Nuclear extracts were prepared as described 18. Cell were washed twice with PBS and detached by trypsinization. After homogenization with Dounce B homogeneizer, nuclear proteins were obtained and protein concentration was determined using Bio-Rad protein assay. Nuclear extracts were brought to a concentration of 0.5 μg/μl for Electrophoretic Mobility Shift Assay (EMSA) experiments 18.

EMSA was perfomed as previously described 181920. Briefly, double-stranded synthetic oligodeoxynucleotides mimicking the NF-κB binding site present in the promoter of the IL-8 gene (IL-8 NF-κB, sense: 5'-AAT CGT GGA ATT TCC TCT-3') have been employed. Oligodeoxynucleotides were labeled with γ³²-P-ATP using 10 Units of T4-polynucleotide-kinase (MBI Fermentas) in 500 mM Tris-HCl, pH 7.6, 100 mM MgCl₂, 50 mM DTT, 1 mM spermidine, 1 mM EDTA in the presence of 50 μCi γ³²-P-ATP) in a volume of 20 μl for 45 minutes at 37°C. Reaction was brought to 150 mM NaCl and 150 ng complementary oligodeoxynucleotide was added. Reaction temperature was increased to 100°C for 5 minutes and left diminishing to room temperature overnight. Nuclear extracts from IB3-1 cells or purified NF-κB p50 dimer protein (Promega) were used at the specified concentrations and poly(dI:dC) (1 mg per reaction) was also added to abolish nonspecific binding 21. After 5 min binding at room temperature, the samples were run at constant voltage (200 V) under low ionic strength conditions (0.25× TBE buffer: 22 mM Tris-borate, 0.4 mM EDTA) on 6% polyacrylamide gels. Gels were dried and subjected to standard autoradiographic procedures.

IB3-1 cells have been obtained from LGC Promochem 20. Cells have been grown in LHC-8 basal medium (Biofluids), supplemented with 5% FBS in the absence of gentamycin 21. All culture flasks and plates have been coated with a solution containing 35 g/ml bovine collagen (Becton-Dickinson), 1 g/ml bovine serum albumin (Sigma) and 1 g/ml human fibronectin (Becton-Dickinson) as described. P. aeruginosa, PAO1 strain, was grown in trypticase soy broth (TSB) or agar (TSA) (Difco). Bacteria colonies from o/n cultures on TSA plates were grown in 20 ml TSB at 37°C. IB3-1 cells were infected with ranging doses of PAO1 at 37°C for 4 hours.

Total RNA from IB3-1 cells was isolated using High Pure RNA Isolation Kit (Roche. Mannheim. Germany) 21. Total RNA (2.5 μg) was reverse-transcribed to cDNA using the High Capacity cDNA Archive Kit and random primers (Applied Biosystems) in a 100-μl reaction. The cDNA (2 μl) was then amplified for 50 PCR cycles using the Platinum^® SYBR^® Green qPCR SuperMix-UDG (Invitrogen) in an ABI Prism 5700 sequence detection system (Applied Biosystems). The real-time PCR reactions were performed in duplicates for both target and normalizer genes. Primer sequences for detection of IL-8 mRNA were GACCACACTGCGCCAACA (IL-8 forward) and GCTCTCTTCCATCAGAAAGTTACATAATTT(IL-8 reverse). Primer sets were purchased from Sigma-Genosys (The Woodlands. TX). Results were collected with Sequence Detection Software (version 1.3; Applied Biosystems). Relative quantification of gene expression was performed using the comparative threshold (C_T) method as described by the manufacturer (Applied Biosystems User Bulletin 2). Changes in mRNA expression level were calculated following normalization to calibrator gene 22. The ratios obtained following normalization are expressed as -fold change over untreated samples.

The docking results for all the reference inhibitory compounds and the natural compounds under study are reported in Table 1 (references compounds) and in Table 2 (natural compounds). As shown in the 2.3 Å crystal structure, the DNA/p50 complex is formed by one DNA molecule and two p50 proteins each one consisting of two distinct domains connected by a10-residue linker. Both domains and the segments that connects them, form a sequence-specific DNA-binding surface by contributing 5 loops per subunit that fill the entire major groove of the DNA. The specific interactions that stabilized the NF-kappaB/DNA complex, occur over 10-bp forming the kB recognition site. Unlike many dimeric protein-DNA complexes, many residues of both subunits make specific base contacts in a non-contiguous cooperative network. The plasticity of centre region of the interface carry to the lack of symmetry exhibited by the interactions of Lys 241 from the linker segment, and Lys 272 and Arg 305 from the dimerization region with the symmetrical target site 4. In the subsequent experimental EMSA studies, a recombinant p50 protein that probably forms a monomer-dimer mixture in binding buffer solution will be used. On the base of structural and experimental assumptions as above mentioned, p50 dimer and monomer were employed as protein target in our molecular modelling investigation.

In order to evaluate the impact of the introduction of the similarity penalty in the docking algorithm on the results, the positions of 9i and 10i used as test set in the final GlideScore ranking were compared in the two different procedures (Table 2).

Known active compound 10i was ranked at the top positions in both procedures, but only the introduction of the similarity parameter in the scoring function significantly increased the efficiency in 9i ranking (Table 2). In fact the difference in glide-score among these two inhibitors with a similar inhibitory potency (500 μM) 9 was very small (ΔGlideScore = 0.10). For each selected ligand the pose with best E-Model score (combination of energy grid score, GlideScore, and the internal strain of the ligand) was used for in-deph interaction analysis. Compound 21 clearly showed highest score in respect to docked plant extracts (Table 2) outranking the known inhibitors at physiological pH in docking simulation to the dimer.

Docked compounds 1–27, 9i and 10i, occupied a region of the binding surface creates by the spatial relationship between the N-terminal domain of p50 subunit and the 10 residues long linker loop (Figure 3). Molecules 21, 9i and 10i (Figure 4) were located in a small cleft surrounded by several polar amino acids (i.e. Tyr57, His109, His141, Tyr143 Lys144, Lys145, Ser208, Asp239, Lys241 and Ser208) and the highest score poses were superimposable with minimum RMSD of 1.36 Å for compounds 9i and 21. The RMSD was calculated by superimposing the following atoms pairs: heteroatoms involved in hydrogen bonding with the same residues of the protein (9i.O8 and 21.O2'; 9i.O7 and 21.O1a) (Figure 4B) and the centroid of aromatic system of coumarin structure with the centroid of benzene ring of 21. These compounds showed slightly different binding modes in p50 (chain A), p50 (chain B) and p50-p50 targets. Here we reported the highest score poses obtained from docking protocol including the similarity function. H-bond interactions between OH groups of coumarin structures (OH of benzene ring in 21) and both NH of His141 and the carboxylic group of Asp239 showed to be important for ligands binding.

Moreover, OH groups of coumarin moiety (carboxylate group in 21) made an additional hydrogen bond with CO of the backbone and protonated NH₃ group of Lys241 (Table 3). It is important to note that Lys241 could be involved in the stability of the DNA-binding conformation of the protein. In fact, as discussed above, this residue is situated in the flexible linker segment and interacts with Lys 272 and Arg 305 from the dimerization domain. Finally, carbonyl group of 10i engage another H-bond with NH of the backbone of the Leu207. Compound 21 showed the same binding mode of active ligands in the monomer configuration of the target, with the only difference of a stronger interaction of carboxylate group with Lys241 (Table 3 and Figures 5A, 6A).

Interestingly, the best pose of compound 21 occupied a region formed by residues of both p50 units (chain A and chain B) of NF-kappaB dimer: Lys 145 and Thr143 of chain A and Tyr57, Lys144, Lys145, Glu60, Cys59, Thr143, Lys146 of chain B. In particular, the OH group of the ligand engages a hydrogen bond with the sidechain of Thr143 (chain B), and the carboxylate group forms a salt bridge stabilized by two hydrogen bonds with the side chain of Lys 145 (chain B). Moreover the phenyl structure of compound 21 could be involved in a weak π-π stacking interaction with the aromatic moiety of Tyr57 (chain B) (centroid-centroid distance: 4.93 Å), a residue specific for kB DNA sequence 5'-GGGATTTCC-3', present in different cellular genes including HIV-LTR. Of course, further dynamics simulation on the protein-ligand complex should be necessary to validate this hypothesis. In addition, the amino group of Lys145 of the opposite p50 unit (chain A) could form an additional π-cation interaction with the aromatic group of 21 (N⁺-H and centroid of benzene ring distance: 3.87 Å) (Figures 5B, 6B). These bridge structures are likely to reinforce the anchoring of this molecule to the DNA binding region of the dimer, and might account for the slight better G-score of 21 in respect to the monomer configuration of the receptor. Moreover, all the residues of the protein involved in molecular interactions with molecule 21, form hydrogen bonds also with DNA.

All compounds with higher GlideScore and E-Model score clearly showed the ability to make a maximum number of hydrogen bonding, according with the result as previously reported on a flexible docking studies of known inhibitors 9i and 10i 9, even if reported residues involved in binding interaction were different. The highest ranking poses of 21, 9i and 10i formed 3–4 hydrogen bonding with the target protein, whereas molecules in medium positions in docking ranking not more than 2. According, structures not involved in hydrogen bonding were ranked in the last positions (Table 2). In particular, compound 5 with a GlideScore < 0 in similarity protocol lost the ability both to occupy the same positions of active ligands and to form hydrogen bonding with the protein (not shown). In house experimental data were in good agreement with the molecular modelling findings. In accordance with docking results, 21 and 5 showed to be active and inactive respectively in further EMSA experimental studies.

The effects of compound 21 on NF-kappaB interactions were first studied by electrophoretic mobility shift assay (EMSA) as described elsewhere 18192021. It is indeed well accepted that molecules binding NF-kappaB might retain inhibitory activity on molecular interaction between NF-kappaB and DNA 21. Accordingly, we performed EMSA in the presence of increasing amounts of compound 21. In addition, compounds 5 was used as possible negative control. This compound, indeed, is expected, from the docking analysis (Table 2), to be less active. In addition, extracts from Cupressus pyramidalis were also used, since this extract does not inhibit NF-kappaB/DNA interactions (data not shown). Finally, the known inhibitory compound 9i was used as reference molecule. The results of the gel retardation analysis are shown in Figure 7 and clearly demonstrate that compound 21 inhibit the molecular interactions between nuclear factors (Figure 7B) or isolated NF-kappaB p50 (Figure 7C and 7D) and a target double stranded oligonucleotide mimicking the NF-kappaB binding sites. This effect was similar to that exhibited by the reference compound 9i. Interestingly, compound 5 and extracts from C. pyramidalis were found to be inactive (Figure 7A), fully in agreement with the docking data summarized in Table 2.

Several experimental model system are available for biological validation of molecules inhibiting NF-kappaB function. In a recent paper we report that decoy oligonucleotides targeting NF-kappaB are powerful inhibitors of Pseudomoas aeruginosa mediated induction of IL-8 in cystic fibrosis IB3-1 cells 21. Besides the importance of these data for the theoretical point of view, our results are of great interest for the practical point of view, suggesting this treatment as a possible strategy for the therapy of inflammation associated with cystic fibrosis.

When the effects of P. aeruginosa infection on the expression of pro-inflammatory genes of IB3-1 cells infected for 4 hours are analysed, the results shown in Figure 8A are obtained. In this preliminary experiment the content of RNAs coding for several pro-inflammatory proteins was analysed by RT-PCR. The results obtained indicate that IL-8 mRNA sequences sharply increases following PAO1 infection by 40 folds (range 12–92) in respect to basal level of uninfected cells, assumed to be 1. In addition to IL-8 mRNA, other genes induced by PAO1 are GRO-γ (15 folds, range 9–36), IL-6 (18 folds, range 5–44), IL-1β (5 folds, range 2–8), ICAM-1 (4 folds, range 2–8). On the contrary, very low increase of accumulation of IP-10, RANTES, MIP-1α, TNF-α, IFN-β, TGF-β and IL-10 mRNA was observed under these experimental conditions.

Since NF-kappaB is one of the most important transcription factors regulating the expression of IL-8 gene [23] and the data reported in Figure 7 demonstrate that compound 21 inhibit NF-kappaB/DNA interactions, we tested the activity of this compound in inhibiting the expression of IL-8 gene in IB3-1 cells infected with PAO1. Cells were exposed to different concentrations of compound 21 and then infected with 150 cfu/cell of PAO1. After 4 hours, cells were harvested, RNA extracted and quantitative RT-PCR analysis performed. The results obtained (Figure 8B) demonstrate that compound 21 is a strong inhibitor of PAO-1 induced accumulation of IL-8 mRNA.