<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1472-6769-10-4</ui>
   <ji>1472-6769</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Dietary phenethylisothiocyanate attenuates bowel inflammation in mice</p>
         </title>
         <aug>
            <au ca="yes" id="A1">
               <snm>Dey</snm>
               <fnm>Moul</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>MOUL.DEY@SDSTATE.EDU</email>
            </au>
            <au id="A2">
               <snm>Kuhn</snm>
               <fnm>Peter</fnm>
               <insr iid="I2"/>
               <email>PEKUHN@RCI.RUTGERS.EDU</email>
            </au>
            <au id="A3">
               <snm>Ribnicky</snm>
               <fnm>David</fnm>
               <insr iid="I3"/>
               <email>RIBNICKY@AESOP.RUTGERS.EDU</email>
            </au>
            <au id="A4">
               <snm>Premkumar</snm>
               <fnm>VummidiGiridhar</fnm>
               <insr iid="I3"/>
               <insr iid="I5"/>
               <email>PREMKUMARVG@GMAIL.COM</email>
            </au>
            <au id="A5">
               <snm>Reuhl</snm>
               <fnm>Kenneth</fnm>
               <insr iid="I4"/>
               <email>REUHL@EOHSI.RUTGERS.EDU</email>
            </au>
            <au id="A6">
               <snm>Raskin</snm>
               <fnm>Ilya</fnm>
               <insr iid="I3"/>
               <email>RASKIN@AESOP.RUTGERS.EDU</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Nutrition, Food Science and Hospitality, South Dakota State University, Box 2275A, Brookings, SD 57007, USA</p>
            </ins>
            <ins id="I2">
               <p>Phytomedics Inc., 1085 Cranbury South River Road, Jamesburg, NJ 08831, USA</p>
            </ins>
            <ins id="I3">
               <p>Rutgers University, Biotechnology Center, 59 Dudley Road, New Brunswick NJ 08901, USA</p>
            </ins>
            <ins id="I4">
               <p>Rutgers University, Department of Pharmacology &amp; Toxicology, Ernest Mario School of Pharmacy, Piscataway, NJ 08854, USA</p>
            </ins>
            <ins id="I5">
               <p>Department of Cancer and Cell Biology, University of Cincinnati, Cincinnati, OH 45219, USA</p>
            </ins>
         </insg>
         <source>BMC Chemical Biology</source>
         <issn>1472-6769</issn>
         <pubdate>2010</pubdate>
         <volume>10</volume>
         <issue>1</issue>
         <fpage>4</fpage>
         <url>http://www.biomedcentral.com/1472-6769/10/4</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">20423518</pubid>
               <pubid idtype="doi">10.1186/1472-6769-10-4</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>20</day>
               <month>11</month>
               <year>2009</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>27</day>
               <month>4</month>
               <year>2010</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>27</day>
               <month>4</month>
               <year>2010</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2010</year>
         <collab>Dey et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Phenethylisothiocyanate (PEITC) is produced by Brassica food plants. PEO is a <b>P</b>EITC <b>E</b>ssential <b>O</b>il containing >95% natural PEITC. PEITC is known to produce various health benefits but its effect in alleviation of ulcerative colitis signs is unknown.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>In two efficacy studies (acute and chronic) oral administration of PEO was effective at remitting acute and chronic signs of ulcerative colitis (UC) in mice. Disease activity, histology and biochemical characteristics were measured in the treated animals and were compared with appropriate controls. PEO treatment significantly improved body weights and stool consistency as well as decreased intestinal bleeding. PEO treatment also reduced mucosal inflammation, depletion of goblet cells and infiltration of inflammatory cells. Attenuation of proinflammatory interleukin1&#946; production was observed in the colons of PEO-treated animals. Expression analyses were also carried out for immune function related genes, transcription factors and cytokines in lipopolysaccharide-activated mouse macrophage cells. PEO likely affects an intricate network of immune signaling genes including a novel concentration dependent reduction of total cellular Signal Transducer and Activator of Transcription 1 (STAT1) as well as nuclear phosphorylated-STAT1 (activated form of STAT1). A PEO-concentration dependent decrease of mRNA of C-X-C motif ligand 10 (a STAT1 responsive chemokine) and Interleukin 6 were also observed.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>PEO might be a promising candidate to develop as a treatment for ulcerative colitis patients. The disease attenuation by PEO is likely associated with suppression of activation of STAT1 transcription and inhibition of pro-inflammatory cytokines.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Inflammatory bowel disease (IBD), affecting an estimated two million people annually in the US <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>, is predominantly comprised of Crohn's disease (CD) and ulcerative colitis (UC). IBD is a set of chronic and relapsing inflammatory disorders of the intestine caused by multifactorial conditions in a genetically predisposed individual. UC primarily affects the mucosal lining of the colon and rectum, whereas CD may extend to any part of the gastrointestinal tract and is characterized by transmural inflammation <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Since the etiology of both CD and UC remains unclear, successful treatment strategies targeting wider sections of the population have not been found. In recent years meta-analyses of clinical trials have been performed in several instances to establish efficacy of antibiotic and other therapies. Non-steroidal anti-inflammatory drugs such as Asacol, and immune-suppressive agents are commonly used to treat IBD alone or in combination with short-term antibiotic therapies <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. While adjunct antibiotic therapies may be useful <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, their long term use is not common for reasons beyond the scope of discussion here. Other oral therapies generally for long term remission and to prevent flare-up, to which not all patients adequately respond, are often combined with surgical interventions of the colon. Patients with prolonged UC are at an increased risk for developing colitis-associated cancer (CAC) <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Long-term use of some IBD therapies can reduce the risk of CAC by 75-81% in responding patients <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Side effects of existing treatments, such as kidney damage from long-term use of mesalamine (Asacol) or increased risk of infections from use of immune suppressive agents are common <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. The lack of efficacious drugs to treat the general patient population, combined with the prevalence of negative side effects, emphasizes the need for the development of new, effective, and well-tolerated anti-inflammatory therapies for UC. Alternative treatments, including botanical therapies, have been proposed <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Unfortunately, objective evidence of consistent efficacy and safety of botanical products is generally nonexistent, despite their gain in public acceptance <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>.</p>
         <p>A combination of genetic susceptibility factors and an altered immune response driven by enteric microbial factors and oxidative stress, contributes to the initiation and chronification of IBD as suggested by various animal models <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. Chemically induced intestinal inflammation is among the most commonly used IBD animal models, as the onset of inflammation is immediate and the procedure is relatively straightforward. Among the chemical models, the dextran sodium sulfate- (DSS) induced model of bowel inflammation can be adapted for the study of both acute and chronic colitis and can be extended for the study of CAC <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. In addition, the DSS-induced model recreates some important immunological and histopathological aspects of IBD occurring in humans.</p>
         <p>Isothiocyanates (ITCs) are naturally occurring sulfur-containing compounds commonly found in Brassicaceae family vegetables such as cabbage, cauliflower, watercress and broccoli <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Phenethylisothiocyanate (PEITC) is a well-studied ITC, occurring naturally in the form of its glucosinolate precursor, gluconasturtiin. <it>Barbarea verna </it>is a Brassicaceous herb that is used in salads, soups, and garnishes and in our study is one of the richest sources of dietary PEITC, with the highest levels contained in the seeds <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. PEITC showed chemopreventive activity against various cancers <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp> and no apparent toxicity even when administered in high doses in rats and dogs as determined by NOEL (no-observed-adverse-effect-level) in drug safety studies <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. It is also known for other beneficial effects such as anti-oxidative and anti-inflammatory activities <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. PEITC inhibited Nuclear Factor kappaB (NF&#954;B) activity in colon cancer cells and macrophages <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B20">20</abbr></abbrgrp>. Our previous study <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> showed that PEITC was the most effective of several ITCs tested in suppressing expression of NF&#954;B-regulated proinflammatory genes. In the same study PEO (PEITC essential oil, >95% natural PEITC from <it>B. verna</it>) had strong anti-inflammatory activity, reducing paw edema in rats with an effect that was comparable to that of the reference drug aspirin administered at the same concentration <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Research shows that PEITC is stable in biological samples and has high oral bioavailability in rats <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Here, we report the efficacy of PEO in alleviating clinical signs of DSS-induced acute and chronic colitis in mice. Using in vivo and in vitro models, we have measured effects of PEO on disease activity index, histological parameters, and changes in proinflammatory cytokine levels as well as changes in expression and activation of a key transcription factor, Signal Transducer and Activator of Transcription (STAT1). To the best of our knowledge no prior report has evaluated the anti-inflammatory effects of PEITC on IBD in mammalian models.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Chemicals and Biochemicals</p>
            </st>
            <p>Antibiotics, dimethyl sulphoxide (DMSO), LPS (lipo-polysaccharide from <it>E.coli</it>, serotype 055:B5) and PEITC standard were purchased from Sigma Chemicals (St. Louis, MO), 5-amino salicylic acid (5-ASA, also known as mesalamine) from TCI America (Portland, OR) and DSS from MP Biomedicals (Solon, OH). All other chemicals, including cell culture media, were obtained from Invitrogen Inc. (Carlsbad, CA). Reagents used in quantitative PCR, including enzymes, were supplied by Stratagene Inc. (La Jolla, CA), cress seeds (certified non-contaminated) from Kitazawa Seed Company (Oakland, CA) and RAW 264.7 cell line (ATCC TIB-71) from American Type Culture Collection (Manassas, VA). All antibodies were obtained from Santa Cruz Biotechnology Inc (Santa Cruz, CA), unless otherwise mentioned.</p>
         </sec>
         <sec>
            <st>
               <p>Preparation of PEO</p>
            </st>
            <p>PEO (containing >95% PEITC) was extracted by hydro distillation of ground winter cress seed as was previously described in Ribnicky et al., <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> and Dey et al., <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Gas chromatography/mass spectroscopy (GC/MS) was used to confirm the purity of the obtained PEO. The samples were injected into a Hewlett-Packard mass spectrometer (model 5890/5971) equipped with a 30-m &#215; 0.25 mm DB-5 MS fused silica capillary column (J&amp;W Scientific, Folsom CA). Chromatographic parameters were as previously described <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B19">19</abbr></abbrgrp>. The retention time of PEITC is 11.3 min. The major ion of PEITC has a mass of 91 (m/z) and molecular ion of mass 163 (m/z). The abundance of these ions and the integration value of the entire peak were used together with standard curves created previously from a PEITC chemical standard (Sigma Chemicals, St. Louis, MO) to quantify the PEITC in PEO.</p>
         </sec>
         <sec>
            <st>
               <p>In vivo animal studies</p>
            </st>
            <p>All studies were performed in accordance with the Guide for the Care and Use of Laboratory Animals as adopted and promulgated by the U.S. National Institutes of Health. C57BL/6J male mice, seven weeks old, were used. The mice were housed in a room maintained at a constant temperature of 24-26&#176;C with 12-h light/dark cycle and had free access to food (Purina chow) and drinking water. Before the start of experiments, one week was allowed for their acclimatization to these conditions. Two murine models of colitis, the chronic and acute, were used following Aharoni et al., <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and Wirtz et al., <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. The mice were randomized into four groups, which are described in Table <tblr tid="T1">1</tblr>. For the acute and chronic models, each of the groups, except healthy controls, consisted of 6 and 10 animals respectively, housed 3-4 per cage. The healthy control (water group) consisted of 4 animals in both experiments. Development (and variation) of clinical signs was not anticipated in this group, hence the small number was determined to be sufficient. Treating this group with vehicle helped to account for any stress among animals due to daily oral gavage.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>In vivo experimental set-up for acute and chronic colitis models</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Groups</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Acute model</b>
                        </p>
                        <p>
                           <b>(5 days induction, ad libitum)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Chronic model</b>
                        </p>
                        <p>
                           <b>(36 days induction,, ad libitum)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Treatment</b>
                        </p>
                        <p>
                           <b>(14 days, once daily)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Comment</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Water</p>
                     </c>
                     <c ca="left">
                        <p>Tap water</p>
                     </c>
                     <c ca="left">
                        <p>Tap water</p>
                     </c>
                     <c ca="left">
                        <p>Vehicle (9% DMSO+corn oil)</p>
                     </c>
                     <c ca="left">
                        <p>Healthy control</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DSS</p>
                     </c>
                     <c ca="left">
                        <p>3% DSS</p>
                     </c>
                     <c ca="left">
                        <p>2.5% DSS (3 days) followed by tap water (6 days), 4 cycles</p>
                     </c>
                     <c ca="left">
                        <p>Vehicle (9% DMSO+corn oil)</p>
                     </c>
                     <c ca="left">
                        <p>Diseased control*</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PEO</p>
                     </c>
                     <c ca="left">
                        <p>3% DSS</p>
                     </c>
                     <c ca="left">
                        <p>2.5% DSS (3 days) followed by tap water (6 days), 4 cycles</p>
                     </c>
                     <c ca="left">
                        <p>PEO 75 mg/kg (>95% PEITC)</p>
                     </c>
                     <c ca="left">
                        <p>Unknown test group</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5-ASA</p>
                     </c>
                     <c ca="left">
                        <p>3% DSS</p>
                     </c>
                     <c ca="left">
                        <p>2.5% DSS (3 days) followed by tap water (6 days), 4 cycles</p>
                     </c>
                     <c ca="left">
                        <p>5-ASA 50 mg/kg</p>
                     </c>
                     <c ca="left">
                        <p>Reference test group</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* Statistical significance of treatments of PEO and 5-ASA groups are shown with respect to DSS group, unless otherwise mentioned</p>
               </tblfn>
            </tbl>
            <p>1. Acute model of colitis: Acute ulcerative colitis was induced by freshly prepared 3% DSS (ad libitum) in drinking water for five days (Table <tblr tid="T1">1</tblr>). In a separate experiment we had previously tested various DSS concentrations (2-4%) for acute disease development (data not shown). At a concentration higher than 3% DSS, some deaths occurred that corresponded with severity of clinical signs. Therefore, we used the highest tolerated concentration of 3% for our actual experiment. Mice were observed individually once a day for their general health conditions, including body weight, diarrhea, rectal bleeding and inflammation and rectal prolapse. Occult bleeding was tested daily in stool per cage using a commercial ColoScreen Kit (Helena Laboratories, Beaumont, TX). Disease activity index (DAI) (Fig <figr fid="F1">1</figr>) was determined following the scheme shown in Table <tblr tid="T2">2</tblr>. On the 15<sup>th </sup>day post-treatment, mice were sacrificed using carbon dioxide inhalation. Colons were collected terminally, measured for their gross length, and flushed with sterile phosphate-buffered saline without calcium and magnesium (Gibco Carlsbad, CA) containing 20 &#956;g/ml gentamycin (Sigma Chemicals, St Louis, MO). Entire colons were then stored in histology cassettes immersed in 10% neutral buffered formalin. Paraffin cross-sections (6 &#956;m) were stained with hematoxylin and eosin (H&amp;E) for histological evaluation (&#215;200 magnification) of colonic damage. Histopathological assessment was performed in a blinded manner following the published scoring system <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> (Table <tblr tid="T3">3</tblr>, Fig <figr fid="F2">2</figr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Disease Activity Index (DAI) to assess clinical colitis in mice (modified based on Aharoni et al., 2006; Wirtz et al., 2007)</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Score</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Body wt change (%)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Internal intestinal bleeding, FOBT test strip (colorimetric)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Rear end visible bleeding+ inflammation</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Stool consistency</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>*Rectal prolapse</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>Gain, loss &lt;1</p>
                     </c>
                     <c ca="left">
                        <p>No color change</p>
                     </c>
                     <c ca="left">
                        <p>Negative</p>
                     </c>
                     <c ca="left">
                        <p>Normal</p>
                     </c>
                     <c ca="left">
                        <p>None</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>Loss 1-5</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Either one, mild</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>Loss 5-10</p>
                     </c>
                     <c ca="left">
                        <p>Color change</p>
                     </c>
                     <c ca="left">
                        <p>Either one, severe</p>
                     </c>
                     <c ca="left">
                        <p>Loose</p>
                     </c>
                     <c ca="left">
                        <p>Observed</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>Loss 10-15</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Both, mild</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>Loss >15</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Both, severe</p>
                     </c>
                     <c ca="left">
                        <p>Diarrhea</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* Rectal prolapse was only observed in the chronic model</p>
               </tblfn>
            </tbl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Scoring system for inflammation-associated histological changes in the colon (Wirtz et al., 2007)</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Score</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Histologic changes</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>No evidence of inflammation</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>Low level of inflammation with scattered infiltrating mononuclear cells (1--2 foci)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>Moderate inflammation with multiple foci</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>High level of inflammation with increased vascular density and marked wall thickening</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>Maximal severity of inflammation with transmural leukocyte infiltration and loss of goblet cells</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>2. Chronic model of colitis: Chronic colitis was induced by four cycles of 9 days of alternating DSS and tap water (ad libitum) (detailed in Table <tblr tid="T1">1</tblr>). Each 9-day cycle consisted of 3 days of 2.5% DSS, followed by 6 days of tap water. Treatment regimens and sacrifice of mice were the same as in acute model except that necropsy was carried out on day 16. Five samples from each group, except water group, were collected for histopathology as described for the acute model, and remaining five were collected for full thickness organ culture as described by Wirtz et al., <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Similarly for the control water group, two were collected for full thickness organ culture and two for histopathology. All clinical assessments were performed as described for acute model above.</p>
         </sec>
         <sec>
            <st>
               <p>Organ culture and ELISA</p>
            </st>
            <p>Two biopsy punches were terminally collected from each of the proximal middle and distal parts of individual colons using a 3 mm dermal punch biopsy instrument (Miltex, York, PA). Each biopsy specimen was transferred into separate wells of a 48-well microtiter plate containing 500 &#956;l of supplemented RPMI1640 media (Gibco, Carlsbad, CA) and incubated at 37&#176;C for 12 hours in a cell culture incubator <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Supernatants were collected and stored at -20&#176;C until further use. Interleukin1&#946; (IL1&#946;) protein levels released by the biopsy samples in the media were assessed with a quantitative enzyme-linked immunosorbent assay kit (ELISA) (Bender Med Systems, Burlingame, CA), according to manufacturer's instruction, and the values were expressed as pg/ml (Fig <figr fid="F3">3</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Macrophage Cell Culture Assay</p>
            </st>
            <p>The mouse monocyte/macrophage cells, RAW 264.7 (ATCC TIB-71), were cultured and treated as previously described by Dey et al., <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Cell Viability Assay and Dose Range Determination</p>
            </st>
            <p>A Cell Titer 96 MTS assay kit (Promega Corp., Madison, WI) was used to determine the relative number of viable cells remaining after incubation with treatments. For actual in vitro experiments with PEO, the highest non-toxic concentration or less was selected.</p>
         </sec>
         <sec>
            <st>
               <p>Total RNA Extraction, Purification, and cDNA Synthesis</p>
            </st>
            <p>Total RNA extraction, purification and cDNA synthesis were performed as described previously in Dey et al., <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Real Time Quantitative PCR and Gene Array</p>
            </st>
            <p>Q-RT-PCR was performed as previously described <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Gene-specific primers (IDT Inc., Coralville, IA) used in the current study are described in Table <tblr tid="T4">4</tblr>. For gene array experiments (Table <tblr tid="T5">5</tblr>), PCR-arrays (APM_025, SABiosciences Inc, MD) were purchased and manufacturer's protocol was followed. Relative quantification using SYBR green technology and standard &#916;&#916;Ct method was used for individual RT-PCR and gene array experiments. Data are expressed as relative mRNA quantity with respect to LPS-elicited control (positive control) which is normalized to a value of 1.0 as described in Dey et al., 2006 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> (Fig <figr fid="F4">4</figr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Primer sequences used for real-time RT-PCR</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene (accession number)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Forward</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reverse</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>IL6 (NM_031168)</p>
                     </c>
                     <c ca="left">
                        <p>5'-tagtccttcctaccccaatttcc-3'</p>
                     </c>
                     <c ca="left">
                        <p>5'-ttggtccttagccactccttc-3'</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CXCL10/IP10 (NM_021274)</p>
                     </c>
                     <c ca="left">
                        <p>5'attctttaagggctggtctga 3'</p>
                     </c>
                     <c ca="left">
                        <p>5'cacctccacatagcttacagt 3'</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#946; Actin (NM_007393)</p>
                     </c>
                     <c ca="left">
                        <p>5'-aaccgtgaaaagatgacccagat-3'</p>
                     </c>
                     <c ca="left">
                        <p>5'-cacagcctggatggctacgt-3'</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>IL6, Interleukin6; CXCL10/IP10, C-X-C motif ligand 10/10 kDa interferon-gamma-induced protein</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Immuno-blotting</p>
            </st>
            <p>For immunoblot analyses, pretreated RAW 264.7 cells were activated with LPS for 45 minutes and harvested using RIPA lysis buffer (Pierce biotechnology, Rockford, IL). For nuclear extract preparation and protein concentration determination manufacturer's (Thermo Scientific, Rockford, IL) protocols in NE-PER Nuclear Extraction Reagents and Pierce BCA Protein Assay kit were followed. Proteins (50 &#956;g/lane) were separated by 12% SDS-PAGE and products were electrotransferred to polyvinyldene difluoride (PVDF) membranes (Amersham Biosciences Corp, Piscataway, NJ). The membranes were blocked with 5% skim milk for 1 h, washed 3 times in PBS, incubated with primary Ab (Abs against mouse &#946;actin and STAT1 were purchased from Santa Cruz Biotechnology Inc., Santa Cruz, CA and against phosphorylated [Tyr<sup>701</sup>] STAT1 from Cell Signaling Technology Inc, Beverly, MA) for 1 h, washed 3 times in PBST (PBS containing 05% Tween20) and incubated with HRP-conjugated secondary Ab (Santa Cruz Biotechnology Inc., Santa Cruz, CA) for 1 h, all at room temperature. After an additional 3 washing steps, bound peroxidase activity was detected by ECL detection system (Amersham Biosciences Corp, Piscataway, NJ) (Fig <figr fid="F5">5</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Statistical Analysis</p>
            </st>
            <p>Data are expressed as mean &#177; SE. Analyses for in vitro experiments were performed using Student's <it>t</it>-test. One-way ANOVA (analysis of variance) was used to determine the significance of in vivo treatments followed by post-ANOVA Tukey's Honestly Significant Difference multiple means comparison test to determine specificity of the treatments.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>For convenient interpretation of the data discussed in the subsequent sections, the current paragraph highlights key features of the method section. The acute model is defined by rapid onset of severe clinical signs (sometimes interchangeably referred to as 'symptoms' in the rest of the text) that may be healed when the disease-causing agent (DSS) is withdrawn. The induction period in the acute model is shorter than in the chronic model and a higher DSS concentration is used. In the chronic model, induction of symptoms is slower but longer lasting with possible flare-up and remission cycles. DSS is administered in alternate cycles at lower concentrations for the chronic model (see Table <tblr tid="T1">1</tblr> and methods). The optimal concentration of PEO (75 mg/kg) for assessing its in vivo efficacy was determined in a pilot study using a dose response administration of PEO in DSS-treated animals (data not shown). Mesalamine/5-ASA, a standard first-line therapy for mild-to-moderate UC, administered at a recommended 50 mg/kg <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, was used as a reference standard for in vivo models. In all instances, statistical significances of treatments of PEO and 5-ASA groups were compared to DSS group (Figs <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>, Table <tblr tid="T1">1</tblr>). The results are presented in the order of physiological, histopathological and molecular observations. In the sections to follow, the 'water-group' and the 'DSS-group' refer to the healthy and the disease controls respectively (see Table <tblr tid="T1">1</tblr> for details).</p>
         <p>Disease activity index (DAI) (Fig <figr fid="F1">1</figr>) combined the following 5 variables (clinical signs/symptoms): change in body weight, stool consistency, occult blood in stool, rear end bleeding and inflammation (visible), and rectal protrusion. DAI was used to compare the treatment response to PEO and 5-ASA with that of the DSS group following the scale described in Table <tblr tid="T2">2</tblr> [modified from <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B11">11</abbr></abbrgrp>]. Rectal prolapse, one of the variables for DAI (Table <tblr tid="T2">2</tblr>) was observed only in the chronic colitis animals (Fig <figr fid="F1">1B</figr>) occurring with partial prolapse of the rectal lining. Therefore, the DAI shown for the acute model (Fig <figr fid="F1">1A</figr>) does not reflect this variable. Also, UC is an intermittent disease with periods of exacerbated symptoms and periods that are relatively symptoms free <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B23">23</abbr></abbrgrp>. Due to the longer experimental duration of the chronic model (Table <tblr tid="T1">1</tblr>), the relapse-remission pattern among members of individual groups was observed (Fig <figr fid="F1">1B</figr>). In the acute model, both PEO and 5-ASA attenuated the general signs of UC after 5, 10 and 15 days of respective treatments (Fig <figr fid="F1">1A</figr>) with PEO performing notably better (PEO <it>p </it>&lt; 0.01, 5-ASA <it>p </it>&lt; 0.05) and comparing closely with the water (healthy) group (Fig <figr fid="F1">1A</figr>). In the chronic model, alleviation of clinical signs was not observed until after 10 days of treatment (Fig <figr fid="F1">1B</figr>). The PEO-treated group showed significant amelioration (<it>p </it>&lt; 0.01) of symptoms on day 12 and continued to experience further relief until the end of the experiment while the 5-ASA group did not show any significant remission (Fig <figr fid="F1">1B</figr>). In addition, the PEO- treated group experienced an attenuated spike in symptoms starting from the second day of treatment (<it>p </it>&lt; 0.01), suggesting that PEO may also prevent the relapsing nature of chronic colitis (Fig <figr fid="F1">1B</figr>).</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Effects of orally administered PEO and 5-ASA on the Disease activity index (DAI) in DSS-induced colitis</p>
            </caption>
            <text>
               <p><b>Effects of orally administered PEO and 5-ASA on the Disease activity index (DAI) in DSS-induced colitis</b>. Experimental mouse groups and disease induction are defined in Table 1 and scoring criteria in Table 2. Significance of treatments in PEO and 5-ASA groups in respect to DSS group and are indicated by *, <it>p </it>&lt; 0.05 and **<it>p </it>&lt; 0.01 and ***<it>p </it>&lt; 0.001. (A) Acute colitis model. Data as mean &#177; SEM (n = 6) are shown at five-day intervals. (B) Chronic colitis model. Data as mean &#177; SEM (n = 10) are shown at three-and two-day intervals during induction and treatment periods respectively.</p>
            </text>
            <graphic file="1472-6769-10-4-1" hint_layout="double"/>
         </fig>
         <p>Colon characteristics were analyzed next. Colon lengths were measured prior to flushing. The healthy water group typically had longer, non-thickened colons. In the diseased animals, the colons were often shortened (Fig <figr fid="F2">2A</figr>), likely due to loss in crypt structure and thickened due to edema formation, similar to previously reported studies with this model <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. The differences between the healthy and the DSS-receiving groups in terms of colon lengths were less pronounced in the acute study (data not shown) as compared with the chronic study (Fig <figr fid="F2">2A</figr>), likely due to shorter induction period (5 days vs 36 days). Therefore, relief from colon shortening-effects was not observed in the acute model. In the chronic study, all of the DSS-treated groups (Table <tblr tid="T1">1</tblr>) had markedly shorter average colon lengths as compared with the healthy water-treated group (Fig <figr fid="F2">2A</figr>). The PEO-treated group exhibited pronounced attenuation of colon shortening (<it>p </it>&lt; 0.05, Fig <figr fid="F2">2A</figr>) as was observed terminally.</p>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Effects of orally administered PEO and 5-ASA on colon length and histopathology</p>
            </caption>
            <text>
               <p><b>Effects of orally administered PEO and 5-ASA on colon length and histopathology</b>. Experimental groups (chronic) and disease induction are defined in Table 1. (A) The DSS receiving groups had shorter average colon length as compared to water group (healthy controls) (n = 10). The shortening was relieved significantly in PEO treated group with respect to DSS group (*, <it>p </it>&lt; 0.05). (B) Histogram showing blinded histo-pathological scores (n = 5; #, <it>p </it>= 0.07; +, <it>p </it>= 0.08) (C) Representative section (&#215;200) from healthy (water) control group showing intact goblet cells and absence of inflammatory cells (D) Representative section (&#215;200) from DSS group showing massive inflammatory cell aggregates and extensive loss of goblet cells (E) Representative section (&#215;200) from PEO-treated group showing partial loss of goblet cells but absence of inflammatory cell accumulation (F) Representative section (&#215;200) from 5-ASA-treated group showing minor loss of goblet cells and moderate infiltration of inflammatory cells. M, mucosa; SM, submucosa; ME, muscularis; Goblet cells are shown with yellow triangles with black borders; Inflammatory cells are marked with white triangles with red border. Histopathology was analyzed from H&amp;E stained colon sections (6 &#956;m).</p>
            </text>
            <graphic file="1472-6769-10-4-2" hint_layout="double"/>
         </fig>
         <p>Histology of the bowel sections of the experimental animals revealed a number of cellular changes in the colons as described in Table <tblr tid="T3">3</tblr><abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. However, the population size available for histopathology study (Fig <figr fid="F2">2B</figr>) was smaller (n = 5) as compared to the observations for gross colon length (n = 10) (Fig <figr fid="F2">2A</figr>). This is because half of the 10 colons were used for biopsy samples (discussed later, Fig <figr fid="F3">3</figr>) and half were available for histopathological evaluations. The PEO-treated group had the lowest average pathological score (<it>p </it>= 0.07), closely followed by the 5-ASA group (<it>p </it>= 0.08) (Fig <figr fid="F2">2B</figr>). Qualitative differences were widespread among the bowels of both the PEO (Fig <figr fid="F2">2E</figr>) and 5-ASA (Fig <figr fid="F2">2F</figr>) groups relative to the DSS group (Fig <figr fid="F2">2D</figr>). In the bowels of the DSS treated animals, moderate to extensive infiltration of submucosa ('SM', Fig <figr fid="F2">2</figr>) and superficial muscularis ('ME', Fig <figr fid="F2">2</figr>) by a mixed population of inflammatory cells (shown in white triangles with red border, Fig <figr fid="F2">2</figr>), such as lymphocytes, plasma cells, and macrophages (all mononuclear type), was observed. In some samples the infiltration extended transmurally through the muscularis and into the serosa (data not shown). The epithelium in small patches had frequently lost the majority of their goblet cells (shown in yellow triangles with black borders, Fig <figr fid="F2">2</figr>) or ulcerated away from mucosa with intense infiltration of polymorphonuclear neutrophylic leukocytes (PMNs) beneath ulcerated areas, in contrast to the representative healthy colon section (Fig <figr fid="F2">2C</figr>). Rectal parts of the colons were generally characterized with the worst pathology including extensive infiltration, the presence of hyperplastic squamous epithelium and an increased mitotic index (data not shown). In the bowels of PEO- and 5-ASA-treated groups (Figs <figr fid="F2">2E, F</figr>) some signs of ulceration, partially inflamed submucosa, and low inflammatory cell infiltration were also observed, but to a much lesser extent and infrequently, in contrast to the DSS group (Fig <figr fid="F2">2D</figr>). Additionally, crypt structures with intact goblet cells were frequently visible (Figs <figr fid="F2">2E, F</figr>).</p>
         <p>In order to address the biochemical basis of histological alterations, the cytokine response in the gut was evaluated by measuring the release of the pro-inflammatory cytokine, Interleukin 1&#946; (IL1&#946;) from colon tissue. A significant reduction in the average production of IL1&#946; in the proximal (<it>p </it>&lt; 0.01) and distal (<it>p </it>&lt; 0.05) colon biopsies was observed among PEO-treated animals as compared with the DSS group. There was also a marked reduction in cytokine production in the mid colon for the PEO group (<it>p </it>= 0.06) (Fig <figr fid="F3">3</figr>). The average IL1&#946; production was reduced by 5-ASA in the middle and distal colons.</p>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Effect of orally administered PEO and 5-ASA on proinflammatory Interleukin 1&#946; (IL1&#946;) expressed in mouse colons</p>
            </caption>
            <text>
               <p><b>Effect of orally administered PEO and 5-ASA on proinflammatory Interleukin 1&#946; (IL1&#946;) expressed in mouse colons</b>. Experimental groups and disease induction are defined in Table 1. Data are means &#177; SEM (n = 5), *, <it>p </it>&lt; 0.05, **, <it>p </it>&lt; 0.01, #, <it>p </it>= 0.06. Protein expression in the gut was measured using ELISA.</p>
            </text>
            <graphic file="1472-6769-10-4-3" hint_layout="single"/>
         </fig>
         <p>In the present study, histopathological analyses showed infiltration by various inflammatory cells including macrophages in the diseased samples and a reduction of such infiltration in the PEO treated group. Subsequently, we performed a gene array analysis (Table <tblr tid="T5">5</tblr>) using the same in vitro macrophage based system to elucidate additional immune signaling genes that could be potential targets of PEO activity. Twenty one out of 84 genes (25%) induced by LPS, were suppressed three-fold or more by 10 &#956;M PEO as compared to LPS activation alone (Table <tblr tid="T5">5</tblr>). LPS is a known agonist of toll-like receptor 4 signaling that plays a critical role in colitis <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Two genes that were down-regulated by LPS and up-regulated by PEITC were Htr2b (5-hydroxytryptamine, NM_008311) and Zap70 (zeta chain associated protein, NM_009539). LPS activation (or suppression) was separately compared to non activated levels of gene expressions (data not shown). The 21 down regulated genes represent key transcription factors and inflammatory mediators, at least 7 of which including IL6 were previously unknown to be affected by PEITC/PEO treatment (Table <tblr tid="T5">5</tblr>). There is one very recent report <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, however, showing in vitro down regulation of some oncogenes by PEITC in response to IL6 elicitation but effects of PEITC on IL6 expression was not reported. Out of these 7 responding genes, concentration-dependent changes in IL6, CXCL10 and STAT1 (signal transducer and activator of transcription1) expressions have been confirmed using real time RT-PCR (Fig <figr fid="F4">4</figr>) and Western Blot analyses respectively (Fig <figr fid="F5">5</figr>). These three genes were selected for further examination since their activation has been reported for human ulcerative colitis <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. At 10-15 &#956;M, a decrease in mRNA and protein levels was observed for all these three genes (<it>p </it>&lt; 0.01) (Figs <figr fid="F4">4</figr>, <figr fid="F5">5</figr>).</p>
         <tbl id="T5">
            <title>
               <p>Table 5</p>
            </title>
            <caption>
               <p>Genes down-regulated (&#8805; 3-fold vs LPS activation alone) by 10 &#956;M PEO in macrophages</p>
            </caption>
            <tblbdy cols="4">
               <r>
                  <c ca="left">
                     <p>
                        <b>Gene name</b>
                     </p>
                     <p>
                        <b>abbreviation</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Gene name full</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Partial Gene Ontology term</b>
                     </p>
                     <p>
                        <url> http://www.geneontology.org</url>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Fold change in response to LPS</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="4">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CCL2*</p>
                  </c>
                  <c ca="left">
                     <p>Chemokine (C-C motif) ligand 2</p>
                  </c>
                  <c ca="left">
                     <p>Inflammatory response; Chemokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-35.67</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CSF2</p>
                  </c>
                  <c ca="left">
                     <p>Colony stimulating factor 2 (granulocyte- macrophage)</p>
                  </c>
                  <c ca="left">
                     <p>Immune response; Cytokine and chemokine mediated signaling pathway</p>
                  </c>
                  <c ca="center">
                     <p>-8.21</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CSF3</p>
                  </c>
                  <c ca="left">
                     <p>Colony stimulating factor 3 (granulocyte)</p>
                  </c>
                  <c ca="left">
                     <p>Immune response; Cytokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-53.69</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CXCL10*</p>
                  </c>
                  <c ca="left">
                     <p>Chemokine (C-X-C motif) ligand 10</p>
                  </c>
                  <c ca="left">
                     <p>Inflammatory response; Chemokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-30.05</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FOS</p>
                  </c>
                  <c ca="left">
                     <p>FBJ osteosarcoma oncogene</p>
                  </c>
                  <c ca="left">
                     <p>DNA binding; Regulation of transcription</p>
                  </c>
                  <c ca="center">
                     <p>-10.90</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>GJA1</p>
                  </c>
                  <c ca="left">
                     <p>Gap junction membrane channel protein alpha 1</p>
                  </c>
                  <c ca="left">
                     <p>Cell-cell signaling</p>
                  </c>
                  <c ca="center">
                     <p>-19.25</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>IL10</p>
                  </c>
                  <c ca="left">
                     <p>Interleukin 10</p>
                  </c>
                  <c ca="left">
                     <p>Immune response; Cytokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-4.95</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>IL1a</p>
                  </c>
                  <c ca="left">
                     <p>Interleukin 1 alpha</p>
                  </c>
                  <c ca="left">
                     <p>Inflammatory response; Cytokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-291.36</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>IL1b</p>
                  </c>
                  <c ca="left">
                     <p>Interleukin 1 beta</p>
                  </c>
                  <c ca="left">
                     <p>Inflammatory response; Cytokine activity; Neutrophil chemotaxis; Positive regulation of IL-6 and chemokine biosynthesis</p>
                  </c>
                  <c ca="center">
                     <p>-32.83</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>IL6*</p>
                  </c>
                  <c ca="left">
                     <p>Interleukin 6</p>
                  </c>
                  <c ca="left">
                     <p>Signal transducer and cytokine activity</p>
                  </c>
                  <c ca="center">
                     <p>-14.39</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>MAPK3</p>
                  </c>
                  <c ca="left">
                     <p>Mitogen activated protein kinase 3</p>
                  </c>
                  <c ca="left">
                     <p>ATP binding; Transferase activity; Protein amino acid phosphorylation; Signal transduction; Inflammatory response; Regulation of cytokine biosynthesis; MAP kinase activity</p>
                  </c>
                  <c ca="center">
                     <p>-3.11</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>NFkB1</p>
                  </c>
                  <c ca="left">
                     <p>Nuclear factor of kappa light chain gene enhancer in B-cells 1, p105</p>
                  </c>
                  <c ca="left">
                     <p>DNA binding; Regulation of transcription</p>
                  </c>
                  <c ca="center">
                     <p>-21.51</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>NFkB2</p>
                  </c>
                  <c ca="left">
                     <p>Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100</p>
                  </c>
                  <c ca="left">
                     <p>DNA binding; Regulation of transcription</p>
                  </c>
                  <c ca="center">
                     <p>-5.72</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>NFkBia</p>
                  </c>
                  <c ca="left">
                     <p>Nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, alpha</p>
                  </c>
                  <c ca="left">
                     <p>Nucleus; Protein binding; Cytoplasm: Regulation of cell proliferation; Protein-nucleus import, translocation</p>
                  </c>
                  <c ca="center">
                     <p>-8.21</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>REL</p>
                  </c>
                  <c ca="left">
                     <p>Reticuloendotheliosis oncogene</p>
                  </c>
                  <c ca="left">
                     <p>DNA binding; Regulation of transcription</p>
                  </c>
                  <c ca="center">
                     <p>-5.76</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RELb</p>
                  </c>
                  <c ca="left">
                     <p>Avian reticuloendotheliosis viral (v-rel) oncogene related B</p>
                  </c>
                  <c ca="left">
                     <p>Transcription factor activity; Intracellular; T-helper 1 type immune response</p>
                  </c>
                  <c ca="center">
                     <p>-3.78</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RIPK2</p>
                  </c>
                  <c ca="left">
                     <p>Receptor (TNFRSF)-interacting serine-threonine kinase 2</p>
                  </c>
                  <c ca="left">
                     <p>Regulation of apoptosis</p>
                  </c>
                  <c ca="center">
                     <p>-5.72</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>SLC20a1*</p>
                  </c>
                  <c ca="left">
                     <p>Solute carrier family 20, member 1</p>
                  </c>
                  <c ca="left">
                     <p>Receptor activity; Phosphate transport</p>
                  </c>
                  <c ca="center">
                     <p>-6.81</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>STAT1*</p>
                  </c>
                  <c ca="left">
                     <p>Signal transducer and activator of transcription 1</p>
                  </c>
                  <c ca="left">
                     <p>DNA binding; Regulation of transcription</p>
                  </c>
                  <c ca="center">
                     <p>-4.81</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>TNFaip3*</p>
                  </c>
                  <c ca="left">
                     <p>Tumor necrosis factor, alpha-induced protein 3</p>
                  </c>
                  <c ca="left">
                     <p>Apoptosis; Zinc ion binding</p>
                  </c>
                  <c ca="center">
                     <p>-134.05</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CD40*</p>
                  </c>
                  <c ca="left">
                     <p>CD40 antigen</p>
                  </c>
                  <c ca="left">
                     <p>Signal transduction; Immune response; Apoptosis</p>
                  </c>
                  <c ca="center">
                     <p>-46.74</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* Novel hits (genes) suppressed by PEITC/PEO (previously not reported)</p>
            </tblfn>
         </tbl>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>Concentration dependent mRNA expression of IL6 and CXCL10 (selected novel hits presented in Table 5) in response to PEO treatments in LPS-activated mouse macrophage</p>
            </caption>
            <text>
               <p><b>Concentration dependent mRNA expression of IL6 and CXCL10 (selected novel hits presented in Table 5) in response to PEO treatments in LPS-activated mouse macrophage</b>. Effect of PEO treatment was measured by the relative mRNA quantity of the genes of interest in the treated cells with respect to that of LPS activation only (positive control) that is normalized to a value of 1.00; &#946; actin served as an internal control. Lower values represent greater inhibitory effects with 0.00 corresponding to a complete inhibition of the induced gene expression; Values are mean &#177; S.E. **, <b><it>p </it></b>&lt; 0.01; ***<b><it>p </it></b>&lt; 0.001. The gene expression was amplified using Real time RT-PCR.</p>
            </text>
            <graphic file="1472-6769-10-4-4" hint_layout="single"/>
         </fig>
         <fig id="F5">
            <title>
               <p>Figure 5</p>
            </title>
            <caption>
               <p>Immunoblot analyses showing suppression of total cellular STAT1 (selected novel hit from Table 5) as well as activated nuclear pSTAT1 in response to PEO treatments in LPS-activated mouse macrophage</p>
            </caption>
            <text>
               <p><b>Immunoblot analyses showing suppression of total cellular STAT1 (selected novel hit from Table 5) as well as activated nuclear pSTAT1 in response to PEO treatments in LPS-activated mouse macrophage</b>. Cells were pre-treated with PEO for 2 h prior to 45 min LPS-activation. Unstimulated cells and stimulated cells served as na&#239;ve and positive controls. Figure is representative of three experiments. Significance of PEO treatment with respect to positive control is discussed in results section.</p>
            </text>
            <graphic file="1472-6769-10-4-5" hint_layout="single"/>
         </fig>
         <p>IL-6 signaling is mediated by STAT3 and various inflammatory diseases including UC are associated with STAT3 activation <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. But since activity of PEITC on STAT3 activation is known <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, our subsequent investigation focused on effects of PEO on STAT1 activation and expression. Concentration dependent suppression of cytoplasmic STAT1 protein (Fig <figr fid="F5">5</figr>) and mRNA (data not shown) levels were observed. Additionally, CXCL10, a STAT1 responsive gene <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> was also suppressed by PEO in activated macrophages (Fig <figr fid="F4">4</figr>). We previously reported suppression of another STAT1 responsive gene, iNOS by PEO <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Therefore, we wanted to study the effects of PEO on activated (phosphorylated at Tyr<sup>701</sup>) STAT1 (pSTAT1). Since within seconds after phosphorylation STAT1 translocates into the nucleus for binding to the DNA of its target genes <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, we determined the levels of pSTAT1 in the nuclear fractions of the PEO treated cells. A concentration dependent attenuation of pSTAT1 was observed (Fig <figr fid="F5">5</figr>). Densitometric analysis revealed a 2.5-, 4-, and 5-fold (<it>p </it>&lt; 0.05, with respect to LPS control) reduction in pSTAT levels by one, 5 and 10 &#956;M PEO. At 15 &#956;M PEO treatment, pSTAT was almost absent (<it>p </it>&lt; 0.001) as was also observed in non-stimulated cells (Fig <figr fid="F5">5</figr>).</p>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p><it>Barbarea verna </it>seeds are a rich source of PEITC with the potential for providing natural protection from environmental and dietary toxins <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. We have previously reported the anti-inflammatory properties of PEO <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. PEO, an essential oil extracted from edible <it>B. verna</it>, containing >95% naturally occurring PEITC, was used for all experiments in the present study. Here, we present the effects of PEO in mouse ulcerative colitis models. The colitis was chemically induced with DSS and clinical signs comparable to those of human ulcerative colitis <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> were observed such as body weight loss, diarrhea, bloody stool, mucosal ulceration, and shortening of colon length <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. DSS is directly toxic to the gut epithelial cells by weakening the integrity of the mucosal barrier <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. When given at a higher concentration (3%) for a short duration (five days), DSS induced acute colitis, while long-term (36 days) and cyclic (alternated with tap water) administration of a lower concentration (2.5%) of DSS developed signs of chronic colitis [modification of <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B11">11</abbr></abbrgrp>]. After disease induction, 75 mg/kg PEO was administered orally, once daily for two weeks. The PEO treatments significantly suppressed DSS-induced colitis in acute as well as chronic models, improving their body weights and stool consistency, as well as decreasing their intestinal bleeding (combined together as DAI, Fig <figr fid="F1">1</figr>). In addition, PEO reduced mucosal inflammation, depletion of goblet cells, and infiltration of inflammatory cells, thereby preserving colon length and structure (Fig <figr fid="F2">2</figr>). The observed attenuation of histopathological signs of colitis (Fig <figr fid="F2">2</figr>) was not as pronounced as the remission of the physiological symptoms (Fig <figr fid="F1">1</figr>) after 2 weeks of PEO-treatment. This is, however, consistent with the published report that complete healing of bowel ulceration may not always occur in parallel with clinical remission of symptoms <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Various clinical studies also suggest that mucosal restitution is usually measured after 8 weeks of treatments <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. The effects of the reference drug 5-ASA (also known as mesalamine) administered at a dose of 50 mg/kg <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, produced comparable DAI to that of PEO in the acute model (Fig <figr fid="F1">1A</figr>) but were less pronounced in the chronic model (Fig <figr fid="F1">1B</figr>). It is interesting to note that although widely used as a first-line therapy for UC, 5-ASA is largely ineffective in more severe and chronic cases of the disorder <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. For this reason and others, in recent years, the 5-aminosalicylic acid-containing pro-drug balsalazide has been the focus of attention. In a very recent metanalyses study Balsalazide was more effective than mesalamine in induction of remission, but balsalazide had no benefit compared with mesalamine in preventing relapse in the population selected. The number of patients with any adverse events and withdrawals because of severe adverse events was similar for mesalamine and balsalazide <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>.</p>
         <p>The pathophysiology of IBD is reflected by a distorted balance of regulatory cytokines <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. We have previously reported the in vitro inhibition of IL1&#946;, a pro-inflammatory cytokine, in immune cells by PEO <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. In colitis tissue, the expression of IL1&#946; increases in immune-challenged cells due to the activation of nuclear factor kappaB (NF&#954;B) <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Also, local high production of IL-1&#946; leads to tissue damage in IBD patients <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B36">36</abbr></abbrgrp>. In the present study we observed a significant PEO-mediated reduction of IL1&#946; protein in the gut tissue (Fig <figr fid="F3">3</figr>).</p>
         <p>The NF&#954;B and STATs are two important families of transcription factors that are activated in response to a variety of stimuli to regulate multiple cellular processes including immune response. The NF&#954;B and STATs have distinct as well as synergistic effects on gene induction <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. STAT proteins (7 reported in mammals) are dormant cytoplasmic transcription factors that become activated after phosphorylation by Janus kinases or other kinases in response to various stimuli including cytokines, growth factors and LPS <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. The activated protein migrates into the nucleus and binds to specific promoter elements to regulate gene expression <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. STAT regulated genes include inducible nitric oxide synthase (iNOS) <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, and CXCL10 <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> among others. The role of NF&#954;B in IBD <abbrgrp><abbr bid="B34">34</abbr></abbrgrp> as well as effect of PEITC on NF&#954;B activity <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B20">20</abbr></abbrgrp> are well studied. Excepting a very recent report on STAT3 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, the effect of PEITC on STATs however has not been investigated.</p>
         <p>An increase in STAT1 expression and activation in human UC was observed by Schreiber et al., <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. In addition, a number of studies have also reported an increased expression of CXCL10 in the serum and mucosa of patients with UC <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. The CXCL10 is a STAT1 responsive, CXC chemokine that promotes the migration of activated T cells. It is secreted by a variety of cell types, including macrophages <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. The gene array analysis in the present study detected greater than three-fold suppression of STAT1 and CXCL10 mRNA by 10 &#956;M PEO in LPS activated mouse macrophages (Table <tblr tid="T5">5</tblr>). Since it was previously unknown that PEITC/PEO can attenuate the expression of these genes (CXCL10 and STAT1), we further confirmed a concentration-dependent suppression of expression of these two genes by PEO (Fig <figr fid="F4">4</figr>, <figr fid="F5">5</figr>).</p>
         <p>In macrophages we also observed a novel dose-dependent decrease of activated STAT1 (pSTAT1) in the nucleus by PEO/PEITC (Fig <figr fid="F5">5</figr>). This is an interesting observation given that macrophages are cells of monocytic lineage, and phosphorylated (p) STAT1 was mainly detected in monocytic cells and neutrophils in the inflamed mucosa of ulcerative colitis patients <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. The inhibition of pSTAT1 by PEO is also consistent with our current and previous findings that CXCL10 and iNOS <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> mRNA are down regulated by PEO in activated macrophages. Since STAT1 regulates iNOS <abbrgrp><abbr bid="B38">38</abbr></abbrgrp> and CXCL10 <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B41">41</abbr></abbrgrp>, suppression of pSTAT1 by PEO likely contributes to the downstream inhibition of iNOS and CXCL10. Based on our current observations we hypothesize that the decrease in nuclear pSTAT1 is primarily due to lower levels cytoplasmic STAT1 protein (Fig <figr fid="F5">5</figr>) that serves as the kinase substrate before translocation. We have initiated a detailed investigation into the molecular mechanism of suppression of STAT1 activation by PEO that will be described elsewhere in the future.</p>
         <p>Published reports suggest the important role of IL-6 signaling in the development of IBD <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. IL6 signaling is mediated by STAT3 that is also associated with colitis disease development <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. PEITC has been shown to suppress STAT3 activation <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> but its direct effect on IL6 expression has not been reported. The gene array data in the current study show down-regulation of this proinflammatory cytokine by PEO in elicited macrophages (Table <tblr tid="T5">5</tblr>). We confirmed this observation using a concentration-dependent mRNA inhibition of IL6 by PEO (Fig <figr fid="F4">4</figr>).</p>
         <p>In summary, orally administered PEO is pharmacologically active at remitting acute and chronic bowel inflammation in experimental colitis in a mammalian model system. The biological activity of PEO may be partly mediated by the inhibition of pro-inflammatory cytokines and chemokines produced by infiltrating immune cells in the inflamed gut such as macrophages, thereby attenuating signs of tissue damage. The gene expression data further indicate that PEO affects an intricate network of cellular targets of IBD including but not limited to STAT1 mediated signaling. Taken together, the physiological, histopathological and molecular findings of this study suggest that PEO might provide promising new therapeutic lead for the treatment of IBD.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>Orally administered PEO is pharmacologically active at remitting acute and chronic bowel inflammation in experimental colitis in a mammalian system. The physiological, histopathological and molecular findings of this study suggest that PEO might provide promising new therapeutic lead for the treatment of IBD.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>MD conceived of the study, designed all experiments, carried out major part of all experiments, interpreted all data and drafted the entire manuscript. PK helped coordinate and substantially carried out the animal experiments. DR purified the chemical compound that is being tested for biological activity and analyzed the purity of the extracted compound using GC-MS. VGP participated in animal experiment and carried out western blotting. KR analyzed the histo-pathological data and provided guidance with microscopy and imaging. DR and KR also commented on the manuscript format, grammar and content. IR provided facilities within his laboratory for some parts of the experiments that were carried out at Rutgers University. IR also commented/edited on the manuscript for intellectual property content. <b>All authors read and approved the final manuscript</b>.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' informations</p>
         </st>
         <p><b>All authors have Ph.D in Biology or related fields as their highest obtained degree</b>.</p>
         <p>MD was formerly Assistant Research Professor in the Biotechnology Center at Rutgers, The State University of NJ (NJ) and currently Associate Professor, Nutrigenomics Program, South Dakota State University (SD). MD specializes in Molecular Biology and Nutrient-gene interaction.</p>
         <p>PK is a Senior Scientist at Phytomedics Inc. NJ. PK specializes in Animal Science and rodent disease models.</p>
         <p>DR is a Research Associate in the Biotechnology Center at Rutgers University in NJ and a Principal Investigator. DR specializes in Natural Product Chemistry.</p>
         <p>VGP was formerly a postdoctoral Associate in Rutgers University and is currently working as a postdoctoral researcher at University of Cincinnati, OH.</p>
         <p>KR is a Professor in the Department of Pharmacology and Toxicology at Rutgers University, NJ.</p>
         <p>IR is a Professor in the Department of Plant Biology and Pathology at Rutgers University, NJ.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>Authors thank Dr Suvobrata Chakravarty for critical reading of the manuscript from outside the field of Chemical Biology and acknowledge excellent technical support from Ruth Dorn, Reneta Pouleva, Nina Konstantinovskaya and Kathleen Roberts.</p>
            <p><b>Major source of research funding</b>:</p>
            <p>Major funding for this work came from National Institute of Health (NIH) Pathway to Independence award to MD [Grants K99AT004245 and 4R00AT004245].</p>
            <p>Additional funding sources are: NIH Center for Dietary Supplements Research on Botanicals and Metabolic Syndrome [Grant 1-P50 AT002776-01], NIH [Grant U01 TW006674] for ICBG and Phytomedics, Inc., Jamesburg, NJ to IR, and NIEHS P30 [Grant# ES-005022] to KR.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Podolsky</snm>
                  <fnm>DK</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>2002</pubdate>
            <volume>347</volume>
            <fpage>417</fpage>
            <lpage>429</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJMra020831</pubid>
                  <pubid idtype="pmpid" link="fulltext">12167685</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Body traffic: ecology, genetics, and immunity in inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Braun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Annu Rev Pathol</source>
            <pubdate>2007</pubdate>
            <volume>2</volume>
            <fpage>401</fpage>
            <lpage>429</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.pathol.1.110304.100128</pubid>
                  <pubid idtype="pmpid" link="fulltext">18039105</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Pathogenesis and immune mechanisms of chronic inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sartor</snm>
                  <fnm>RB</fnm>
               </au>
            </aug>
            <source>Am J Gastroenterol</source>
            <pubdate>1997</pubdate>
            <volume>92</volume>
            <issue>Suppl 12</issue>
            <fpage>5S</fpage>
            <lpage>11S</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9395346</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>The risk of lymphoma in the treatment of inflammatory bowel disease with immunosuppressive agents</p>
            </title>
            <aug>
               <au>
                  <snm>Kwon</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Farrell</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Crit Rev Oncol Hematol</source>
            <pubdate>2005</pubdate>
            <volume>56</volume>
            <fpage>169</fpage>
            <lpage>178</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.critrevonc.2005.02.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">15979323</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Immunomodulatory therapeutic effect of glatiramer acetate on several murine models of inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Aharoni</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kayhan</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Domev</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Labunskay</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Arnon</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Pharmacol Exp Ther</source>
            <pubdate>2006</pubdate>
            <volume>318</volume>
            <fpage>68</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1124/jpet.106.103192</pubid>
                  <pubid idtype="pmpid" link="fulltext">16624971</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>A meta-analysis of antibiotic therapy for active ulcerative colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Rahimi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nikfar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rezaie</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Abdollahi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Dig Dis Sci</source>
            <pubdate>2007</pubdate>
            <volume>52</volume>
            <fpage>2920</fpage>
            <lpage>2925</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10620-007-9760-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">17415632</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Risk of cancer in ulcerative colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Ekbom</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Gastrointest Surg</source>
            <pubdate>1998</pubdate>
            <volume>2</volume>
            <fpage>312</fpage>
            <lpage>313</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1091-255X(98)80067-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">9917184</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Greten</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>Eckmann</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Greten</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>ZW</fnm>
               </au>
               <au>
                  <snm>Egan</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Kagnoff</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Karin</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2004</pubdate>
            <volume>18</volume>
            <fpage>285</fpage>
            <lpage>296</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.cell.2004.07.013</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Complementary and alternative therapeutics: rigorous research is needed to support claims</p>
            </title>
            <aug>
               <au>
                  <snm>Kinsel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Straus</snm>
                  <fnm>SE</fnm>
               </au>
            </aug>
            <source>Annu Rev Pharmacol Toxicol</source>
            <pubdate>2003</pubdate>
            <volume>43</volume>
            <fpage>463</fpage>
            <lpage>484</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.pharmtox.43.100901.135757</pubid>
                  <pubid idtype="pmpid" link="fulltext">12540748</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Experimental models of inflammatory bowel disease reveal innate, adaptive, and regulatory mechanisms of host dialogue with the microbiota</p>
            </title>
            <aug>
               <au>
                  <snm>Elson</snm>
                  <fnm>CO</fnm>
               </au>
               <au>
                  <snm>Cong</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>McCracken</snm>
                  <fnm>VJ</fnm>
               </au>
               <au>
                  <snm>Dimmitt</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Lorenz</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Weaver</snm>
                  <fnm>CT</fnm>
               </au>
            </aug>
            <source>Immunol Rev</source>
            <pubdate>2005</pubdate>
            <volume>206</volume>
            <fpage>260</fpage>
            <lpage>276</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.0105-2896.2005.00291.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16048554</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Chemically induced mouse models of intestinal inflammation</p>
            </title>
            <aug>
               <au>
                  <snm>Wirtz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Neufert</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Weigmann</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Neurath</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Nat Protoc</source>
            <pubdate>2007</pubdate>
            <volume>2</volume>
            <fpage>541</fpage>
            <lpage>546</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nprot.2007.41</pubid>
                  <pubid idtype="pmpid" link="fulltext">17406617</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Glucosinolates and their breakdown products in food and food plants</p>
            </title>
            <aug>
               <au>
                  <snm>Fenwick</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Heaney</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mullin</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Crit Rev Food Sci Nutr</source>
            <pubdate>1983</pubdate>
            <volume>18</volume>
            <fpage>123</fpage>
            <lpage>201</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/10408398209527361</pubid>
                  <pubid idtype="pmpid">6337782</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Seed of Barbarea verna as a rich source of phenethyl isothiocyanate to provide natural protection from environmental and dietary toxins</p>
            </title>
            <aug>
               <au>
                  <snm>Ribnicky</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Poulev</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Henry</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Raskin</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>J Nutraceuticals Funct Med Foods</source>
            <pubdate>2001</pubdate>
            <volume>3</volume>
            <fpage>43</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1300/J133v03n03_03</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Potent chemopreventive agents against pancreatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Nishikawa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Furukawa</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>IS</fnm>
               </au>
               <au>
                  <snm>Takuji</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Masao</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Curr Cancer Drug Targets</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>373</fpage>
            <lpage>384</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2174/1568009043332970</pubid>
                  <pubid idtype="pmpid" link="fulltext">15180502</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Clinical development plan: phenethyl isothiocyanate</p>
            </title>
            <aug>
               <au>
                  <cnm>NCI</cnm>
               </au>
               <au>
                  <cnm>DCPC</cnm>
               </au>
            </aug>
            <source>J Cell Biochem Suppl</source>
            <pubdate>1996</pubdate>
            <volume>26</volume>
            <fpage>149</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9154175</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Suppression of inducible Nitric Oxide production by Indole and Isothiocyanate derivatives from Brassica plants in stimulated macrophages</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Dail</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Planta Med</source>
            <pubdate>2003</pubdate>
            <volume>69</volume>
            <fpage>696</fpage>
            <lpage>700</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1055/s-2003-42790</pubid>
                  <pubid idtype="pmpid" link="fulltext">14531017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Mechanism-based in vitro screening of potential cancer chemopreventive agents</p>
            </title>
            <aug>
               <au>
                  <snm>Gerhauser</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Klimo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Heiss</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Neumann</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Gamal-Eldeen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Knauft</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>GY</fnm>
               </au>
               <au>
                  <snm>Sitthimonchai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Frank</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Mutat Res</source>
            <pubdate>2003</pubdate>
            <volume>523-524</volume>
            <fpage>163</fpage>
            <lpage>172</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12628514</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Beta-phenylethyl and 8-methylsulphinyloctyl isothiocyanates, constituents of watercress, suppress LPS induced production of nitric oxide and prostaglandin E2 in RAW 264.7 macrophages</p>
            </title>
            <aug>
               <au>
                  <snm>Rose</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Won</snm>
                  <fnm>YK</fnm>
               </au>
               <au>
                  <snm>Ong</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Whiteman</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nitric Oxide</source>
            <pubdate>2005</pubdate>
            <volume>12</volume>
            <fpage>237</fpage>
            <lpage>243</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.niox.2005.03.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">15917216</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p><it>In vitro </it>and <it>in vivo </it>anti-inflammatory activity of a seed preparation containing phenethylisothiocyanate</p>
            </title>
            <aug>
               <au>
                  <snm>Dey</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ribnicky</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kurmukov</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Raskin</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>J Pharmacol Exp Ther</source>
            <pubdate>2006</pubdate>
            <volume>317</volume>
            <fpage>326</fpage>
            <lpage>333</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1124/jpet.105.096511</pubid>
                  <pubid idtype="pmpid" link="fulltext">16373530</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Modulatory properties of various natural chemopreventive agents on the activation of NF-kappaB signaling pathway</p>
            </title>
            <aug>
               <au>
                  <snm>Jeong</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>IW</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kong</snm>
                  <fnm>AN</fnm>
               </au>
            </aug>
            <source>Pharm Res</source>
            <pubdate>2004</pubdate>
            <volume>21</volume>
            <fpage>661</fpage>
            <lpage>670</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/B:PHAM.0000022413.43212.cf</pubid>
                  <pubid idtype="pmpid" link="fulltext">15139523</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Pharmacokinetics of dietary phenethyl isothiocyanate in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Ji</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kuo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>Pharm Res</source>
            <pubdate>2005</pubdate>
            <volume>22</volume>
            <fpage>1658</fpage>
            <lpage>1666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s11095-005-7097-z</pubid>
                  <pubid idtype="pmpid" link="fulltext">16180123</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>RDP58, a locally active TNF inhibitor, is effective in the dextran sulphate mouse model of chronic colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Murthy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Flanigan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Coppola</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Inflamm Res</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <fpage>522</fpage>
            <lpage>531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/PL00012423</pubid>
                  <pubid idtype="pmpid">12540016</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Mucosal healing in inflammatory bowel disease: impossible ideal or therapeutic target?</p>
            </title>
            <aug>
               <au>
                  <snm>Rutgeerts</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Vermeir</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Assche</snm>
                  <fnm>GV</fnm>
               </au>
            </aug>
            <source>Gut</source>
            <pubdate>2007</pubdate>
            <volume>56</volume>
            <fpage>453</fpage>
            <lpage>455</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/gut.2005.088732</pubid>
                  <pubid idtype="pmcid">1856849</pubid>
                  <pubid idtype="pmpid" link="fulltext">17369375</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Anti-inflammatory effects of phytosteryl ferulates in colitis induced by dextran sulphate sodium in mice</p>
            </title>
            <aug>
               <au>
                  <snm>Islam</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Murata</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fujisawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nagasaka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ushio</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bari</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Hori</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ozaki</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Br J Pharmacol</source>
            <pubdate>2008</pubdate>
            <volume>154</volume>
            <fpage>812</fpage>
            <lpage>824</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/bjp.2008.137</pubid>
                  <pubid idtype="pmcid">2439859</pubid>
                  <pubid idtype="pmpid" link="fulltext">18536734</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Toll-Like Receptor-4 Promotes the Development of Colitis-Associated Colorectal Tumors</p>
            </title>
            <aug>
               <au>
                  <snm>Fukata</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vamadevan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Breglio</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Krishnareddy</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hsu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Harpaz</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Dannenberg</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Subbaramaiah</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Itzkowitz</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Abreu</snm>
                  <fnm>MT</fnm>
               </au>
            </aug>
            <source>Gastroenterology</source>
            <pubdate>2007</pubdate>
            <volume>133</volume>
            <fpage>1869</fpage>
            <lpage>1869</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/j.gastro.2007.09.008</pubid>
                  <pubid idtype="pmcid">2180834</pubid>
                  <pubid idtype="pmpid" link="fulltext">18054559</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Phenethyl isothiocyanate inhibits STAT3 activation in prostate cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Gong</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Krishna Vanaja</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Karnes</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>CY</fnm>
               </au>
            </aug>
            <source>Mol Nutr Food Res</source>
            <pubdate>2009</pubdate>
            <volume>53</volume>
            <fpage>878</fpage>
            <lpage>886</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/mnfr.200800253</pubid>
                  <pubid idtype="pmpid" link="fulltext">19437484</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Activation of signal transducer and activator of transcription (STAT) 1 in human chronic inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Schreiber</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rosenstiel</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hampe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nikolaus</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Groessner</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Schottelius</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>K&#252;hbacher</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>H&#228;mling</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>F&#246;lsch</snm>
                  <fnm>UR</fnm>
               </au>
               <au>
                  <snm>Seegert</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Gut</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <fpage>379</fpage>
            <lpage>385</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/gut.51.3.379</pubid>
                  <pubid idtype="pmcid">1773344</pubid>
                  <pubid idtype="pmpid" link="fulltext">12171960</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Interleukin-6 trans-signaling in inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Mitsuyama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sata</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rose-John</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Cytokine Growth Factor Rev</source>
            <pubdate>2006</pubdate>
            <volume>17</volume>
            <fpage>451</fpage>
            <lpage>461</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cytogfr.2006.09.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">17045835</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The production of interferon-gamma-inducible protein 10 by granulocytes and monocytes is associated with ulcerative colitis disease activity</p>
            </title>
            <aug>
               <au>
                  <snm>Noguchi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Narumi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamagami</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fujiwara</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Higuchi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Oshitani</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Arakawa</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Gastroenterol</source>
            <pubdate>2007</pubdate>
            <volume>42</volume>
            <fpage>947</fpage>
            <lpage>956</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00535-007-2118-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">18085351</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>TNF activates an IRF1-dependent autocrine loop leading to sustained expression of chemokines and STAT1-dependent type I interferon-response genes</p>
            </title>
            <aug>
               <au>
                  <snm>Yarilina</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Park-Min</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Antoniv</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Ivashkiv</snm>
                  <fnm>LB</fnm>
               </au>
            </aug>
            <source>Nat Immunol</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>378</fpage>
            <lpage>387</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ni1576</pubid>
                  <pubid idtype="pmpid" link="fulltext">18345002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>The ins and outs of STAT1 nuclear transport</p>
            </title>
            <aug>
               <au>
                  <snm>McBride</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Reich</snm>
                  <fnm>NC</fnm>
               </au>
            </aug>
            <source>Sci STKE</source>
            <pubdate>2003</pubdate>
            <volume>195</volume>
            <fpage>re 13</fpage>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The immunology of mucosal models of inflammation</p>
            </title>
            <aug>
               <au>
                  <snm>Strober</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Fuss</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Blumberg</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Annu Rev Immunol</source>
            <pubdate>2002</pubdate>
            <volume>20</volume>
            <fpage>495</fpage>
            <lpage>549</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.immunol.20.100301.064816</pubid>
                  <pubid idtype="pmpid" link="fulltext">11861611</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Glabridin, a functional compound of licorice, attenuates colonic inflammation in mice with dextran sulphate sodium-induced colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Kwon</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Oh</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>JK</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2008</pubdate>
            <volume>151</volume>
            <fpage>165</fpage>
            <lpage>173</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2276918</pubid>
                  <pubid idtype="pmpid" link="fulltext">18005263</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Enhanced activity of a hydrogen sulphide-releasing derivative of mesalamine (ATB-429) in a mouse model of colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Fiorucci</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Orlandi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mencarelli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Caliendo</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Santagada</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Distrutti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Santucci</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Cirino</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Br J Pharmacol</source>
            <pubdate>2007</pubdate>
            <volume>150</volume>
            <fpage>996</fpage>
            <lpage>1002</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.bjp.0707193</pubid>
                  <pubid idtype="pmcid">2013915</pubid>
                  <pubid idtype="pmpid" link="fulltext">17339831</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>NF&#954;B: Comparison of mesalazine and balsalazide in induction and maintenance of remission in patients with ulcerative colitis: a meta-analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Rahimi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nikfar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rezaie</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Abdollahi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Dig Dis Sci</source>
            <pubdate>2009</pubdate>
            <volume>54</volume>
            <fpage>712</fpage>
            <lpage>721</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10620-008-0428-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">18683049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Mucosal inflammation in the terminal ileum of ulcerative colitis patients: endoscopic findings and cytokine profiles</p>
            </title>
            <aug>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Maruyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Umegae</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Saniabadi</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>Dig Liver Dis</source>
            <pubdate>2008</pubdate>
            <volume>40</volume>
            <fpage>253</fpage>
            <lpage>259</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.dld.2007.11.020</pubid>
                  <pubid idtype="pmpid" link="fulltext">18243079</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Control of specificilty and magnitude of NF&#954;B and STAT1-mediated gene activation through PIASy and PIAS1 cooperation</p>
            </title>
            <aug>
               <au>
                  <snm>Tahk</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chernishof</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Shuai</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2007</pubdate>
            <volume>104</volume>
            <fpage>11643</fpage>
            <lpage>11648</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0701877104</pubid>
                  <pubid idtype="pmcid">1913887</pubid>
                  <pubid idtype="pmpid" link="fulltext">17606919</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Regulation of cytokine-inducible nitric oxide synthase in cardiac myocytes and microvascular endothelial cells. Role of extracellular signal-regulated kinases 1 and 2 (ERK1/ERK2) and STAT1 alpha</p>
            </title>
            <aug>
               <au>
                  <snm>Singh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Balligand</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>TA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1996</pubdate>
            <volume>271</volume>
            <fpage>1111</fpage>
            <lpage>1117</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.271.2.1111</pubid>
                  <pubid idtype="pmpid" link="fulltext">8557638</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Increased expression of IP-10, IL-8, MCP-1, and MCP-3 in ulcerative colitis</p>
            </title>
            <aug>
               <au>
                  <snm>Uguccioni</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gionchetti</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Robbiani</snm>
                  <fnm>DF</fnm>
               </au>
               <au>
                  <snm>Rizzello</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Peruzzo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Campieri</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baggiolini</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>1999</pubdate>
            <volume>155</volume>
            <fpage>331</fpage>
            <lpage>336</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1866859</pubid>
                  <pubid idtype="pmpid" link="fulltext">10433925</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Blockade of CXCL10 protects mice from acute colitis and enhances crypt cell survival</p>
            </title>
            <aug>
               <au>
                  <snm>Sasaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yoneyama</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Eur J Immunol</source>
            <pubdate>2002</pubdate>
            <volume>32</volume>
            <fpage>3197</fpage>
            <lpage>3205</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/1521-4141(200211)32:11&lt;3197::AID-IMMU3197>3.0.CO;2-1</pubid>
                  <pubid idtype="pmpid">12555665</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>KEGG Toll-like receptor signaling pathway - Mus musculus (mouse)</p>
            </title>
            <url>http://www.genome.jp/kegg/pathway.html#disease</url>
         </bibl>
      </refgrp>
   </bm>
</art>
