<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1475-2859-7-24</ui>
   <ji>1475-2859</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Nisin inducible production of listeriolysin O in <it>Lactococcus lactis </it>NZ9000</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Bahey-El-Din</snm>
               <fnm>Mohammed</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>mohammedbahey@student.ucc.ie</email>
            </au>
            <au id="A2">
               <snm>Griffin</snm>
               <mi>T</mi>
               <fnm>Brendan</fnm>
               <insr iid="I2"/>
               <email>brendan.griffin@ucc.ie</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Gahan</snm>
               <mi>GM</mi>
               <fnm>Cormac</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>c.gahan@ucc.ie</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Microbiology, University College Cork, Cork, Ireland</p>
            </ins>
            <ins id="I2">
               <p>School of Pharmacy, University College Cork, Cork, Ireland</p>
            </ins>
            <ins id="I3">
               <p>Alimentary Pharmabiotic Centre, University College Cork, Cork, Ireland</p>
            </ins>
         </insg>
         <source>Microbial Cell Factories</source>
         <issn>1475-2859</issn>
         <pubdate>2008</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>24</fpage>
         <url>http://www.microbialcellfactories.com/content/7/1/24</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18664263</pubid>
               <pubid idtype="doi">10.1186/1475-2859-7-24</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>09</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>29</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>29</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Bahey-El-Din et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p><it>Listeria monocytogenes </it>is a well-characterized food-borne pathogen that infects pregnant women and immunocompromised individuals. Listeriolysin O (LLO) is the major virulence factor of the pathogen and is often used as a diagnostic marker for detection of <it>L. monocytogenes</it>. In addition, LLO represents a potent antigen driving T cell-mediated immunity during infection. In the present work, <it>Lactococcus lactis </it>NZ9000 was used as an expression host to hyper-produce LLO under inducible conditions using the NICE (NIsin Controlled Expression) system. We created a modified pNZ8048 vector encoding a six-His-tagged LLO downstream of the strong inducible PnisA promoter.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>The constructed vector (pNZPnisA:CYTO-LLO) was expressed in <it>L. lactis </it>NZ9000 and was best induced at mid-log phase with 0.2% v/v nisin for 4 h statically at 30&#176;C. Purification of the His-tagged LLO was accomplished by Ni-NTA affinity chromatography and functionality was confirmed through haemolytic assays. Total LLO yield (measured as total protein content) was 4.43&#8211;5.9 mg per litre culture and the haemolytic activity was still detectable after 8 months of storage at 4&#176;C.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The LLO production method described in this work provides an approach to efficient LLO production in the Gram-positive <it>Lactococcus </it>bacterium to yield a significant source of the protein for research and diagnostic applications. Expression of LLO in <it>L. lactis </it>has a number of benefits over <it>E. coli </it>which may facilitate both <it>in vivo </it>and <it>in vitro </it>applications of this system.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Listeria monocytogenes </it>is the causative agent of listeriosis, a food-borne disease generally associated with the consumption of contaminated ready-to-eat food products. Listeriosis affects mainly immunocompromised individuals and the outcome of infection includes spontaneous miscarriage in pregnant women, and meningitis in the newborn <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. <it>L. monocytogenes </it>is common in the environment and can be found in the gastrointestinal tract of approximately 5% of healthy persons. Symptomatic infection occurs in individuals with immunosuppression including patients with AIDS and organ transplant recipients <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Listeriosis is usually a severe disease with a mean mortality rate in humans of 20 to 30% <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Several common-source outbreaks of listeriosis have been linked to consumption of <it>Listeria</it>-contaminated foods (frankfurters, p&#226;t&#233;, pasteurised milk and soft-cheese) <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Controlled good manufacturing procedures and early detection of <it>Listeria </it>contamination in food are of great importance in preventing such outbreaks.</p>
         <p>The major virulence factor of <it>L. monocytogenes </it>is the haemolysin listeriolysin O (LLO). Upon internalisation of the bacterium within the host cell phagolysosome, rapid acidification (~pH 5.5) activates LLO. The protein then interacts with vacuolar membrane cholesterol, oligomerizes and produces pores in the phagolysosomal membrane permitting bacterial escape to the cytoplasm <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. LLO is therefore critical to <it>L. monocytogenes </it>infection as it facilitates intracellular pathogenesis and subsequent spread of the infection to other tissues.</p>
         <p>Enhanced expression systems for <it>in vitro </it>production of LLO have a number of potential applications. Since LLO is associated solely with the pathogenic strain <it>L. monocytogenes</it>, the use of anti-LLO antibodies to identify the pathogen in diagnostic or food samples has demonstrated significant potential <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Pure LLO could also find an application in assays to determine prior exposure and immunity to the pathogen in humans or animals <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Finally, LLO is recognised as an immunodominant antigen by T cells generated during infection <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Modified strains expressing LLO may therefore have applications as vaccines for delivering this <it>Listeria</it>-specific antigen to the host immune system.</p>
         <p>We have chosen to utilise <it>Lactococcus lactis </it>as a vector for hyper-expressing LLO. <it>L. lactis </it>is a GRAS (generally regarded as safe) microorganism widely used in the food industry. Recent advances in the molecular characterization of <it>L. lactis </it>and the development of <it>L. lactis</it>-compatible genetic engineering tools have increased the versatility of this organism as a means of protein production <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Moreover, the use of lactococci has been extended by others as a live antigen and therapeutic drug delivery system <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. Several protein expression systems, both constitutive and inducible, have been developed in lactococci <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. However, constitutive systems have a potential disadvantage in that the protein may be more liable to lactococcal degradation, or may prove toxic to the cell if produced in high amounts for extended periods.</p>
         <p>One of the best characterized inducible expression systems for use in lactococci is the NICE (NIsin Controlled Expression) system <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. In the present work, we describe high level production of the <it>L. monocytogenes </it>LLO protein in <it>Lactococcus lactis </it>NZ9000 using the NICE system. The His-tagged LLO was purified by Ni-NTA affinity chromatography to give a considerable yield and high functional haemolytic activity compared to other published methods <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. The significant yield and purity obtained for LLO using the NICE-expression system in <it>Lactococcus </it>demonstrate the benefits of this approach for the production of LLO for research and diagnostic purposes. Moreover, the constructed LLO-expressing <it>L. lactis </it>strain has the potential to act as a safe live vaccine candidate against listeriosis.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Culture media, antibiotics and incubation conditions</p>
            </st>
            <p>For <it>L. lactis</it>, GM17 broth (M17 broth (Oxoid) supplemented with 0.5% glucose) was used as a standard culture medium. Luria-Bertani (LB) broth (10 g peptone from casein, 5 g yeast extract and 5 g sodium chloride per litre) was used for <it>Escherichia coli </it>cultures. Solid media were prepared by adding technical agar (Merck) to the corresponding broth with a final concentration of 1.5% w/v. <it>L. lactis </it>cultures were incubated statically at 30&#176;C while <it>E. coli </it>was incubated at 37&#176;C with shaking when applicable. When required, ampicillin (Amp) was used at a concentration of 100 &#956;g/ml for <it>E. coli </it>while chloramphenicol (Cm) was used at 10 &#956;g/ml for both <it>E. coli </it>and <it>L. lactis</it>.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of plasmid vector for expression of LLO in <it>L. lactis </it>NZ9000</p>
            </st>
            <p>Bacterial strains and vectors used in the present study are described in Table <tblr tid="T1">1</tblr> while PCR primers are summarized in Table <tblr tid="T2">2</tblr>. High fidelity KOD hot start DNA polymerase (Novagen) was used in all PCR reactions throughout the whole procedures following manufacturer's instructions. Restriction enzymes and T4 DNA ligase were purchased from Roche Diagnostics (Mannheim, Germany). The gene encoding listeriolysin O, <it>hly</it>, of <it>L. monocytogenes </it>EGD-e was PCR-amplified without the signal peptide coding sequence from the chromosomal DNA [GenBank: <ext-link ext-link-type="gen" ext-link-id="AL591824">AL591824</ext-link>] using primers 1 and 2. The resulting PCR product was sequentially digested by <it>Bam</it>HI and <it>Pst</it>I respectively. Ligation to a similarly digested pQE30 vector (Qiagen) was successfully performed using T4 DNA ligase. The ligation reaction mixture was transformed into chemically-competent <it>E. coli </it>BL21 (Novagen) by heat shock following manufacturer's instructions and plated onto LB agar containing 100 &#956;g/ml ampicillin. Positive colonies were identified by PCR and plasmid was extracted from BL21 using Qiagen Miniprep Kit (Qiagen). The resulting plasmid (pQE30/<it>hly</it>) had an N-terminus six-histidine tagged <it>hly </it>gene and the correct nucleotide sequence was confirmed by DNA sequencing (Lark Technologies Inc., UK). pQE30/<it>hly </it>was utilised as a template for further cloning steps outlined below.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Bacterial strains and plasmid vectors used in the present study</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Strain or plasmid</b>
                        </p>
                        <p>
                           <b> name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Description</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reference</b>
                        </p>
                        <p>
                           <b> or source</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>E. coli </it>Top10</p>
                     </c>
                     <c ca="left">
                        <p>Chemically-competent intermediate host, plasmid free</p>
                     </c>
                     <c ca="left">
                        <p>Invitrogen</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>E. coli </it>BL21</p>
                     </c>
                     <c ca="left">
                        <p>Chemically-competent <it>E. coli</it>, used in this study as an intermediate host for pQE30, plasmid free</p>
                     </c>
                     <c ca="left">
                        <p>Novagen</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Listeria monocytogenes EGD-e </it>serovar 1/2a</p>
                     </c>
                     <c ca="left">
                        <p>Wild type <it>Listeria monocytogenes</it></p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B32">32</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Lactococcus lactis </it>NZ9700</p>
                     </c>
                     <c ca="left">
                        <p>Nisin producer strain</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B13">13</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Lactococcus lactis </it>NZ9000</p>
                     </c>
                     <c ca="left">
                        <p><it>L. lactis </it>subsp. <it>Cremoris </it>MG1363 carrying nisRK on the chromosome</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B13">13</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO)</p>
                     </c>
                     <c ca="left">
                        <p><it>Lactococcus lactis </it>NZ9000 harbouring pNZPnisA:CYTO-LLO plasmid and over-expressing LLO upon nisin induction</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>pQE30</p>
                     </c>
                     <c ca="left">
                        <p>Expression vector using phage T5 promoter and adding an N-terminus six-His tag to the expressed protein, Amp<sup>R </sup>(ampicillin resistant)</p>
                     </c>
                     <c ca="left">
                        <p>Qiagen</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>pQE30/<it>hly</it></p>
                     </c>
                     <c ca="left">
                        <p>pQE30 vector with <it>hly </it>gene (without signal sequence) inserted between <it>Bam</it>HI and <it>Pst</it>I restriction sites.</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>pNZ8048</p>
                     </c>
                     <c ca="left">
                        <p><it>E. coli-L. lactis </it>shuttle vector containing PnisA promoter and start codon in <it>Nco</it>I site, Cm<sup>R </sup>(chloramphenicol resistant)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B13">13</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>pNZPnisA:CYTO-LLO</p>
                     </c>
                     <c ca="left">
                        <p>Modified pNZ8048 containing PnisA promoter (<it>Nco</it>I site eliminated) with downstream His-tagged <it>hly </it>gene, Cm<sup>R</sup></p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Oligonucleotide primers used in this study.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Primer</b>
                        </p>
                        <p>
                           <b>code</b>
                        </p>
                        <p>
                           <b>  number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer</b>
                        </p>
                        <p>
                           <b> name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer sequence (5'-3') (restriction enzyme site or overhang)</b>
                           <sup>a</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>pQE30</p>
                        <p>forward </p>
                        <p> primer</p>
                     </c>
                     <c ca="left">
                        <p>GAA<it><ul>GGATCC</ul></it>GATGCATCTGCATTCAATAAAG (<it>Bam</it>HI site)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>pQE30</p>
                        <p>reverse</p>
                        <p>  primer</p>
                     </c>
                     <c ca="left">
                        <p>ACGC<it><ul>CTGCAG</ul></it>TTCGATTGGATTATCTACTTTATTA (<it>Pst</it>I site)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>PnisA</p>
                        <p>forward</p>
                        <p>  primer</p>
                     </c>
                     <c ca="left">
                        <p>CCA<it><ul>AGATCT</ul></it>AGTCTTATAACTATACTG (<it>Bgl</it>II site)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>PnisA</p>
                        <p>reverse</p>
                        <p>primer</p>
                        <p>   (<it>hly </it>overhang)</p>
                     </c>
                     <c ca="left">
                        <p><ul>GGTGATGTCCCAT</ul>TTTGAGTGCCTCCTTATAATTTATTTTG (<it>hly </it>overhang)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p><it>hly </it>forward</p>
                        <p>primer</p>
                        <p>  (PnisA overhang)</p>
                     </c>
                     <c ca="left">
                        <p><ul>AGGCACTCAAA</ul>ATGGGACATCACCATCACCATCACGGA (PnisA overhang)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p><it>hly </it>reverse</p>
                        <p> primer</p>
                     </c>
                     <c ca="left">
                        <p>AGTC<it><ul>GGTACC</ul></it>TTATTCGATTGGATTATCTAC (<it>Kpn</it>I site)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>(<sup>a</sup>) Restriction enzyme recognition sites are italicized and underlined while SOE overhangs are underlined.</p>
               </tblfn>
            </tbl>
            <p>The lactococcal plasmid pNZ8048 <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> was manipulated to allow insertion of the His-tagged <it>hly </it>gene. Plasmid pNZ8048 contains the PnisA promoter (nisin inducible) with a downstream start codon (ATG) inside an <it>Nco</it>I restriction site (CC<ul>ATG</ul>G). However, since the <it>hly </it>gene contains an internal <it>Nco</it>I restriction site, we modified pNZ8048 to eliminate this NcoI site and added a new start codon in frame with <it>hly </it>gene. The Splicing by Overlap Extension (SOE) technique <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> was used to construct an insert containing the His-tagged <it>hly </it>gene spliced directly to PnisA promoter without the need for <it>Nco</it>I digestion. Two PCR reactions were initially performed: primers 3 and 4 were used to amplify the PnisA promoter from pNZ8048 while primers 5 and 6 were used to amplify <it>hly </it>(along with the His-tag) from the constructed pQE30/<it>hly </it>plasmid. The hybrid primers 4 and 5 had overhangs (Table <tblr tid="T2">2</tblr>) which allow the overlap of the previous two PCR products upon combination for the third splicing PCR reaction. This third PCR reaction was done by combining the initial two PCR products in a molar ratio of 1:1 and again PCR-amplified using primers 3 and 6. The resulting PCR spliced product (PnisA with downstream His-tagged <it>hly</it>) was sequentially digested by <it>Bgl</it>II and <it>Kpn</it>I respectively. pNZ8048 was similarly digested with those two restriction enzymes, to remove the PnisA promoter along with the <it>Nco</it>I site, and the digested plasmid was agarose gel purified using the Qiagen gel extraction kit (Qiagen). The spliced PCR product was ligated into the digested pNZ8048 using T4 DNA ligase. The ligation reaction was transformed into chemically-competent <it>E. coli </it>TOP10 (Invitrogen) following the manufacturer's instructions and plated onto LB agar containing 10 &#956;g/ml chloramphenicol. After incubation at 37&#176;C for 24&#8211;48 h, positive colonies were detected by colony PCR and plasmid (designated pNZPnisA:CYTO-LLO) was extracted and correct DNA sequence was confirmed (Lark Technologies Inc., UK). Plasmid pNZPnisA:CYTO-LLO was transformed to electrocompetent <it>L. lactis </it>NZ9000, prepared as previously described <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, using Gene Pulser (Biorad) and plated onto GM17 agar containing 10 &#956;g/ml chloramphenicol. After 24 h incubation at 30&#176;C, colonies were checked by colony PCR and one positive colony was stocked for protein induction and expression. Figures <figr fid="F1">1</figr> and <figr fid="F2">2</figr> show an overview of the plasmid vector construction and the sequence of DNA and amino acids of the final His-tagged LLO respectively.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Schematic representation of the construction of the pNZPnisA:CYTO-LLO vector</p>
               </caption>
               <text>
                  <p><b>Schematic representation of the construction of the pNZPnisA:CYTO-LLO vector</b>.</p>
               </text>
               <graphic file="1475-2859-7-24-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Illustrative partial DNA and amino acid sequence of the constructed vector and LLO respectively</p>
               </caption>
               <text>
                  <p><b>Illustrative partial DNA and amino acid sequence of the constructed vector and LLO respectively</b>. (A) Illustrative DNA sequence of the SOE (splicing by overlap extension) PCR product consisting of the PnisA promoter spliced to downstream six-His-tagged <it>hly </it>gene of <it>L. monocytogenes </it>EGD-e. Flanking restriction sites of <it>Bgl</it>II and <it>Kpn</it>I exist on the PnisA and <it>hly </it>sides respectively. The six-His-tag codons are underlined. (B) Comparison between the amino acid sequence of native LLO (<it>L. monocytogenes </it>EGD-e) with the signal sequence and the constructed six-His-tagged LLO produced in this study.</p>
               </text>
               <graphic file="1475-2859-7-24-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Protein induction</p>
            </st>
            <p>Filter-sterilized culture supernatant of the nisin-secreting strain <it>L. lactis </it>NZ9700 was used as a source of nisin <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Sterile culture supernatant of <it>L. lactis </it>NZ9700 was stored in small aliquots at -20&#176;C and one aliquot was thawed and used as required. The use of the same filter-sterilized batch of supernatant throughout the study ensured consistency of the nisin content between induction experiments. Overnight culture of <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO) was subcultured into fresh GM17 broth (Cm 10 &#956;g/ml) and incubated statically at 30&#176;C. Nisin was added when the optical density at 600 nm (OD600) reached 0.5. Induction was conducted statically at 30&#176;C after which cells were pelleted (3200 &#215; g for 10 min) and washed once with buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 300 mM NaCl, 10 mM imidazole, pH 8). Pellets were frozen at -80&#176;C prior to sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE) or protein purification.</p>
         </sec>
         <sec>
            <st>
               <p>SDS-PAGE and Western blot</p>
            </st>
            <p>Frozen induced pellets from 500 ml cultures were thawed on ice and resuspended in 10&#8211;15 ml ice-cold lysis buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 300 mM NaCl, 10 mM imidazole, pH 8) containing 30 mg/ml lysozyme (Sigma) and kept for 30 min on ice. This was followed by sonication at maximum amplitude (Soniprep 150, MSE UK Ltd.) using eight ten-second pulses with intervening ten-second pauses on ice. For small volume cultures (10&#8211;50 ml), pellets were resuspended in 500 &#956;l lysis buffer in eppendorf tubes and acid-washed glass beads (Sigma) were added followed by beating the tubes in a bead beater (Mini beadbeater-8, Biospec products) for three one-minute beats with one-minute pauses in between on ice. Clear supernatant was obtained after centrifugation at 10000 &#215; g for 30 min at 4&#176;C.</p>
            <p>For SDS-PAGE, 12% SDS-polyacrylamide separating gel and 4% stacking gel were used and gels were stained with coomassie blue stain followed by destaining and gel imaging. For Western blot, pre-stained protein marker was used (Amersham Biosciences UK, Ltd) and gels were blotted against a nitrocellulose membrane (Hybond-ECL&#8482;, Amersham Biosciences UK, Ltd.) using a semi-dry Western transfer apparatus. Membranes were blocked overnight at 4&#176;C in 5% skimmed milk in TBS buffer (0.8% NaCl, 20 mM Tris-HCl, pH 7.6). Primary rabbit anti-LLO antibody (Diatheva, Italy) and secondary anti-rabbit antibody (Amersham ECL Western Blotting System) were used at 1/1000 and 1/1500 dilutions in 5% and 10% skimmed milk in TBS buffer respectively. Western blot detection was done using Amersham ECL Western Blotting System (Amersham Biosciences UK, Ltd.) using the protocol recommended by the manufacturer.</p>
         </sec>
         <sec>
            <st>
               <p>Protein purification and quantitation</p>
            </st>
            <p>Clear supernatant obtained after cell lysis (performed as described in the previous section) was passed through a disposable chromatography column (Biorad) containing 2 ml Ni-NTA affinity gel (Qiagen). Column was washed twice with wash buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 300 mM NaCl, 20 mM imidazole, pH 8) then eluted in fractions of 0.5 ml with elution buffer (50 mM NaH<sub>2</sub>PO<sub>4</sub>, 300 mM NaCl, 250 mM imidazole, pH 8). Elutions were checked by SDS-PAGE and combined together and dialysed overnight at 4&#176;C against 2 l of dialysis buffer (500 mM NaCl, 10 mM Na<sub>2</sub>HPO<sub>4</sub>, 0.5 mM EDTA, 0.02% NaN<sub>3</sub>, pH 7.0). Listeriolysin O concentration was measured as total protein concentration by Micro Lowry total protein kit (Sigma) and also by absorbance at 280 nm using the molar extinction coefficient for His-tagged LLO as 71,950 cm<sup>-1 </sup>(calculated based on the actual sequence of the His-tagged LLO) <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. The purified protein was stored at 4&#176;C.</p>
         </sec>
         <sec>
            <st>
               <p>Measurement of haemolytic activity of purified LLO</p>
            </st>
            <p>Haemolytic activity of LLO was measured according to the method described by Khoda et al <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> with slight modification. Briefly, defibrinated sheep blood was centrifuged at 800 &#215; g for 10 min at 4&#176;C, then washed twice with phosphate buffered saline (PBS) (Gibco) pH 5.5. The pelleted red blood cells (RBCs) were diluted with PBS (pH 5.5) to obtain 0.5% RBCs volume/volume (v/v). Aliquots of 100 &#956;l of the RBCs suspension were distributed in 1.5 ml tubes and twofold serial dilutions of LLO (in PBS pH 5.5) was added to each tube to a final volume of 1 ml. LLO final concentrations covered the range from 8 &#956;g ml<sup>-1 </sup>to 29 pg ml<sup>-1</sup>. A positive control (distilled water, 100% haemolysis) and a negative control (PBS pH 5.5) were also included. Tubes were incubated statically at 37&#176;C for 45 min after which they were centrifuged at 1700 &#215; g for 5 min and supernatants were collected. Absorbance was measured colorimetrically at 415 nm and haemolytic units were calculated. One haemolytic unit (HU) was defined as the amount of protein required to cause 50% haemoglobin release from sheep RBCs as compared to the 100% haemoglobin release of the positive control (distilled water) <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>DNA sequence of the six His-tagged <it>hly </it>gene</p>
            </st>
            <p>Native LLO secreted by <it>Listeria monocytogenes </it>EGD-e is composed of a secretory signal peptide (25 amino acids) and the actual active portion of LLO (504 amino acids). In the cloning described in this paper we omitted the native secretory signal sequence (coding for the first 25 amino acids) of LLO and added six histidine amino acids (a His-tag) at the N-terminus (Figure <figr fid="F2">2</figr>). DNA sequencing of the constructed pNZPnisA:CYTO-LLO confirmed the addition of the six-His-tag upstream of the <it>hly </it>gene and the integrity of the remainder of the <it>hly </it>gene sequence. Overall we added a total of 10 amino acids (including the 6 histidine residues) at the N-terminus of LLO, in place of the signal sequence, to facilitate tagging and purification of the protein (Figure <figr fid="F2">2</figr>). These few amino acids did not affect protein activity as shown below.</p>
         </sec>
         <sec>
            <st>
               <p>Nisin-induced LLO production in <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO)</p>
            </st>
            <p>We performed a series of induction experiments on <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO) to determine the optimum conditions for protein expression. Preliminary induction time-course experiments showed the optimum duration for nisin-induction to be 3&#8211;4 h (data not shown). Consequently, induction was performed at mid-log phase (OD600 = 0.5) for three hours. Initially, different nisin concentrations were examined: 0.02%, 0.1%, and 0.2% (v/v), to determine the optimum concentration for induction and SDS-PAGE was performed to assess the amount of LLO produced (Figure <figr fid="F3">3A</figr>). Subsequently, for protein over-production experiments, 0.2% v/v nisin concentration was chosen for induction to maximize the amount of LLO produced. Western blot was also performed and confirmed the production of pure non-degraded LLO (Figure <figr fid="F3">3B</figr>). It is noteworthy that we detected minimal basal expression of LLO in the uninduced <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO) with no apparent toxicity on bacterial growth (data not shown). The inducer of basal PnisA activity in our experiments in the absence of nisin is not clear although other inducers such as lactose and galactose have been previously reported to induce this promoter at low levels <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. In our experiments the basal LLO expression was negligible compared to the amount of LLO produced upon nisin induction.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Optimization of nisin concentration for induction experiments</p>
               </caption>
               <text>
                  <p><b>Optimization of nisin concentration for induction experiments</b>. (A) SDS-PAGE of the induction experiment for 3 h statically at 30&#176;C without nisin addition (lane 1), and using nisin at concentrations of 0.02% (lane 2), 0.1% (lane 3) and 0.2% (lane 4) (v/v). Lane 5 represents the protein marker. (B) Western blot showing LLO at the expected size of about 57 kDa using rabbit anti-LLO as primary antibody.</p>
               </text>
               <graphic file="1475-2859-7-24-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Purification of LLO and total protein quantitation</p>
            </st>
            <p>To obtain rapid and reproducible purification of LLO, we used the Ni-NTA technology to capture and purify the six-His-tagged protein by affinity chromatography under native purification conditions. Figure <figr fid="F4">4</figr> shows a representative purification procedure of the His-tagged LLO (about 57 kDa) checked by SDS-PAGE. The average yield of pure LLO (measured as total protein) after 3 h-induction at 30&#176;C using a concentration of 0.2% v/v of nisin was 3 mg per litre culture as measured by both Lowry and A<sub>280 </sub>absorbance methods. When the induction time was increased to 4 h at 30&#176;C, the yield ranged from 4.43&#8211;5.9 mg per litre culture. However, to increase the total yield of LLO, we modified the LLO extraction method by applying double sonication to the 4 h-induced pellets of <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO). In brief, after the first sonication was completed (as described in the Methods section), the supernatant was collected for Ni-NTA purification and the remaining pellets were frozen again at -20&#176;C for 24 hours then thawed, resuspended in lysis buffer and sonicated again. Supernatant was collected and then Ni-NTA-gel-purified. This second sonication of the same pellets simply extracted LLO which had not been released from <it>Lactococcus </it>cells upon the first treatment. Eluted proteins from the two sonication treatments were tested by SDS-PAGE for purity (Figure <figr fid="F5">5</figr>) then combined and dialysed as mentioned earlier. This double sonication approach increased the total combined yield of LLO to the range of 9.3&#8211;12.9 mg per litre culture (average 11.6 &#177; 1.56 mg per litre culture). However, when the resulting LLO was examined by Western blot, minor lower molecular weight bands appeared below the major LLO band. This indicated slight degradation of LLO upon the double sonication procedure (Figure <figr fid="F6">6</figr>).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>SDS-PAGE of purified LLO using Ni-NTA affinity chromatography</p>
               </caption>
               <text>
                  <p><b>SDS-PAGE of purified LLO using Ni-NTA affinity chromatography</b>. Lane 1 is the protein marker, lane 2 is culture lysate of <it>L. lactis </it>NZ9000 (pNZPnisA:CYTO-LLO) before passing through the column, lane 3 is the flow-through of the column, lanes 4 and 5 are two successive washes of the columns while lanes 6 and 7 are two successive elutions showing the purified His-tagged LLO.</p>
               </text>
               <graphic file="1475-2859-7-24-4"/>
            </fig>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>SDS-PAGE showing pure LLO elutions (500 ml bacterial culture) using the double sonication approach</p>
               </caption>
               <text>
                  <p><b>SDS-PAGE showing pure LLO elutions (500 ml bacterial culture) using the double sonication approach</b>. Pure LLO was eluted from the Ni-NTA affinity gel after 4 h-0.2% nisin induction at 30&#176;C and double sonication treatment of the induced cells as described in the Methods section. Lanes 1&#8211;3: elutions after first sonication treatment. Lanes 4&#8211;8: elutions after second sonication treatment.</p>
               </text>
               <graphic file="1475-2859-7-24-5"/>
            </fig>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Western blot showing LLO level and stability after 0.2% nisin induction</p>
               </caption>
               <text>
                  <p><b>Western blot showing LLO level and stability after 0.2% nisin induction</b>. Left lane, LLO after 3 h induction (single sonication); Middle lane, LLO after 4 h induction (single sonication); Right lane, LLO after 4 h induction followed by the double sonication treatment (few degradation bands are observed at slightly lower molecular weights).</p>
               </text>
               <graphic file="1475-2859-7-24-6"/>
            </fig>
            <p>To check the functionality of LLO, the haemolytic titre test was carried out and specific LLO haemolytic activity ranged from 5 &#215; 10<sup>5 </sup>to 5 &#215; 10<sup>7 </sup>HU per mg total protein. This haemolytic activity was still detectable after at least 8 months of storage at 4&#176;C.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In the present study, we describe the over-expression of the haemolysin listeriolysin O (LLO) of <it>L. monocytogenes </it>by the GRAS microorganism <it>L. lactis </it>NZ9000. We used a well-defined strong promoter system (the NICE system) in which addition of subinhibitory nisin induces the PnisA promoter for over-expression of downstream genes <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. In the present work, we utilised a nisin concentration of 0.2% v/v for induction which maximized LLO production and was far below the minimum inhibitory concentration (MIC) of nisin against the producing strain (MIC was found to be 3.1% v/v).</p>
         <p>The NICE system has been used extensively in the literature to over-produce proteins in lactococci. For instance, <it>Brucella abortus </it>GroEL protein was produced in <it>L. lactis </it>NZ9000 although it was found that only the secreted rather than the intracellular form was stably produced suggesting a detrimental effect of GroEL protein on <it>Lactococcus </it><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. In contrast, <it>Giardia lamblia </it>cyst wall protein 2 (CWP2) was successfully produced in different cell compartments (intracellular, secreted, and cell-surface anchored) by use of appropriately designed vectors without any detrimental effects on the <it>Lactococcus </it>producer. Lactococci expressing CWP2 on their surface could elicit CWP2-specific IgA antibodies and reduced cyst shedding in a murine <it>Giardia </it>challenge model <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>.</p>
         <p>Here, we demonstrate the use of the NICE system to successfully over-express LLO of <it>L. monocytogenes </it>in the intracellular compartment of <it>L. lactis </it>NZ9000. Several previous studies examined the over-production of LLO in different host cells and expression systems (summarized in Table <tblr tid="T3">3</tblr>). Earlier studies that purified native LLO directly from <it>L. monocytogenes </it>culture supernatants had poor LLO yields (0.022&#8211;0.25 mg per litre culture) and utilised laborious multi-step procedures requiring large culture volumes <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. Dealing with such large culture volumes of pathogenic bacteria is potentially hazardous and necessitates special precautions if scaling-up is required. When LLO was constitutively over-expressed and secreted by the non-pathogenic <it>Listeria innocua</it>, an improved yield was obtained (1.6 mg LLO per litre culture) <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. However, purification of LLO from <it>L. innocua </it>involved multiple steps involving preliminary concentration by filtration, followed by two sequential chromatography purification steps <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>.</p>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Comparative results of LLO production and purification by different investigators.</p>
            </caption>
            <tblbdy cols="7">
               <r>
                  <c ca="center">
                     <p>
                        <b>Source of</b>
                     </p>
                     <p>
                        <b> LLO</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Starter</b>
                     </p>
                     <p>
                        <b>Culture</b>
                     </p>
                     <p>
                        <b>volume</b>
                     </p>
                     <p>
                        <b>   (litre)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>LLO yield </b>
                     </p>
                     <p>
                        <b>(mg l<sup>-1</sup>) </b>
                     </p>
                     <p>
                        <b>{Total</b>
                     </p>
                     <p>
                        <b> yield (mg)}</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Specific</b>
                     </p>
                     <p>
                        <b>LLO</b>
                     </p>
                     <p>
                        <b>haemolytic</b>
                     </p>
                     <p>
                        <b>activity (HU</b>
                     </p>
                     <p>
                        <b>per mg</b>
                     </p>
                     <p>
                        <b>protein) </b>
                     </p>
                     <p>
                        <b>     pH 5.5</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Expression host</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Plasmid expression</b>
                     </p>
                     <p>
                        <b>system/inducer</b>
                     </p>
                     <p>
                        <b>  (If applicable)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Reference</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="7">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Culture supernatant</p>
                  </c>
                  <c ca="center">
                     <p>27</p>
                  </c>
                  <c ca="center">
                     <p>0.022 {0.6}</p>
                  </c>
                  <c ca="center">
                     <p>10<sup>6 </sup>(pH 6)</p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>Listeria monocytogenes</it>
                        <sup>
                           <it>a</it>
                        </sup>
                     </p>
                  </c>
                  <c ca="center">
                     <p>N/A</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B24">24</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Culture supernatant</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>1.6 {4.8}</p>
                  </c>
                  <c ca="center">
                     <p>1.02 &#215; 10<sup>6 </sup>(pH 5.7)</p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>Listeria innocua</it>
                        <sup>
                           <it>b</it>
                        </sup>
                     </p>
                  </c>
                  <c ca="center">
                     <p>pERL3-503</p>
                     <p> (constitutive)</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B26">26</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Culture supernatant</p>
                  </c>
                  <c ca="center">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>0.25 {1.5}</p>
                  </c>
                  <c ca="center">
                     <p>2.6 &#215; 10<sup>5</sup></p>
                  </c>
                  <c ca="center">
                     <p>LLO-hypersecretor <it>Listeria monocytogenes</it><sup><it>a</it></sup></p>
                  </c>
                  <c ca="center">
                     <p>N/A</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B25">25</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Cell lysate</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>4.5 {4.5}</p>
                  </c>
                  <c ca="center">
                     <p>1.25 &#215; 10<sup>6</sup></p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>Escherichia coli</it>
                        <sup>
                           <it>c</it>
                        </sup>
                     </p>
                  </c>
                  <c ca="center">
                     <p>pET system/IPTG</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B15">15</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Cell lysate</p>
                  </c>
                  <c ca="center">
                     <p>0.6</p>
                  </c>
                  <c ca="center">
                     <p>3.5 &#8211; 8 {2.1 &#8211; 4.8}</p>
                  </c>
                  <c ca="center">
                     <p>1.8 &#215; 10<sup>6</sup></p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>Escherichia coli</it>
                        <sup>
                           <it>d</it>
                        </sup>
                     </p>
                  </c>
                  <c ca="center">
                     <p>pQE31 system/IPTG</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B14">14</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Cell lysate</p>
                  </c>
                  <c ca="center">
                     <p>0.6</p>
                  </c>
                  <c ca="center">
                     <p>2.5 {1.5}</p>
                  </c>
                  <c ca="center">
                     <p>2.16 &#215; 10<sup>6</sup></p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>Escherichia coli</it>
                        <sup>
                           <it>e</it>
                        </sup>
                     </p>
                  </c>
                  <c ca="center">
                     <p>pQE70 system/IPTG</p>
                  </c>
                  <c ca="center">
                     <p>
                        <abbrgrp>
                           <abbr bid="B14">14</abbr>
                        </abbrgrp>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Cell lysate</p>
                  </c>
                  <c ca="center">
                     <p>0.5</p>
                  </c>
                  <c ca="center">
                     <p>-Single sonication treatment: 4.43 &#8211; 5.9 {2.215 &#8211; 2.95} -Double sonication approach: 9.3 &#8211; 12.9 {4.65 &#8211; 6.45}</p>
                  </c>
                  <c ca="center">
                     <p>5 &#215; 10<sup>5 </sup>&#8211; 5 &#215; 10<sup>7</sup></p>
                  </c>
                  <c ca="center">
                     <p><it>Lactococcus lactis </it>NZ9000<sup><it>d</it></sup></p>
                  </c>
                  <c ca="center">
                     <p>NICE system (pNZPnisA:CYTO-LLO)/nisin</p>
                  </c>
                  <c ca="center">
                     <p>This study</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>(N/A) not applicable; IPTG: Isopropyl &#946;-D-1-thiogalactopyranoside; <it>a </it>untagged native full-length LLO; <it>b </it>untagged full-length LLO; <it>c </it>untagged LLO without signal sequence; <it>d </it>N-terminus His-tagged LLO without signal sequence; <it>e </it>C-terminus His-tagged LLO without signal sequence</p>
            </tblfn>
         </tbl>
         <p>Giammarini and coworkers could inducibly over-express LLO in <it>E. coli </it>obtaining a relatively good yield (4.5 mg per litre culture) <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. However, two sequential purification steps were applied with haemolytic activity assessment on blood agar and SDS-PAGE performed between the first hydroxyapatite purification step and the second ammonium sulphate precipitation step. Further concentration steps were applied before the effluent fractions containing LLO were concentrated by ultrafiltration <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Although the LLO yield was good, those multi-step procedures are relatively time-consuming. To the best of our knowledge, Churchill et al were able to obtain the highest yield of haemolytically active LLO <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. In their study, several expression systems have been attempted in <it>E. coli </it>among which the N-terminus His-tagged LLO was the most successful using the pQE31/IPTG (Isopropyl &#946;-D-1-thiogalactopyranoside)-inducible system (Qiagen). This system makes use of the well-characterized strong T5 promoter/<it>lac </it>operator transcription-translation system to control LLO expression in <it>E. coli</it>. A significant LLO yield (3.5&#8211;8 mg per litre culture) was obtained with proven haemolytic activity (1.8 &#215; 10<sup>6 </sup>HU per mg protein) and stability up to one year upon storage at 4&#176;C <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>The current <it>L. lactis</it>-based LLO production method resembles to some extent the N-terminus His-tagged LLO prepared by Churchill et al <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. As regards LLO yield, the single sonication treatment gave an appreciably good pure yield (4.43&#8211;5.9 mg per litre culture) though the highest value (i.e. 5.9 mg per litre culture) is less than the highest yield obtained by Churchill and coworkers (8 mg per litre culture) <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Although the double sonication treatment of the same culture resulted in some minor degradation of LLO (Figure <figr fid="F6">6</figr>), the total yield almost doubled (up to 12.9 mg per litre culture) without using any additional culture. This minor degradation may be tolerable for experimental scale production (but not for large commercial scale production). We also assessed the haemolytic activity of the purified LLO at intervals up to 8 months and found it to be within the same range (5 &#215; 10<sup>5 </sup>to 5 &#215; 10<sup>7 </sup>HU per mg total protein).</p>
         <p>We consider the most important innovation in the current work is the use of <it>L. lactis </it>as an expression host. <it>L. lactis </it>is a GRAS, Gram-positive lactic acid bacterium widely used in the food industry. More recently <it>L. lactis </it>has demonstrated significant promise as a means of producing heterologous proteins for experimental or commercial applications <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Lactic acid bacteria expressing heterologous proteins have been used in the food industry <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, in experimental vaccine antigen delivery <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B28">28</abbr></abbrgrp>, and for the targeted delivery of therapeutic bioactive proteins (cytokines and trefoil factors) <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B29">29</abbr></abbrgrp>. In producing bioactive proteins for human or animal use, lactococci have a significant advantage over <it>E. coli </it>in that they do not produce endotoxins. Moreover, <it>L. lactis </it>is known to produce very low amounts of native exoproteins and the lactococcal genome is generally about half the size of the <it>E. coli </it>genome <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B18">18</abbr><abbr bid="B30">30</abbr></abbrgrp>. This is an advantage both for <it>in vitro </it>heterologous protein production and for the use of <it>L. lactis </it>as a vaccine delivery vehicle as there are fewer contaminating proteins when <it>L. lactis </it>is used as a heterologous host <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B31">31</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The present study offers a convenient method for LLO production in an advantageous host providing a good protein yield, high haemolytic activity and significant stability that compares well with previously published studies. Purified LLO from <it>L. lactis </it>may find significant applications in basic research into listerial pathogenesis including the stimulation and development of improved monoclonal antibodies against LLO. This <it>L. monocytogenes</it>-specific protein may also have applications in the development of improved food testing protocols. Finally, <it>L. lactis </it>production of LLO may have applications in vaccine development.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>MB carried out the molecular genetic and protein studies and drafted the manuscript. BTG participated in the design and coordination of the study. CGMG conceived of the study, and participated in its design and follow-up and helped to draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>Mohammed Bahey-El-Din is a recipient of a postgraduate scholarship from the Egyptian government administered through the Education and Culture Bureau of the Egyptian Embassy, London. The authors would like to acknowledge the funding received from the Irish Government under the National Development Plan 2000&#8211;2006 and the funding of the Alimentary Pharmabiotic Centre by the Science Foundation of Ireland Centres for Science Engineering and Technology (CSET) programme.</p>
            <p>We thank Abdelhamid Abbas for helpful advice and information.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Emerging issues in microbiological food safety</p>
            </title>
            <aug>
               <au>
                  <snm>Meng</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Doyle</snm>
                  <fnm>MP</fnm>
               </au>
            </aug>
            <source>Annu Rev Nutr</source>
            <pubdate>1997</pubdate>
            <volume>17</volume>
            <fpage>255</fpage>
            <lpage>275</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.nutr.17.1.255</pubid>
                  <pubid idtype="pmpid" link="fulltext">9240928</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p><it>Listeria</it>--review of epidemiology and pathogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Ramaswamy</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Cresence</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Rejitha</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Lekshmi</snm>
                  <fnm>MU</fnm>
               </au>
               <au>
                  <snm>Dharsana</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Prasad</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Vijila</snm>
                  <fnm>HM</fnm>
               </au>
            </aug>
            <source>J Microbiol Immunol Infect</source>
            <pubdate>2007</pubdate>
            <volume>40</volume>
            <issue>1</issue>
            <fpage>4</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17332901</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p><it>Listeria</it> pathogenesis and molecular virulence determinants</p>
            </title>
            <aug>
               <au>
                  <snm>Vazquez-Boland</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Kuhn</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Berche</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Chakraborty</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Dominguez-Bernal</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Goebel</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gonzalez-Zorn</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wehland</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kreft</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Clin Microbiol Rev</source>
            <pubdate>2001</pubdate>
            <volume>14</volume>
            <issue>3</issue>
            <fpage>584</fpage>
            <lpage>640</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">88991</pubid>
                  <pubid idtype="pmpid" link="fulltext">11432815</pubid>
                  <pubid idtype="doi">10.1128/CMR.14.3.584-640.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Detection of <it>Listeria</it> monocytogenes and the toxin listeriolysin O in food</p>
            </title>
            <aug>
               <au>
                  <snm>Churchill</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Microbiol Methods</source>
            <pubdate>2006</pubdate>
            <volume>64</volume>
            <issue>2</issue>
            <fpage>141</fpage>
            <lpage>170</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.mimet.2005.10.007</pubid>
                  <pubid idtype="pmpid" link="fulltext">16310269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Evaluation of indirect and avidin-biotin enzyme linked immunosorbent assays for detection of anti-listeriolysin O antibodies in bovine milk samples</p>
            </title>
            <aug>
               <au>
                  <snm>Kalorey</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Kurkure</snm>
                  <fnm>NV</fnm>
               </au>
               <au>
                  <snm>Warke</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Barbuddhe</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Zoonoses Public Health</source>
            <pubdate>2007</pubdate>
            <volume>54</volume>
            <issue>8</issue>
            <fpage>301</fpage>
            <lpage>306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1863-2378.2007.01066.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17894640</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Immune responses to Listeria monocytogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Pamer</snm>
                  <fnm>EG</fnm>
               </au>
            </aug>
            <source>Nat Rev Immunol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <issue>10</issue>
            <fpage>812</fpage>
            <lpage>823</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nri1461</pubid>
                  <pubid idtype="pmpid" link="fulltext">15459672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Plasmids of lactococci - genetic accessories or genetic necessities?</p>
            </title>
            <aug>
               <au>
                  <snm>Mills</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McAuliffe</snm>
                  <fnm>OE</fnm>
               </au>
               <au>
                  <snm>Coffey</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fitzgerald</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Ross</snm>
                  <fnm>RP</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Rev</source>
            <pubdate>2006</pubdate>
            <volume>30</volume>
            <issue>2</issue>
            <fpage>243</fpage>
            <lpage>273</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1574-6976.2005.00011.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16472306</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Heterologous protein production and delivery systems for <it>Lactococcus lactis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Nouaille</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ribeiro</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Miyoshi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pontes</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Le Loir</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Langella</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Azevedo</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Genet Mol Res</source>
            <pubdate>2003</pubdate>
            <volume>2</volume>
            <issue>1</issue>
            <fpage>102</fpage>
            <lpage>111</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12917806</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Complete genome sequence of the prototype lactic acid bacterium <it>Lactococcus lactis</it> subsp. cremoris MG1363</p>
            </title>
            <aug>
               <au>
                  <snm>Wegmann</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>O'Connell-Motherway</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zomer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Buist</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Shearman</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Canchaya</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ventura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Goesmann</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gasson</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kuipers</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>van Sinderen</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kok</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2007</pubdate>
            <volume>189</volume>
            <issue>8</issue>
            <fpage>3256</fpage>
            <lpage>3270</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1855848</pubid>
                  <pubid idtype="pmpid" link="fulltext">17307855</pubid>
                  <pubid idtype="doi">10.1128/JB.01768-06</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>A phase I trial with transgenic bacteria expressing interleukin-10 in Crohn's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Braat</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Rottiers</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hommes</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Huyghebaert</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Remaut</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Remon</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>van Deventer</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Neirynck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Peppelenbosch</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Steidler</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Clin Gastroenterol Hepatol</source>
            <pubdate>2006</pubdate>
            <volume>4</volume>
            <issue>6</issue>
            <fpage>754</fpage>
            <lpage>759</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cgh.2006.03.028</pubid>
                  <pubid idtype="pmpid">16716759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Mucosal delivery of a pneumococcal vaccine using <it>Lactococcus lactis</it> affords protection against respiratory infection</p>
            </title>
            <aug>
               <au>
                  <snm>Hanniffy</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Carter</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Hitchin</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2007</pubdate>
            <volume>195</volume>
            <issue>2</issue>
            <fpage>185</fpage>
            <lpage>193</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/509807</pubid>
                  <pubid idtype="pmpid" link="fulltext">17191163</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Autoregulation of nisin biosynthesis in <it>Lactococcus lactis</it> by signal transduction</p>
            </title>
            <aug>
               <au>
                  <snm>Kuipers</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>Beerthuyzen</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>de Ruyter</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Luesink</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>de Vos</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1995</pubdate>
            <volume>270</volume>
            <issue>45</issue>
            <fpage>27299</fpage>
            <lpage>27304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.270.45.27299</pubid>
                  <pubid idtype="pmpid" link="fulltext">7592991</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Quorum sensing-controlled gene expression in lactic acid bacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Kuipers</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>de Ruyter</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kleerebezem</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>de Vos</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Journal of Biotechnology</source>
            <pubdate>1998</pubdate>
            <volume>64</volume>
            <issue>1</issue>
            <fpage>15</fpage>
            <lpage>21</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-1656(98)00100-X</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Rapid purification of recombinant listeriolysin O (LLO) from <it>Escherichia coli</it></p>
            </title>
            <aug>
               <au>
                  <snm>Churchill</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Ind Microbiol Biotechnol</source>
            <pubdate>2005</pubdate>
            <volume>32</volume>
            <issue>8</issue>
            <fpage>355</fpage>
            <lpage>363</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10295-005-0002-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">16052337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>High-level expression of the <it>Listeria </it>monocytogenes listeriolysin O in <it>Escherichia coli </it>and preliminary characterization of the purified protein</p>
            </title>
            <aug>
               <au>
                  <snm>Giammarini</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Andreoni</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Amagliani</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Casiere</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Barocci</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Magnani</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Protein Expr Purif</source>
            <pubdate>2003</pubdate>
            <volume>28</volume>
            <issue>1</issue>
            <fpage>78</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1046-5928(02)00682-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12651110</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Horton</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Cai</snm>
                  <fnm>ZL</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>SN</fnm>
               </au>
               <au>
                  <snm>Pease</snm>
                  <fnm>LR</fnm>
               </au>
            </aug>
            <source>Biotechniques</source>
            <pubdate>1990</pubdate>
            <volume>8</volume>
            <issue>5</issue>
            <fpage>528</fpage>
            <lpage>535</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2357375</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>High-frequency transformation, by electroporation, of <it>Lactococcus lactis</it> subsp. cremoris grown with glycine in osmotically stabilized media</p>
            </title>
            <aug>
               <au>
                  <snm>Holo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nes</snm>
                  <fnm>IF</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>1989</pubdate>
            <volume>55</volume>
            <issue>12</issue>
            <fpage>3119</fpage>
            <lpage>3123</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">203233</pubid>
                  <pubid idtype="pmpid" link="fulltext">16348073</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p><it>Lactococcus lactis</it> as host for overproduction of functional membrane proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Kunji</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Slotboom</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Poolman</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>2003</pubdate>
            <volume>1610</volume>
            <issue>1</issue>
            <fpage>97</fpage>
            <lpage>108</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0005-2736(02)00712-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12586384</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Peptide property calculator, center for biotechnology, Northwestern University</p>
            </title>
            <aug>
               <au>
                  <snm>Chazan</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <url>http://www.basic.northwestern.edu/biotools/proteincalc.html</url>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Dissociated linkage of cytokine-inducing activity and cytotoxicity to different domains of listeriolysin O from <it>Listeria </it>monocytogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Kohda</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kawamura</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nomura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ito</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kimoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Mitsuyama</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <issue>3</issue>
            <fpage>1334</fpage>
            <lpage>1341</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">127785</pubid>
                  <pubid idtype="pmpid" link="fulltext">11854218</pubid>
                  <pubid idtype="doi">10.1128/IAI.70.3.1334-1341.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Nisin independent induction of the nisA promoter in <it>Lactococcus lactis</it> during growth in lactose or galactose</p>
            </title>
            <aug>
               <au>
                  <snm>Chandrapati</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>O'Sullivan</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>1999</pubdate>
            <volume>170</volume>
            <issue>1</issue>
            <fpage>191</fpage>
            <lpage>198</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9919668</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Heterologous expression of <it>Brucella abortus</it> GroEL heat-shock protein in Lactococcus lactis</p>
            </title>
            <aug>
               <au>
                  <snm>Miyoshi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bermudez-Humaran</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Ribeiro</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Le Loir</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Oliveira</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Langella</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Azevedo</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Microb Cell Fact</source>
            <pubdate>2006</pubdate>
            <volume>5</volume>
            <fpage>14</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1444932</pubid>
                  <pubid idtype="pmpid" link="fulltext">16556312</pubid>
                  <pubid idtype="doi">10.1186/1475-2859-5-14</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Expression of the <it>Giardia lamblia</it> cyst wall protein 2 in <it>Lactococcus lactis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Faubert</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>Microbiology</source>
            <pubdate>2006</pubdate>
            <volume>152</volume>
            <issue>Pt 7</issue>
            <fpage>1981</fpage>
            <lpage>1990</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/mic.0.28877-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">16804173</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Purification, characterization, and toxicity of the sulfhydryl-activated hemolysin listeriolysin O from <it>Listeria</it> monocytogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Geoffroy</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gaillard</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Alouf</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Berche</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1987</pubdate>
            <volume>55</volume>
            <issue>7</issue>
            <fpage>1641</fpage>
            <lpage>1646</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">260571</pubid>
                  <pubid idtype="pmpid" link="fulltext">3110067</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A method for purification of listeriolysin O from a hypersecretor strain of <it>Listeria monocytogenes</it></p>
            </title>
            <aug>
               <au>
                  <snm>Walton</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>GY</fnm>
               </au>
            </aug>
            <source>Protein Expr Purif</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <issue>2</issue>
            <fpage>243</fpage>
            <lpage>245</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/prep.1998.1022</pubid>
                  <pubid idtype="pmpid" link="fulltext">10049682</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Hyperexpression of listeriolysin in the nonpathogenic species <it>Listeria innocua</it> and high yield purification</p>
            </title>
            <aug>
               <au>
                  <snm>Darji</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chakraborty</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Niebuhr</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tsonis</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wehland</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Weiss</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Biotechnol</source>
            <pubdate>1995</pubdate>
            <volume>43</volume>
            <issue>3</issue>
            <fpage>205</fpage>
            <lpage>212</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0168-1656(95)00138-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">8590646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Expression of the catalase gene katA in starter culture <it>Lactobacillus plantarum</it> TISTR850 tolerates oxidative stress and reduces lipid oxidation in fermented meat product</p>
            </title>
            <aug>
               <au>
                  <snm>Noonpakdee</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Sitthimonchai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Panyim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lertsiri</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Int J Food Microbiol</source>
            <pubdate>2004</pubdate>
            <volume>95</volume>
            <issue>2</issue>
            <fpage>127</fpage>
            <lpage>135</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ijfoodmicro.2004.01.020</pubid>
                  <pubid idtype="pmpid" link="fulltext">15282125</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Expression of <it>Helicobacter pylori </it>cag12 gene in <it>Lactococcus lactis</it> MG1363 and its oral administration to induce systemic anti-Cag12 immune response in mice</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Jun do</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>YH</fnm>
               </au>
            </aug>
            <source>Appl Microbiol Biotechnol</source>
            <pubdate>2006</pubdate>
            <volume>72</volume>
            <issue>3</issue>
            <fpage>462</fpage>
            <lpage>470</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00253-005-0285-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">16586107</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Active delivery of trefoil factors by genetically modified <it>Lactococcus lactis</it> prevents and heals acute colitis in mice</p>
            </title>
            <aug>
               <au>
                  <snm>Vandenbroucke</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hans</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Van Huysse</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Neirynck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Demetter</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Remaut</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Rottiers</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Steidler</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Gastroenterology</source>
            <pubdate>2004</pubdate>
            <volume>127</volume>
            <issue>2</issue>
            <fpage>502</fpage>
            <lpage>513</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/j.gastro.2004.05.020</pubid>
                  <pubid idtype="pmpid" link="fulltext">15300583</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>The complete genome sequence of <it>Escherichia coli</it> K-12</p>
            </title>
            <aug>
               <au>
                  <snm>Blattner</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>G</fnm>
                  <suf>3rd</suf>
               </au>
               <au>
                  <snm>Bloch</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Perna</snm>
                  <fnm>NT</fnm>
               </au>
               <au>
                  <snm>Burland</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Riley</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Collado-Vides</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Glasner</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Rode</snm>
                  <fnm>CK</fnm>
               </au>
               <au>
                  <snm>Mayhew</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Gregor</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>NW</fnm>
               </au>
               <au>
                  <snm>Kirkpatrick</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Goeden</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Mau</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Shao</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1997</pubdate>
            <volume>277</volume>
            <issue>5331</issue>
            <fpage>1453</fpage>
            <lpage>1474</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.277.5331.1453</pubid>
                  <pubid idtype="pmpid" link="fulltext">9278503</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Production of human papillomavirus type 16 E7 protein in <it>Lactococcus lactis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Bermudez-Humaran</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Langella</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Miyoshi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gruss</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Guerra</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Montes de Oca-Luna</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Le Loir</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Appl Environ Microbiol</source>
            <pubdate>2002</pubdate>
            <volume>68</volume>
            <issue>2</issue>
            <fpage>917</fpage>
            <lpage>922</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">126697</pubid>
                  <pubid idtype="pmpid" link="fulltext">11823236</pubid>
                  <pubid idtype="doi">10.1128/AEM.68.2.917-922.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Comparative genomics of <it>Listeria species</it></p>
            </title>
            <aug>
               <au>
                  <snm>Glaser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Frangeul</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Buchrieser</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rusniok</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Amend</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Baquero</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Berche</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bloecker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Brandt</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Chakraborty</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Charbit</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chetouani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Couve</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>de Daruvar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dehoux</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Domann</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Dominguez-Bernal</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Duchaud</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Durant</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Dussurget</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Entian</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Fsihi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Garcia-del Portillo</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Garrido</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gautier</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Goebel</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gomez-Lopez</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hain</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hauf</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Kaerst</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Kreft</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kuhn</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kunst</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kurapkat</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Madueno</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Maitournam</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vicente</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Ng</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Nedjari</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nordsiek</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Novella</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>de Pablos</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Perez-Diaz</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Purcell</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Remmel</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schlueter</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Simoes</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Tierrez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vazquez-Boland</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Voss</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wehland</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cossart</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>294</volume>
            <issue>5543</issue>
            <fpage>849</fpage>
            <lpage>852</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11679669</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
