-actin were used as a control to normalize each experiment. Results are presented in Table <tblr tid="T5">5</tblr>.</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Quantitative RT-PCR. Relative quantity of mRNA expression in PT, LM and NP tissues measured by quantitative real time PCR</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="8" ca="center">
                        <p>
                           <b>Relative fold change</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Genes</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PT1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>LT1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PT2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>LT2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PT3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>LT3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>NP1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>NP2</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Igfbp1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>14.4</p>
                     </c>
                     <c ca="center">
                        <p>70.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                     <c ca="center">
                        <p>20.0</p>
                     </c>
                     <c ca="center">
                        <p>10.0</p>
                     </c>
                     <c ca="center">
                        <p>90.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Sepina1a</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>16.9</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="center">
                        <p>28.9</p>
                     </c>
                     <c ca="center">
                        <p>78.4</p>
                     </c>
                     <c ca="center">
                        <p>14.4</p>
                     </c>
                     <c ca="center">
                        <p>40.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Peg3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="center">
                        <p>0.2</p>
                     </c>
                     <c ca="center">
                        <p>4.9</p>
                     </c>
                     <c ca="center">
                        <p>10.0</p>
                     </c>
                     <c ca="center">
                        <p>16.0</p>
                     </c>
                     <c ca="center">
                        <p>8.1</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>&#946;-actin</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Verification of microarray data in human pancreatic cancer cell lines</p>
            </st>
            <p>A panel of human pancreatic cancer cell lines that were reportedly to have high or low metastatic potential in immunodeficient mouse models were used to verify the data from Ela-<it>c-myc </it>model of primary and metastatic pancreatic tumors. Cell lines with high metastatic potential include PANC28, CoLo357fg, L3.6pl and low- or non-metastatic potential include PANC1 and BxPC3. We verified two genes in human cell lines, Igfbp1 and Serpina1a, these genes were highly upregulated in liver metastaic tissues compared to primary pancreatic tumors from transgenic mice. Expression patterns of both genes were consistent with the murine microarray and RT-PCR data (Fig. <figr fid="F2">2C</figr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In this study, we report the genome-wide expression profiles of primary pancreatic tumors and liver metastatic lesions from Ela-<it>c-myc </it>transgenic mice, or normal pancreas from wild-type mice. cDNA microarray analysis showed several gene clusters under various functional categories in primary or metastatic pancreatic tumors of Ela-<it>c-myc </it>transgenic mice that differ from normal pancreas of non-transgenic littermates. Notably, increased expression was observed for a large number of genes related to ribosomal biogenesis, maturation and ribosome assembly in primary or metastatic pancreatic tumors. Previous studies by others have also shown enhanced expression of genes related to ribosomal proteins, rRNA maturation and ribosome assembly, in addition to enhanced expression of many translation initiation and elongation factors in c-Myc overexpressing cells <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. Thus, our model recapitulates the experimental observations and key features of c-Myc overexpressing tumors.</p>
         <p>Genes involved in posttranscriptional regulation was a major functional category of upregulated genes in both PT and LM compared to NP samples, we observed changes in expression for splicing factors, RNA binding/pre-mRNA processing factors and spliceosome related genes, indicating that events related to RNA processing may play critical roles in pancreatic tumor development and progression induced by c-Myc. More than 50% of human genes undergo alternative splicing, and this type of RNA process has recently become an emerging topic in molecular and clinical oncology <abbrgrp><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr></abbrgrp>. Our data showed upregulation of several splicing factors from the SR family such as Sfrs1, Sfrs2, Sfrs3, Sf3b in both primary and metastatic tumors compared to normal pancreas. SR proteins represent a family of essential splicing factors, which are characterized by extensively phosphorylated serine-arginine rich domains <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. SR proteins recognize splice sites and, depending on their relative levels, these proteins can influence alternative RNA processing <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>.</p>
         <p>Other groups of genes that were upregulated are involved in DNA replication, cell proliferation and cell cycle regulation; chromosome organization and biogenesis; and signal transduction. Many genes are related to the maintenance of chromosomal structure and integrity such as minichromosome maintenance (Mcm)2, Mcm5, Mcm10, structural maintenance of chromosome (Smc)2l1, Smc4l1, Smc5l1, Rad51, Brca1 and Centromere component (Cenp-I). The entire Mcm protein family (Mcm2-7) is essential in regulating the replication of DNA. Amplification of genes in the Mcm family has been detected in various cancer cells <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Their upregulation may deregulate the complete and accurate DNA replication and thus result in failure to maintain the genetic integrity of affected cells. Smc family proteins are integral components of the machinery that modulates chromosome structure for mitosis <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. Similarly, Rad51, brca1 and Cenp-I play a role in maintenance of genetic integrity <abbrgrp><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>. We also noticed increased expression of some X-linked genes related to signal transduction such as Rsk4, Dusp9 and S100g, which have not been reported previously in pancreatic tumors.</p>
         <p>Intriguingly, we observed highly upregulated expression of Igfbp1 and Serpina1 in liver metastatic tissues compared to primary pancreatic tumors and normal pancreas. Verification of Igfbp1 and Serpina1 by RT-PCR and quantitative PCR showed strong expression in liver metastatic lesions but there was a lack of expression of these genes in primary pancreatic tumors or normal pancreas. Similarly, both these genes also showed higher expression in highly metastatic human pancreatic cell lines (PANC28, CoLo357fg, L3.6pl) and lower expression levels in less-metastatic cell lines (PANC1 and BxPC3). Several studies have described the inhibitory and potentiating activities of both Serpina1 and Igfbp1 in a variety of cells <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr></abbrgrp>. Igfbp1 interacts with &#945;<sub>5</sub>&#946;<sub>1 </sub>integrin, influencing cell adhesion and migration. Jones <it>et al</it>. <abbrgrp><abbr bid="B48">48</abbr></abbrgrp> first reported the increased migration of Chinese hamster ovary cells transfected to express human Igfbp1. Increased expression of several Igfbps has also been reported in human pancreatic cancer <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. Serpins are endogenous inhibitors of serine protease activity <it>in vivo </it><abbrgrp><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp> and a large number of studies support the notion that proteases play an important role in the progression of malignant tumors. Therefore, the expression of proteinase inhibitors is considered to be an anti-malignant event. Serpina1, a major inhibitor of human serine proteases in serum, is produced mainly by the liver, but also by extra-hepatic cells, including neutrophils and certain cancer cells <abbrgrp><abbr bid="B51">51</abbr><abbr bid="B52">52</abbr></abbrgrp>. However, clinical studies have shown that high circulating levels of Serpina1 directly correlate with tumor progression <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr></abbrgrp>. Immunohistochemical studies revealed that patients with Serpina1-positive lung adenocarcinomas had a worse prognosis than Serpina1-negative ones <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. More interestingly, both Serpina1 and Igfbp1 have been demonstrated to play a role in human invasive and metastatic pancreatic cancer. Together these studies and our findings suggest that Igfbp1 and Serpina1 may play critical roles in tumor progression <it>in vivo</it>, and are potential candidates for therapeutic interventions.</p>
         <p>We also compared our gene expression profiles with published data on human pancreatic cancer tissues or cell lines. Gene expression pattern of many genes such as Serpina1, Igfbp1, Wt1, CD44, MMP12, CXCR4, Muc2, Dek, Capza1, Bcra1, Birc5, S100g, Claudin-18, RAD51, Mcm2, Mcm4, Mcm7, Cyclin B2, splicing factor 3b, Nap1l1 etc. (please see Tables <tblr tid="T1">1</tblr>, <tblr tid="T2">2</tblr>, <tblr tid="T3">3</tblr> and <tblr tid="T4">4</tblr>for references) was similarly reported in other studies and therefore provide a validation for our model.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We show differential gene expression profiles under several functional categories in normal pancreas, primary pancreatic tumors and liver metastases. We identified two genes, Igfbp1 and Serpina1, which were overexpressed only in liver metastatic lesions suggesting that these genes are likely to be involved in the establishment of metastases in Ela-myc transgenic animal model. In addition, metastatic lesions appear to have low levels or absence of Wt1 gene expression while primary tumors express at least two major variants (+ exon 5 or - exon 5) Wt1 transcripts. Igfbp1 and Serpina1 may serve as clinically interesting biomarkers are likely to be useful for prognostic or therapeutic purposes in metastatic pancreatic cancer.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Ela-<it>myc </it>transgenic mice</p>
            </st>
            <p>We used Ela-<it>myc </it>transgenic mice with a FVB background, this strain was generated by crossbreeding of C57BL/6xSJL background Ela-<it>myc </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp> mice (obtained from Dr. Sandgren at the University of Wisconsin) with a FVB strain. The F1 mice were crossed together to generate F2 transgenic mice and some of the F2 mice were crossed to yield F3 mice. The F2 and F3 transgenic mice and their wild type littermates were used in this study.</p>
         </sec>
         <sec>
            <st>
               <p>Human Pancreatic cancer cell lines</p>
            </st>
            <p>A panel of human pancreatic cell lines, PANC1, PANC-28, CoLo357, L3.6pl and BxPC3, were used to verify the microarray data. All pancreatic cell lines were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, penicillin and streptomycin. Cells were harvested when they were about 80&#8211;90% confluent for RNA isolation.</p>
         </sec>
         <sec>
            <st>
               <p>cDNA microarray</p>
            </st>
            <p>Primary pancreatic cancer tissue, its corresponding liver metastatic lesion and normal pancreatic tissues were used to prepare RNA using the RNeasy mini kit (Qiagen) per manufacturer's instructions. Assurance of quality assessment and microarray analysis were carried out by personnel in the Applied Genomics Technology Center (Center for Molecular Medicine and Genetics, Wayne State University). Briefly, biotin-labeled RNA fragments were produced from 1 &#956;g of RNA by first synthesizing double-stranded cDNA followed by <it>in vitro </it>transcription and fragmentation reactions. A hybridization cocktail, containing the fragmented cRNA, probe array controls, bovine serum albumin, and herring sperm DNA, was prepared and hybridized at 45&#176;C for 16 h to the High Density Mouse Genome M430-2 containing 45101 probesets (Affymetrix Inc., Santa Clara, CA). The hybridized probe array was washed, and bound biotin-labeled cRNA was detected with streptavidin-phycoerythrin conjugate. Each probe array was scanned twice (Hewlett-Packard GeneArray Scanner), the images were overlaid, and the average intensities of each probe cell were compiled. Microarray was repeated three times for each condition (LM, PT, NP).</p>
         </sec>
         <sec>
            <st>
               <p>cDNA microarray data analysis</p>
            </st>
            <p>High density microarray image files were interpreted and quality assessed to Affymetrix standards in GCOS 1.1 as described previously <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. Expression changes were filtered in DChip for fold change (> 4 fold) between the experiments. Hierarchical clustering was carried out using Dchip and ontological analysis of gene expression was conducted in both OntoExpress in conjunction with curated pathway analysis using the KEGG Biocarta and GeneGo systems. At least three samples from each condition were used for Affymetrix microarray analysis to select candidate genes. Candidate genes were also confirmed with semi-quantitative, quantitative RT-PCR analysis and/or western blot at least 3 times.</p>
         </sec>
         <sec>
            <st>
               <p>Semiquantitative RT-PCR</p>
            </st>
            <p>Total RNA, isolated from the primary or metastatic lesions and normal pancreas of Ela-<it>c-myc </it>transgenic mice, was subjected to first-strand cDNA synthesis using an oligo (dT) primer and Moloney murine leukemia virus (MMLV) reverse transcriptase (Invitrogen). The primer amplified products were separated on ethidium bromide containing 1.2% agarose gels. Primers for the semiquantitative and quantitative detection of target mRNAs are presented in Table <tblr tid="T6">6</tblr>.</p>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>List of primer. Primer sets for qRT-PCR and sqRT-PCR</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><b>Accession No</b>.</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Quantitative or sqRT-PCR primer sequence</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>CXCR4</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>D87747</p>
                     </c>
                     <c ca="left">
                        <p>CATGGAACCGATCAGTGTGA (325)*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TTTCCCAAAGTACCAGTCAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>MMP2</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_008610</p>
                     </c>
                     <c ca="left">
                        <p>CTGTGTTCTTCGCAGGGAAT (433)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TGTGCAGCGATGAAGATGAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Snail2</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_011415</p>
                     </c>
                     <c ca="left">
                        <p>TTCCTCTGACACTTCATCCAA (474)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TTGGAGCAGTTTTTGCACTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>E-tcad</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_009864</p>
                     </c>
                     <c ca="left">
                        <p>CCTGCCAATCCTGATGAAAT (329)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TCAGGGA AGGAGCTGAAAGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Fgf13</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>AF020737</p>
                     </c>
                     <c ca="left">
                        <p>CATTTTCTGCCCAAACCACT (378)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>AATGCTTGGCACTCTTTTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Rsk4</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>BB402211</p>
                     </c>
                     <c ca="left">
                        <p>GTGGGTGCCAAAGTTTTGAT (351)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CAAACCACATGGAAATCAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>MIF</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_010798.1</p>
                     </c>
                     <c ca="left">
                        <p>ACTACAGTAAGCTGCTGTGTGG (208)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ATCGCTACCGGTGGATAAAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Mcm7</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_008568.1</p>
                     </c>
                     <c ca="left">
                        <p>ACCGCGAAGTCAGTACACAA (208)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GATGGTCTGCTGCTCCATAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Ttr</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_013697.1</p>
                     </c>
                     <c ca="left">
                        <p>TGGAAGACACTTGGCATTTC (194)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TGCTACTGCTTTGGCAAGAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>H2Aa</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_010378.2</p>
                     </c>
                     <c ca="left">
                        <p>CCTTCATCCCTTCTGACGAT (197)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CAGGCCTTGAATGATGAAGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Mrpl19</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_026490.2</p>
                     </c>
                     <c ca="left">
                        <p>TGCATCCCATGAAGAAGAGA (183)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GACATTTGCTCGTTACAAAAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Dusp9</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_029352.3</p>
                     </c>
                     <c ca="left">
                        <p>CCTGTGCTTGAGCTCTGATT (181)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GCTCTCCAAATTGGCTGAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>S100g</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_009789.2</p>
                     </c>
                     <c ca="left">
                        <p>CAGCAAAATGTGTGCTGAGA (197)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CTCCATCGCCATTCTTATCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Serpina1a</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_009243</p>
                     </c>
                     <c ca="left">
                        <p>GCCCTGGCAAATTACATTCT (196)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CATTGCCTGCATAATCCATC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Peg3</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_008817.2</p>
                     </c>
                     <c ca="left">
                        <p>ACCATTCAGGCCTCAGTTTC (205)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TTTTCTCAAATTCGCTGACG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Igfbp1</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_008341</p>
                     </c>
                     <c ca="left">
                        <p>CCTGCCAACGAGAACTCTAT (196)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GGGATTTTCTTTCCACTCCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Saa3</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_011315.3</p>
                     </c>
                     <c ca="left">
                        <p>GCGAGCCTACTCTGACATGA (196)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ATTGGCAAACTGGTCAGCTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Cldn18</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_019815.2</p>
                     </c>
                     <c ca="left">
                        <p>GCTGTACGAGCCCTGATGAT (193)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TGTTGGCAAACACAGACACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Sfrs1</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_173374.3</p>
                     </c>
                     <c ca="left">
                        <p>CACTGGTGTCGTGGAGTTTG (190)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CTTCTGCTACGGCTTCTGCT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Sfrs2</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_013663.3</p>
                     </c>
                     <c ca="left">
                        <p>GCTTTGCTTTCGTCGAATTT (188)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>AGGACTCCTCCTGCGGTAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Eif2</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_026030.2</p>
                     </c>
                     <c ca="left">
                        <p>GGAGTTGCTGAACCGAGTGT (180)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>AGGAGATGTTTGGGTTGACG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Muc13</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_010739.1</p>
                     </c>
                     <c ca="left">
                        <p>TGCGTGATGCTACAAAGGAC (195)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TGTCCTGGCATTTACTGCTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Igfbp1 (human)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_000596.2</p>
                     </c>
                     <c ca="left">
                        <p>AAGGCACAGGAGACATCAGG (195)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TATCTGGCAGTTGGGGTCTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Serpina1 (human)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NM_001002235.1</p>
                     </c>
                     <c ca="left">
                        <p>TGCCTGATGAGGGGAAACTA (186)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CCCCATTGCTGAAGACCTTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>WT1(362&#8211;970)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NC_000068</p>
                     </c>
                     <c ca="left">
                        <p>TCCAGCAGCCGGAGCAACCT (608)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>AGGGCGTGTGGCCATAGCTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>WT1(947&#8211;1470)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NC_000068</p>
                     </c>
                     <c ca="left">
                        <p>CGCCCAGCTATGGCCACACG (523)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ATTGCAGCCTGGGTATGCAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>WT1(1444&#8211;1943)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Upstream</p>
                     </c>
                     <c ca="left">
                        <p>NC_000068</p>
                     </c>
                     <c ca="left">
                        <p>TTCATGTGTGCATACCCAGG (499)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Downstream</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>GTAGATCCACAGTCGTGTCC</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*PCR product size</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Real-Time RT-PCR</p>
            </st>
            <p>cDNA from the primary or metastatic lesions Ela-<it>c-myc </it>transgenic and normal pancreas of wild type mice were subjected to PCR amplification, a maximum of 2 &#956;l of each cDNA sample was used per 25-&#956;l PCR reactions. The real-time measurements were analyzed in triplicate using an automated Real Time Cycler as described previously <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. The relative quantity in primary tumor versus normal tissue or primary tumor versus metastatic lesion was normalized to &#946;-actin.</p>
         </sec>
         <sec>
            <st>
               <p>Sequencing of Wilm's tumor suppressor gene (Wt1)</p>
            </st>
            <p>RT-PCR analysis using primers amplified nt947-1470 region of mouse Wt1 mRNA, which covers the first 7 exons, showed that liver metastases (but not primary pancreatic tumors) contained a lower molecular weight mRNA species. To verify the identity of the PCR products of the higher bands in primary tumor and lower band in liver metastatic lesions, we sequenced these bands using forward primer-947 after purifying them from agarose gels using Gel Extraction Kit (QIAEX II) from Qiagen.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>AT participated in the design of the study; participated in the experimental design; analysis and interpretation of data; and wrote the manuscript; AB designed primers; carried out the semi-quantitative and quantitative RT-PCR; JW isolated RNA from tissue samples and did sequencing; DJL participated in the design of the study, monitored and collected primary or metastatic tumor tissues. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by a grant from Elsa U. Pardee Foundation on pancreatic cancer research.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Yeo</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Hruban</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Leach</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Wilentz</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Sohn</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Kern</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Iacobuzio-Donahue</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Goggins</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Canto</snm>
                  <fnm>MI</fnm>
               </au>
               <etal/>
            </aug>
            <source>Curr Probl Cancer</source>
            <pubdate>2002</pubdate>
            <volume>26</volume>
            <issue>4</issue>
            <fpage>176</fpage>
            <lpage>275</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12399802</pubid>
                  <pubid idtype="doi">10.1067/mcn.2002.129579</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>c-MYC activation in primary and metastatic ductal adenocarcinoma of the pancreas: incidence, mechanisms, and clinical significance</p>
            </title>
            <aug>
               <au>
                  <snm>Schleger</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Verbeke</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hildenbrand</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Zentgraf</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bleyl</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Mod Pathol</source>
            <pubdate>2002</pubdate>
            <volume>15</volume>
            <issue>4</issue>
            <fpage>462</fpage>
            <lpage>469</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11950922</pubid>
                  <pubid idtype="doi">10.1038/modpathol.3880547</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Frequent amplification of 8q24, 11q, 17q, and 20q-specific genes in pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Mahlamaki</snm>
                  <fnm>EH</fnm>
               </au>
               <au>
                  <snm>Barlund</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tanner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gorunova</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hoglund</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Karhu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kallioniemi</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Genes Chromosomes Cancer</source>
            <pubdate>2002</pubdate>
            <volume>35</volume>
            <issue>4</issue>
            <fpage>353</fpage>
            <lpage>358</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12378529</pubid>
                  <pubid idtype="doi">10.1002/gcc.10122</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Amplifications of both c-Ki-ras with a point mutation and c-myc in a primary pancreatic cancer and its metastatic tumors in lymph nodes</p>
            </title>
            <aug>
               <au>
                  <snm>Yamada</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sakamoto</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Taira</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shimosato</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Terada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sugimura</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Jpn J Cancer Res</source>
            <pubdate>1986</pubdate>
            <volume>77</volume>
            <issue>4</issue>
            <fpage>370</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3009377</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Pancreatic tumor pathogenesis reflects the causative genetic lesion</p>
            </title>
            <aug>
               <au>
                  <snm>Sandgren</snm>
                  <fnm>EP</fnm>
               </au>
               <au>
                  <snm>Quaife</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Paulovich</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Palmiter</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Brinster</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1991</pubdate>
            <volume>88</volume>
            <issue>1</issue>
            <fpage>93</fpage>
            <lpage>97</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">1986386</pubid>
                  <pubid idtype="doi">10.1073/pnas.88.1.93</pubid>
                  <pubid idtype="pmcid">50755</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Characterization of pancreatic lesions from MT-tgfalpha, Ela-myc and MT-tgfalpha/Ela-myc single and double transgenic mice</p>
            </title>
            <aug>
               <au>
                  <snm>Liao</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Adsay</snm>
                  <fnm>NV</fnm>
               </au>
               <au>
                  <snm>Grignon</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Khanani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sarkar</snm>
                  <fnm>FH</fnm>
               </au>
            </aug>
            <source>J Carcinog</source>
            <pubdate>2006</pubdate>
            <volume>5</volume>
            <fpage>19</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16822304</pubid>
                  <pubid idtype="doi">10.1186/1477-3163-5-19</pubid>
                  <pubid idtype="pmcid">1559682</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Histological complexities of pancreatic lesions from transgenic mouse models are consistent with biological and morphological heterogeneity of human pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Liao</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Adsay</snm>
                  <fnm>NV</fnm>
               </au>
               <au>
                  <snm>Khannani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Grignon</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Thakur</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sarkar</snm>
                  <fnm>FH</fnm>
               </au>
            </aug>
            <source>Histol Histopathol</source>
            <pubdate>2007</pubdate>
            <volume>22</volume>
            <issue>6</issue>
            <fpage>661</fpage>
            <lpage>676</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17357096</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Invasion and metastasis in pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Keleg</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Buchler</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ludwig</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Buchler</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Friess</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mol Cancer</source>
            <pubdate>2003</pubdate>
            <volume>2</volume>
            <fpage>14</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12605717</pubid>
                  <pubid idtype="doi">10.1186/1476-4598-2-14</pubid>
                  <pubid idtype="pmcid">149416</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Pancreatic cancer &#8211; new aspects of molecular biology research</p>
            </title>
            <aug>
               <au>
                  <snm>Kleeff</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Friess</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Berberat</snm>
                  <fnm>PO</fnm>
               </au>
               <au>
                  <snm>Martignoni</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Z'Graggen</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Buchler</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Swiss Surg</source>
            <pubdate>2000</pubdate>
            <volume>6</volume>
            <issue>5</issue>
            <fpage>231</fpage>
            <lpage>234</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">11077487</pubid>
                  <pubid idtype="doi">10.1024/1023-9332.6.5.231</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Exploration of global gene expression patterns in pancreatic adenocarcinoma using cDNA microarrays</p>
            </title>
            <aug>
               <au>
                  <snm>Iacobuzio-Donahue</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Olsen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lowe</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>van Heek</snm>
                  <fnm>NT</fnm>
               </au>
               <au>
                  <snm>Rosty</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sato</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ashfaq</snm>
                  <fnm>R</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2003</pubdate>
            <volume>162</volume>
            <issue>4</issue>
            <fpage>1151</fpage>
            <lpage>1162</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1851213</pubid>
                  <pubid idtype="pmpid" link="fulltext">12651607</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Discovery of novel tumor markers of pancreatic cancer using global gene expression technology</p>
            </title>
            <aug>
               <au>
                  <snm>Iacobuzio-Donahue</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Shen-Ong</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>van Heek</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ashfaq</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Berg</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hollingsworth</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Cameron</snm>
                  <fnm>JL</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2002</pubdate>
            <volume>160</volume>
            <issue>4</issue>
            <fpage>1239</fpage>
            <lpage>1249</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1867224</pubid>
                  <pubid idtype="pmpid" link="fulltext">11943709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>DNA repair and recombination factor Rad51 is over-expressed in human pancreatic adenocarcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Maacke</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jost</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Opitz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Miska</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hasselbach</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Luttges</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kalthoff</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sturzbecher</snm>
                  <fnm>HW</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <issue>23</issue>
            <fpage>2791</fpage>
            <lpage>2795</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10851081</pubid>
                  <pubid idtype="doi">10.1038/sj.onc.1203578</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>BRCA1 and pancreatic cancer: pedigree findings and their causal relationships</p>
            </title>
            <aug>
               <au>
                  <snm>Lynch</snm>
                  <fnm>HT</fnm>
               </au>
               <au>
                  <snm>Deters</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Snyder</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Villeneuve</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Silberstein</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Narod</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Brand</snm>
                  <fnm>RE</fnm>
               </au>
            </aug>
            <source>Cancer Genet Cytogenet</source>
            <pubdate>2005</pubdate>
            <volume>158</volume>
            <issue>2</issue>
            <fpage>119</fpage>
            <lpage>125</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15796958</pubid>
                  <pubid idtype="doi">10.1016/j.cancergencyto.2004.01.032</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>High-resolution genomic and expression profiling reveals 105 putative amplification target genes in pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Mahlamaki</snm>
                  <fnm>EH</fnm>
               </au>
               <au>
                  <snm>Kauraniemi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Monni</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Wolf</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hautaniemi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kallioniemi</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Neoplasia</source>
            <pubdate>2004</pubdate>
            <volume>6</volume>
            <issue>5</issue>
            <fpage>432</fpage>
            <lpage>439</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15548351</pubid>
                  <pubid idtype="doi">10.1593/neo.04130</pubid>
                  <pubid idtype="pmcid">1550328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Gene expression profile of metastatic human pancreatic cancer cells depends on the organ microenvironment</p>
            </title>
            <aug>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fidler</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Coombes</snm>
                  <fnm>KR</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <issue>1</issue>
            <fpage>139</fpage>
            <lpage>148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17210693</pubid>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-06-2563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Genome-wide cDNA microarray analysis of gene expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelial cells selected for purity by laser microdissection</p>
            </title>
            <aug>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Furukawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nakagawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tsunoda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohigashi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Murata</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ishikawa</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ohgaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kashimura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Miyamoto</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Oncogene</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <issue>13</issue>
            <fpage>2385</fpage>
            <lpage>2400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14767473</pubid>
                  <pubid idtype="doi">10.1038/sj.onc.1207392</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Minichromosome maintenance protein 3 elicits a cancer-restricted immune response in patients with brain malignancies and is a strong independent predictor of survival in patients with anaplastic astrocytoma</p>
            </title>
            <aug>
               <au>
                  <snm>Soling</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sackewitz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Volkmar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schaarschmidt</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jacob</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Holzhausen</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Rainov</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>Clin Cancer Res</source>
            <pubdate>2005</pubdate>
            <volume>11</volume>
            <issue>1</issue>
            <fpage>249</fpage>
            <lpage>258</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15671553</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Down-regulation of the claudin-18 gene, identified through serial analysis of gene expression data analysis, in gastric cancer with an intestinal phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Sanada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Oue</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mitani</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yoshida</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakayama</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yasui</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>J Pathol</source>
            <pubdate>2006</pubdate>
            <volume>208</volume>
            <issue>5</issue>
            <fpage>633</fpage>
            <lpage>642</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16435283</pubid>
                  <pubid idtype="doi">10.1002/path.1922</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Differential mucin gene expression in human pancreatic and colon cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Yonezawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Byrd</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Dahiya</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Gum</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Griffiths</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Swallow</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>YS</fnm>
               </au>
            </aug>
            <source>Biochem J</source>
            <pubdate>1991</pubdate>
            <volume>276</volume>
            <issue>Pt 3</issue>
            <fpage>599</fpage>
            <lpage>605</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1151047</pubid>
                  <pubid idtype="pmpid">2064602</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Mucins in cancer: protection and control of the cell surface</p>
            </title>
            <aug>
               <au>
                  <snm>Hollingsworth</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Swanson</snm>
                  <fnm>BJ</fnm>
               </au>
            </aug>
            <source>Nat Rev Cancer</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <issue>1</issue>
            <fpage>45</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14681689</pubid>
                  <pubid idtype="doi">10.1038/nrc1251</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>B-myc inhibits neoplastic transformation and transcriptional activation by c-myc</p>
            </title>
            <aug>
               <au>
                  <snm>Resar</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Dolde</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Barrett</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Dang</snm>
                  <fnm>CV</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1993</pubdate>
            <volume>13</volume>
            <issue>2</issue>
            <fpage>1130</fpage>
            <lpage>1136</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">358997</pubid>
                  <pubid idtype="pmpid" link="fulltext">8423780</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Meta-analysis and meta-review of thyroid cancer gene expression profiling studies identifies important diagnostic biomarkers</p>
            </title>
            <aug>
               <au>
                  <snm>Griffith</snm>
                  <fnm>OL</fnm>
               </au>
               <au>
                  <snm>Melck</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Wiseman</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>J Clin Oncol</source>
            <pubdate>2006</pubdate>
            <volume>24</volume>
            <issue>31</issue>
            <fpage>5043</fpage>
            <lpage>5051</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17075124</pubid>
                  <pubid idtype="doi">10.1200/JCO.2006.06.7330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Evaluation of apolipoprotein A1 and posttranslationally modified forms of transthyretin as biomarkers for ovarian cancer detection in an independent study population</p>
            </title>
            <aug>
               <au>
                  <snm>Moore</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>McGuire</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rabkin</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Molinaro</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yip</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Meng</snm>
                  <fnm>XY</fnm>
               </au>
               <etal/>
            </aug>
            <source>Cancer Epidemiol Biomarkers Prev</source>
            <pubdate>2006</pubdate>
            <volume>15</volume>
            <issue>9</issue>
            <fpage>1641</fpage>
            <lpage>1646</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16985025</pubid>
                  <pubid idtype="doi">10.1158/1055-9965.EPI-05-0980</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Acute-phase proteins or tumour markers: the role of SAA, SAP, CRP and CEA as indicators of metastasis in a broad spectrum of neoplastic diseases</p>
            </title>
            <aug>
               <au>
                  <snm>Weinstein</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Skinner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sipe</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Lokich</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Zamcheck</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>AS</fnm>
               </au>
            </aug>
            <source>Scand J Immunol</source>
            <pubdate>1984</pubdate>
            <volume>19</volume>
            <issue>3</issue>
            <fpage>193</fpage>
            <lpage>198</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6200925</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Gene expression profiling identifies genes associated with invasive intraductal papillary mucinous neoplasms of the pancreas</p>
            </title>
            <aug>
               <au>
                  <snm>Sato</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fukushima</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Iacobuzio-Donahue</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>van Heek</snm>
                  <fnm>NT</fnm>
               </au>
               <au>
                  <snm>Cameron</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Yeo</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Hruban</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Goggins</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2004</pubdate>
            <volume>164</volume>
            <issue>3</issue>
            <fpage>903</fpage>
            <lpage>914</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1613263</pubid>
                  <pubid idtype="pmpid" link="fulltext">14982844</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Gene expression analysis reveals a signature of estrogen receptor activation upon loss of Pten in a mouse model of endometrial cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Lian</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>De Luca</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Di Cristofano</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Cell Physiol</source>
            <pubdate>2006</pubdate>
            <volume>208</volume>
            <issue>2</issue>
            <fpage>255</fpage>
            <lpage>266</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16688764</pubid>
                  <pubid idtype="doi">10.1002/jcp.20681</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Analysis of prostate cancer by proteomics using tissue specimens</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>AY</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sorensen</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Diamond</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>J Urol</source>
            <pubdate>2005</pubdate>
            <volume>173</volume>
            <issue>1</issue>
            <fpage>73</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15592032</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Identification of proteins released by pancreatic cancer cells by multidimensional protein identification technology: a strategy for identification of novel cancer markers</p>
            </title>
            <aug>
               <au>
                  <snm>Mauri</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Scarpa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nascimbeni</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Benazzi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Parmagnani</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mafficini</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Della Peruta</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bassi</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Miyazaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sorio</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Faseb J</source>
            <pubdate>2005</pubdate>
            <volume>19</volume>
            <issue>9</issue>
            <fpage>1125</fpage>
            <lpage>1127</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15985535</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Met proto-oncogene and insulin-like growth factor binding protein 3 overexpression correlates with metastatic ability in well-differentiated pancreatic endocrine neoplasms</p>
            </title>
            <aug>
               <au>
                  <snm>Hansel</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Rahman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>House</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ashfaq</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Berg</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yeo</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Clin Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>18 Pt 1</issue>
            <fpage>6152</fpage>
            <lpage>6158</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15448002</pubid>
                  <pubid idtype="doi">10.1158/1078-0432.CCR-04-0285</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Serum and tissue level of insulin-like growth factor-I (IGF-I) and IGF-I binding proteins as an index of pancreatitis and pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Karna</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Surazynski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Orlowski</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Laszkiewicz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Puchalski</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Nawrat</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Palka</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Int J Exp Pathol</source>
            <pubdate>2002</pubdate>
            <volume>83</volume>
            <issue>5</issue>
            <fpage>239</fpage>
            <lpage>245</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12641820</pubid>
                  <pubid idtype="doi">10.1046/j.1365-2613.2002.00237.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>IGFs and IGFBPs: surrogate markers for diagnosis and surveillance of tumour growth?</p>
            </title>
            <aug>
               <au>
                  <snm>Zumkeller</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Mol Pathol</source>
            <pubdate>2001</pubdate>
            <volume>54</volume>
            <issue>5</issue>
            <fpage>285</fpage>
            <lpage>288</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11577168</pubid>
                  <pubid idtype="doi">10.1136/mp.54.5.285</pubid>
                  <pubid idtype="pmcid">1187083</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Expression profiling and differential screening between hepatoblastomas and the corresponding normal livers: identification of high expression of the PLK1 oncogene as a poor-prognostic indicator of hepatoblastomas</p>
            </title>
            <aug>
               <au>
                  <snm>Yamada</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohira</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Horie</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ando</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takayasu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sugano</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hirata</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Matsunaga</snm>
                  <fnm>T</fnm>
               </au>
               <etal/>
            </aug>
            <source>Oncogene</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <issue>35</issue>
            <fpage>5901</fpage>
            <lpage>5911</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15221005</pubid>
                  <pubid idtype="doi">10.1038/sj.onc.1207782</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays</p>
            </title>
            <aug>
               <au>
                  <snm>Johnson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Castle</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Garrett-Engele</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kan</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Loerch</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Armour</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schadt</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Stoughton</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Shoemaker</snm>
                  <fnm>DD</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>302</volume>
            <issue>5653</issue>
            <fpage>2141</fpage>
            <lpage>2144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14684825</pubid>
                  <pubid idtype="doi">10.1126/science.1090100</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Alternative splicing: an emerging topic in molecular and clinical oncology</p>
            </title>
            <aug>
               <au>
                  <snm>Pajares</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Ezponda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Catena</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Calvo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pio</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Montuenga</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Lancet Oncol</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <issue>4</issue>
            <fpage>349</fpage>
            <lpage>357</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17395108</pubid>
                  <pubid idtype="doi">10.1016/S1470-2045(07)70104-3</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The connection between splicing and cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Srebrow</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kornblihtt</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>J Cell Sci</source>
            <pubdate>2006</pubdate>
            <volume>119</volume>
            <issue>Pt 13</issue>
            <fpage>2635</fpage>
            <lpage>2641</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16787944</pubid>
                  <pubid idtype="doi">10.1242/jcs.03053</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Aberrant and alternative splicing in cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Venables</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>64</volume>
            <issue>21</issue>
            <fpage>7647</fpage>
            <lpage>7654</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15520162</pubid>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-1910</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Splice variants as cancer biomarkers</p>
            </title>
            <aug>
               <au>
                  <snm>Brinkman</snm>
                  <fnm>BM</fnm>
               </au>
            </aug>
            <source>Clin Biochem</source>
            <pubdate>2004</pubdate>
            <volume>37</volume>
            <issue>7</issue>
            <fpage>584</fpage>
            <lpage>594</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15234240</pubid>
                  <pubid idtype="doi">10.1016/j.clinbiochem.2004.05.015</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Targeting the RNA splicing machinery as a novel treatment strategy for pancreatic carcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Hayes</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Carrigan</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>LJ</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2006</pubdate>
            <volume>66</volume>
            <issue>7</issue>
            <fpage>3819</fpage>
            <lpage>3827</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16585209</pubid>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-05-4065</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Distinct functions of SR proteins in alternative pre-mRNA splicing</p>
            </title>
            <aug>
               <au>
                  <snm>Zahler</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Neugebauer</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Roth</snm>
                  <fnm>MB</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1993</pubdate>
            <volume>260</volume>
            <issue>5105</issue>
            <fpage>219</fpage>
            <lpage>222</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">8385799</pubid>
                  <pubid idtype="doi">10.1126/science.8385799</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Stage-specific changes in SR splicing factors and alternative splicing in mammary tumorigenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Stickeler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kittrell</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Medina</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Berget</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>1999</pubdate>
            <volume>18</volume>
            <issue>24</issue>
            <fpage>3574</fpage>
            <lpage>3582</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10380879</pubid>
                  <pubid idtype="doi">10.1038/sj.onc.1202671</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>MCM proteins: DNA damage, mutagenesis and repair</p>
            </title>
            <aug>
               <au>
                  <snm>Bailis</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Forsburg</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Curr Opin Genet Dev</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>1</issue>
            <fpage>17</fpage>
            <lpage>21</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15108800</pubid>
                  <pubid idtype="doi">10.1016/j.gde.2003.11.002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>At the heart of the chromosome: SMC proteins in action</p>
            </title>
            <aug>
               <au>
                  <snm>Hirano</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Nat Rev Mol Cell Biol</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <issue>5</issue>
            <fpage>311</fpage>
            <lpage>322</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16633335</pubid>
                  <pubid idtype="doi">10.1038/nrm1909</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Building the centromere: from foundation proteins to 3D organization</p>
            </title>
            <aug>
               <au>
                  <snm>Amor</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Kalitsis</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sumer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Choo</snm>
                  <fnm>KH</fnm>
               </au>
            </aug>
            <source>Trends Cell Biol</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>7</issue>
            <fpage>359</fpage>
            <lpage>368</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15246429</pubid>
                  <pubid idtype="doi">10.1016/j.tcb.2004.05.009</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>DNA double-strand breaks: signaling, repair and the cancer connection</p>
            </title>
            <aug>
               <au>
                  <snm>Khanna</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>SP</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2001</pubdate>
            <volume>27</volume>
            <issue>3</issue>
            <fpage>247</fpage>
            <lpage>254</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11242102</pubid>
                  <pubid idtype="doi">10.1038/85798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Emerging multifunctional aspects of cellular serine proteinase inhibitors in tumor progression and tissue regeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Kataoka</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Itoh</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Koono</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Pathol Int</source>
            <pubdate>2002</pubdate>
            <volume>52</volume>
            <issue>2</issue>
            <fpage>89</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11940213</pubid>
                  <pubid idtype="doi">10.1046/j.1440-1827.2002.01320.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Cellular actions of the insulin-like growth factor binding proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Firth</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Baxter</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Endocr Rev</source>
            <pubdate>2002</pubdate>
            <volume>23</volume>
            <issue>6</issue>
            <fpage>824</fpage>
            <lpage>854</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12466191</pubid>
                  <pubid idtype="doi">10.1210/er.2001-0033</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Effect of insulin-like growth factor binding protein-1 on integrin signalling and the induction of apoptosis in human breast cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Perks</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Newcomb</snm>
                  <fnm>PV</fnm>
               </au>
               <au>
                  <snm>Norman</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Holly</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>J Mol Endocrinol</source>
            <pubdate>1999</pubdate>
            <volume>22</volume>
            <issue>2</issue>
            <fpage>141</fpage>
            <lpage>150</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10194517</pubid>
                  <pubid idtype="doi">10.1677/jme.0.0220141</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Cell migration: interactions among integrins, IGFs and IGFBPs</p>
            </title>
            <aug>
               <au>
                  <snm>Jones</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Doerr</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Clemmons</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Prog Growth Factor Res</source>
            <pubdate>1995</pubdate>
            <volume>6</volume>
            <issue>2&#8211;4</issue>
            <fpage>319</fpage>
            <lpage>327</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">8817675</pubid>
                  <pubid idtype="doi">10.1016/0955-2235(95)00015-1</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>A novel antiapoptotic role for alpha1-antitrypsin in the prevention of pulmonary emphysema</p>
            </title>
            <aug>
               <au>
                  <snm>Petrache</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Fijalkowska</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Zhen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Medler</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cruz</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Choe</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Taraseviciene-Stewart</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Scerbavicius</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Shapiro</snm>
                  <fnm>L</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am J Respir Crit Care Med</source>
            <pubdate>2006</pubdate>
            <volume>173</volume>
            <issue>11</issue>
            <fpage>1222</fpage>
            <lpage>1228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16514110</pubid>
                  <pubid idtype="doi">10.1164/rccm.200512-1842OC</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Increased plasma levels of serine proteinase inhibitors in lung cancer patients</p>
            </title>
            <aug>
               <au>
                  <snm>Zelvyte</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Wallmark</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Piitulainen</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Westin</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Janciauskiene</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Anticancer Res</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <issue>1</issue>
            <fpage>241</fpage>
            <lpage>247</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15015603</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Alpha 1-antitrypsin and survival in pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Trichopoulos</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tzonou</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kalapothaki</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sparos</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kremastinou</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Skoutari</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>1990</pubdate>
            <volume>45</volume>
            <issue>4</issue>
            <fpage>685</fpage>
            <lpage>686</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">2323846</pubid>
                  <pubid idtype="doi">10.1002/ijc.2910450419</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Alpha 1-antitrypsin and survival in hepatocellular carcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Tzonou</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sparos</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kalapothaki</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zavitsanos</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Rebelakos</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Trichopoulos</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Br J Cancer</source>
            <pubdate>1990</pubdate>
            <volume>61</volume>
            <issue>1</issue>
            <fpage>72</fpage>
            <lpage>73</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2153397</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>An evaluation of the prognostic significance of alpha-1-antitrypsin expression in adenocarcinomas of the lung: an immunohistochemical analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Higashiyama</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Doi</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Kodama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yokouchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tateishi</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Br J Cancer</source>
            <pubdate>1992</pubdate>
            <volume>65</volume>
            <issue>2</issue>
            <fpage>300</fpage>
            <lpage>302</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1739634</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Role of imbalance between neutrophil elastase and alpha 1-antitrypsin in cancer development and progression</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Lancet Oncol</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <issue>3</issue>
            <fpage>182</fpage>
            <lpage>190</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15003202</pubid>
                  <pubid idtype="doi">10.1016/S1470-2045(04)01414-7</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Immunohistochemical analysis of pancreatic secretory trypsin inhibitor expression in pulmonary adenocarcinoma: its possible participation in scar formation of the tumor tissues</p>
            </title>
            <aug>
               <au>
                  <snm>Higashiyama</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Doi</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Kodama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yokouchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tateishi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Matsuura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Murata</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Monden</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ogawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Tumour Biol</source>
            <pubdate>1992</pubdate>
            <volume>13</volume>
            <issue>5&#8211;6</issue>
            <fpage>299</fpage>
            <lpage>307</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1290027</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>The role of X-linked genes in breast cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Thakur</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Bollig</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Biliran</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Liao</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Breast Cancer Res Treat</source>
            <pubdate>2005</pubdate>
            <volume>93</volume>
            <issue>2</issue>
            <fpage>135</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16187233</pubid>
                  <pubid idtype="doi">10.1007/s10549-005-4516-0</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Overexpression of the Wilms' tumor gene WT1 in pancreatic ductal adenocarcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Oji</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nakamori</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fujikawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nakatsuka</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yokota</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tatsumi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Abeno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ikeba</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Takashima</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tsujie</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Cancer Sci</source>
            <pubdate>2004</pubdate>
            <volume>95</volume>
            <issue>7</issue>
            <fpage>583</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15245594</pubid>
                  <pubid idtype="doi">10.1111/j.1349-7006.2004.tb02490.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
