We wanted to establish if the co-transfection of two distinct dsRNAs, targeting two different genes, could trigger their simultaneous silencing. The genes selected were TbPFR2 and FLA1; TbPFR2 encodes one of the two major components of the paraflagellar rod and is necessary for flagellum motility 13; FLA1 encodes a protein required for flagellum attachment to the cell body 50. These dsRNAs were transfected simultaneously in wild-type trypanosomes. As a control experiment, we used GFP dsRNA.

Cells were monitored for their acquired phenotype 15 h and 22 h after transfection (Table 1). The extinction of TbPFR2 was followed by immunofluorescence microscopy using the L8C4 anti-TbPFR2 monoclonal antibody. FLA1 gene silencing was analyzed by differential interference contrast microscopy, as it results in the visible detachement of the flagellum from the cell body (Figure 2).

The transfection of TbPFR2 dsRNA yielded potent silencing, as more than 60 % of the cells showed no staining for L8C4 15 h later. Since old flagella pre-exist in cells which were affected by RNAi at the beginning of cell replication, the real percentage of silenced cells is probably higher than 60 %, which is confirmed by the fact that it built up to more than 74 % at time point 22 h. The transfection of FLA1 dsRNA produced a phenotype in which the flagellum was detached from the cell body in more than 50 % of the cells. When both dsRNAs were co-transfected, both phenotypes were indeed observed, with similar frequencies to experiments where only one dsRNA was transfected. All the transfected cell populations did show a comparable growth rate (data not shown). The trypanosomes shown in Figure 2 had been transfected with both dsRNAs and the cell on the right is starting cytokinesis. The old flagellum of that cell is detached, while the new flagellum is attached along the cell body. The new flagellum exhibits a dilation of its distal tip, probably corresponding to the accumulation of TbPFR1, that is not assembled but still transported to the distal tip of the flagellum in the absence of TbPFR2 13. This observation demonstrates the usefulness of double-transfection experiments also for kinetics analysis. In our case, 22 h after dsRNAs transient transfection, the phenotype due to the FLA1 silencing is no longer visible in the new flagellum while that same flagellum still exhibits the phenotype due to the TbPFR2 silencing, clearly indicating different turn-over for TbPFR2 and FLA1 proteins.

The RNAi machinery could cope with two different dsRNA populations, without – in our conditions – any visible saturation effect. These results show the feasibility of experiments involving the use of multiple dsRNAs, thus allowing studies on complex processes in the cell physiology. However, such complex experiments can only be envisaged after ensuring that the phenotypes resulting from RNAi are specifically due to silencing of the target gene. In order to address that specific problem, we elaborated a method that involves RNAi experiments on trypanosomes that were engineered to possess an extra RNAi-resistant copy of the targeted gene, leading to functional complementation.

As a model for this study, we chose the TbPFR2 gene, which is present in four copies in the WT trypanosome genome (Figure 1A), all transcribed as a single long polycistronic mRNA. All these gene copies are separated by three identical intergenic UTRs (igUTR), while the first copy has a unique 5' UTR and the last copy has a unique 3'UTR. Three types of dsRNA populations were used in our experiments, and termed as follows. dsRNA homologous to the GFP sequence was labelled "GFP dsRNA"; dsRNA homologous to coding sequence of the TbPFR2 gene was labelled "CDS dsRNA"; finally, the mixture of three dsRNAs homologous to the 5' UTR, igUTR and 3'UTR of the TbPFR2 gene was termed "UTRs MIX dsRNAs" (Figure 1A). These dsRNAs were transfected into three cell lines: WT, TbPFR2tag and TbPFR2tag-ΔHLA (see Methods). For each experiment, the presence or absence of TbPFR2 in the new flagellum of bi-nucleated/bi-flagellated cells was monitored by immunofluorescence 14 h after the transfection (Table 2).

Reports in 1424 showed that RNAi silencing of a gene can be accomplished by targeting transcribed non-coding sequences. Here, we wanted to make sure that this kind of experiment was still feasible with a more complex system such as the TbPFR2 multigene locus, where multiple and distinct UTRs regulate the expression of four TbPFR2 isogenes. We first transfected WT trypanosomes with GFP dsRNA as a negative control and did not detect any TbPFR2 silencing (Figure 3A). Second, WT trypanosomes were transfected with the CDS dsRNA: 88 % of cells showed typical TbPFR2 silencing with an anti-TbPFR2 immunofluorescence showing that the protein was missing from the new flagellum (Figure 3B). Finally, the WT trypanosomes were transfected with the UTRs MIX dsRNAs, yielding the same phenotype as for the CDS dsRNA, although the silencing appeared less pronounced (Figure 3C and Table 2). Overall, these results demonstrate that RNAi could efficiently silence all of the TbPFR2 gene copies by targeting non-coding sequences present at the mRNA level.

When WT trypanosomes were transfected with TbPFR2 dsRNA complementary to only one UTR, the cells did not display any specific phenotype (data not shown). This observation is probably explained by the organization of the TbPFR2 locus: the polycistronic transcript is rapidly spliced into three different types of mRNA, each encoding one of the four copies of TbPFR2 515253. Thus, even if one type of TbPFR2 RNA is destroyed, the three remaining ones would likely provide enough RNA to synthesize TbPFR2 levels compatible with normal PFR formation.

To demonstrate that the silencing observed upon transfection of WT trypanosomes with the UTRs MIX dsRNAs was due to the actual targeting of TbPFR2, we used two cell lines expressing a supplementary tagged TbPFR2 gene copy. The TbPFR2tag cell line expresses the TbPFR2-TAG protein which correctly localizes to the flagellum.

The TbPFR2tag-ΔHLA cell line expresses TbPFR2-TAG-ΔHLA, lacking the HLA tripeptide, which prevents its localization to the flagellum. To determine both the cellular localization of the tagged TbPFR2 proteins (TbPFR2-TAG and TbPFR2-TAG-ΔHLA) and the completeness of the PFR assembly, immunofluorescence experiments were carried out with the BB2 and ROD-1 antibodies; the former recognizes the Ty-1 epitope tag present on the two tagged TbPFR2 proteins 54, while the latter is a marker for full PFR assembly 5556.

GFP dsRNA was transfected as a negative control in each cell line. As expected, this did not yield any TbPFR2 silencing: TbPFR2 was decorated in both the old and new flagella by the anti-TbPFR2 antibody, and the PFR could be assembled fully, as evidenced by its staining with the ROD-1 antibody (data not shown, Table 2). In TbPFR2tag cells, TbPFR2-TAG was able to localize to the PFR, as evidenced by the PFR decoration with BB2 (red color, Figure 4A). In contrast, TbPFR2-TAG-ΔHLA failed to do so in TbPFR2tag-ΔHLA cells, and the BB2 signal was detected in the cytoplasm, as expected (red color, Figure 4D).

We next compared TbPFR2tag trypanosomes after transfection with either CDS dsRNA or UTRs MIX dsRNAs. TbPFR2tag cells transfected with CDS dsRNA had a flagellum not (or faintly) decorated with the anti-TbPFR2 antibody, demonstrating that both the WT and the recombinant TbPFR2 gene copies were effciently silenced (Table 2). That result was confirmed with anti-TAG immunofluorescence that showed no staining of the flagellum, demonstrating that TbPFR2-TAG was absent (no red color, Figure 4B). This lack of both TbPFR2 and TbPFR2-TAG led to an incomplete assembly of the PFR, which was therefore not decorated with the ROD-1 antibody (no yellow color, Figure 4B). In contrast, cells transfected with the UTRs MIX dsRNAs exhibited a WT phenotype, with only 2 % of the cells displaying TbPFR2 silencing in the flagellum (Table 2). In this case, the tagged protein was expressed, leading to complete assembly of the PFR (yellow color, Figure 4C) because the protein is functional and localized to the flagellum (red color, Figure 4C; 56). This remarkable result indicates a complementation phenomenon that is explained by the fact that the tagged TbPFR2 gene was not silenced, as it was expressed from a coding sequence flanked by UTRs from the expression vector: from the 5' UTR of the procyclin gene and from the 3'UTR of the aldolase gene (Figure 1B; 57).

To definitely demonstrate that the complementation described above is indeed due to the expression of functional TbPFR2-TAG, we transfected the same dsRNA into TbPFR2tag-ΔHLA trypanosomes expressing a modified TbPFR2 protein missing three amino acids (that is nine nucleotides out of 1800). TbPFR2tag-ΔHLA does not access the flagellar compartment and thus cannot be functional 58. Transfecting either CDS dsRNA or UTRs MIX dsRNAs produced cells in which the new flagellum was not (or faintly) decorated by the anti-TbPFR2 antibody (Table 2). TbPFR2-TAG-ΔHLA was not decorated by the anti-TAG antibody when cells were transfected with CDS dsRNA (red color, Figure 4E), indicating that both the WT and the tagged TbPFR2 copies were silenced, thus leading to an incomplete PFR edification (yellow color, Figure 4E). In contrast, transfection of UTRs MIX dsRNAs did not prevent the expression of the recombinant TbPFR2-TAG-ΔHLA protein, as it appeared stained by the anti-TAG antibody (red color, Figure 4F). However, that non-functional protein could not participate in the construction of the PFR, as shown by the absence of ROD-1 signal in the new flagellum, since it cannot access the flagellum (yellow color, Figure 4F).

RNA-directed RNA polymerase activity (RdRP) has been implicated as one possible step in the formation of siRNA in fungi 59, plants 1718, and worms 60. The fact that we could specifically silence WT TbPFR2 by targeting its UTRs, without interfering with the tagged TbPFR2 genes, suggests that spreading of silencing beyond the initial targeted sequence does not occur in trypanosomes 61626364.

We next asked if an RNAi-mediated loss of function could be complemented by the expression of a gene orthologue to the silenced one. The system used to answer that question involved the TbPFR2i cell line – that expresses TbPFR2 dsRNA under the control of a tetracycline-inducible promoter 47 – into which constitutive expression of Trypanosoma cruzi TbPFR2 orthologue (TcPFR2) was established using stable transfection procedures. TbPFR2 and TcPFR2 proteins share 90 % identity (both of them are recognized by the anti-TbPFR2 L8C4 antibody), but their gene sequences have diverged enough for us to envisage that the RNAi-silencing of TbPFR2 would not affect significantly the introduced TcPFR2 gene (83 % overall nucleotide identity). We thus created two new cell lines based on the previously described TbPFR2i cells 47 (see Methods). TbPFR2 expression and cell motility were analyzed.

Our first experiment showed that the PCGFP cells constitutively expressed GFP, as detected by microscope observation of living cells (data not shown). Both the PCGFP and PCTcPFR2 cell lines were induced to express TbPFR2 dsRNA for 48 hours. Immunofluorescence revealed that non-induced PCGFP cells exhibit a WT-like phenotype (Figure 5A, -TET). When these cells were induced with tetracycline, expected TbPFR2 silencing occurred (Figure 5A, +TET). Non-induced PCTcPFR2 cells displayed an intense anti-TbPFR2 antibody decoration with bright dots in the cytoplasm, indicative of TcPFR2 overexpression (such overexpression by the EP procyclin promoter is frequent; Figure 5B, -TET). When these same cells were tetracycline-induced, the flagellar staining was still perfectly visible, at a level comparable to the one previously observed in the non-induced PCGFP control cells (Figure 5B, +TET). Bright dots previously observed had disappeared, probably as a result of TbPFR2 silencing. The fact that the paraflagellar rod was still neatly decorated by the anti-TbPFR2 antibody demonstrated that the structural inter-species complementation had indeed taken place in these cells, with TcPFR2 being effectively located at the flagellum.

Did these structurally-complemented cells show a functional complementation, i.e. a normal flagellum motility (hence a normal cellular mobility)? To address this question, we performed a sedimentation assay 56 on non-induced and tetracycline-induced PCGFP and PCTcPFR2 trypanosomes (Figure 6). Non-induced PCGFP cells showed a little tendency to sediment due to the fact that expression of TbPFR2 dsRNA in TbPFR2i cells is partially leaky, producing low amounts of TbPFR2 dsRNA even in the absence of tetracycline (43; Durand-Dubief and Bastin, unpublished data). When expression of TbPFR2 dsRNA was fully induced, motility stopped leading to increased sedimentation (Figure 6, left panel). In contrast, expression of TbPFR2 dsRNA in PCTcPFR2 cells did not reduce motility (Figure 6, right panel). That result definitely demonstrates that the ortholog protein TcPFR2 fully complemented the loss of function resulting from TbPFR2 silencing.

The complementation described above shows the robustness of our strategy, because TbPFR2 and TcPFR2 are highly similar (they share 82 % identity at the nucleotide level 65) and are nonetheless correctly differenciated by the RNAi machinery. However, our complementation strategy might be more diffcult to implement when the gene studied is too similar to the T. brucei counterpart. While this unfavorable case might happen with extremely evolutionarily-related organisms, studies have shown that the overall genetic sequence identity between Trypanosoma brucei and Trypanosoma cruzi, for example (the closest evolutionarily-related organisms envisaged for these studies), is roughly 80 % (65 and 66). 47 showed that this identity percentage is still compatible with an RNAi-based complementation strategy. It goes without saying that when the organisms are evolutionarily-distant, gene sequences diverge more rapidly than the protein sequences, thus laying off a field where our strategy can be implemented with good confidence that complementation will occur.

The procyclic T. brucei brucei strain 427 (or its derivatives) was used throughout this work. Cells were cultured at 27°C in semi-defined medium 79 (SDM 79) containing 10% foetal calf serum. PFRAi cells were described in 47. The TbPFR2i trypanosomes can be tetracycline-induced to express TbPFR2 dsRNA, thus eliciting an RNAi response against that gene. Note that this cell line is referred to as TbPFR2i in this article because of a change in the gene nomenclature 70.

RNA was synthesized in vitro with T3 and Sp6 polymerases using PCR products as templates 71. The following primers (incorporating T3 or Sp6 promoters) were used:

for GFP (from the nucleotide coding sequence 476–691 of the EGFPN2 gene; Clontech), AATTAACCCTCACTAAAGGGAGAAG AACGGCATCAAGGTGAAC (T3 promoter italicized) and ATTTAGGTGACACTATAGAAG AGTGATCCCGGCGGCGGTCACG (Sp6 promoter italicized);

for FLA1, AATTAACCCTCACTAAAGGGAGA CCAAACCGTGGGCACCAAGG (T3 promoter italicized) and ATTTAGGTGAACTATAGAAGAG GTGGGATGATTAAAACGAGC (Sp6 promoter italicized);

for the TbPFR2 5' untranslated region (5' UTR; nucleotide sequence [-545→-1] upstream of TbPFR2 ATG start codon), AATTAACCCTCACTAAAGGGAGA (T3 promoter) and ATTTAGGTGACACT-ATAGAAGAG (Sp6 promoter);

for the TbPFR2 intergenic untranslated region (igUTR), AATTAACCCTCACTAAAGGGAGA CGCTGCGCTTAAATGTCTT (T3 promoter italicized) and ATTTAGGTGACACTATAGAAGA GTGATGCTTTATTGCTTTCT (Sp6 promoter italicized);

for the TbPFR2 3'untranslated region (3'UTR; nucleotide sequence [1→533] downstream of the TbPFR2 TAG stop codon), AATTAACCCTCACTAAAGGGAGA (universal T3 promoter) and ATTTAGGTGACACTATAGAAGAG (universal Sp6 promoter);

for the TbPFR2 coding sequence (CDS; nucleotide coding sequence [1084→1358]), ATTTAGGTGACACTATAGA GAGGTGAAGCGCCGTATTGAGGA (Sp6 promoter italicized) and AATTAACCCTCACTAAAGGGAGA GTTTTGTACAGGCGACGGAA (T3 promoter italicized);

Figure 1A shows the TbPFR2 locus and the position of the two dsRNA populations that were used, and their homology to either the coding sequence (labelled "CDS dsRNA") or the different 5'UTR, igUTR and 3'UTR all together (labelled "UTRs MIX dsRNAs"). A third dsRNA, homologous to the GFP gene is labelled "GFP dsRNA" throughout this work and was used as a control dsRNA. dsRNA was introduced into trypanosomes by electroporation, as described 14.

Plasmid pPC was generated from plasmid pSk1-GFP 50 as follows: pSk1-GFP was digested with Hind III and Eco RI to remove the GFP gene. Oligonucleotides AGCT GTCTAGCGATATCGGATCCG (forward) and AATT CGGATCCGATATCGCTAGCA (reverse) were annealed (protruding ends italicized) and the resulting double-strand oligonucleotide was ligated into the pSk1-GFP plasmid, resulting in the insertion of a poly-linker containing restriction sites Cla I, Hind III, Nhe I, Eco RV, Bam HI and Eco RI (Branche and Bastin; unpublished data). Plas-mid pPCTcPFR2 was generated as follows: amplification of the TcPFR2 gene was performed using Trypanosoma cruzi genomic DNA (kind gift of Cécile Gallet and Philippe Grellier, MNHN) and the two primers TcPFR2H (GAGTCTAAGCTTATGAGCTACAAGGAGGCATC) and TcPFR2ER (GCGTGGAATTCTTACTGTGTGATCTGCTGCAC). Both the amplified DNA fragment and the pPC plasmid were digested with Eco RI and Hind III. The fragment was ligated into pPC so as to yield the plasmid pPCTcPFR2 (Figure 1B).

The different constructs used to transform trypanosomes are shown on Figure 1B. The cell lines were established as follows.

Three different monoclonal antibodies were used as hybridoma supernatants: L8C4, IgG recognizing T. brucei TbPFR2 and cross-reacting with T. cruzi orthologue TcPFR2 74; BB2, IgG recognizing the Ty-1 tag of the TbPFR2-TAG and TbPFR2-TAG-ΔHLA recombinant proteins 54; and ROD-1, IgM recognizing a doublet of minor PFR proteins 55. For immunofluorescence, trypanosomes were spread onto poly-L-lysine-coated slides, fixed in cold methanol and processed as described 75. Experiments involving the use of L8C4 only were performed with an FITC-conjugated anti-mouse IgG secondary antibody. Double-staining experiments using BB2 and ROD-1 were performed with a TRITC-conjugated specific anti-mouse IgG secondary antibody and an FITC-conjugated specific anti-mouse IgM secondary antibody. DNA was systematically stained with 4',6-diamidino-2-phenylindole (DAPI). Slides were examined with a Leica DMR microscope, images were captured using a cooled CCD camera (Cool Snap HQ, Roper Scientific) and processed with the GNU image manipulation program version 2 76.

The trypanosome sedimentation assay was performed as described in 56. Briefly: trypanosomes were grown at ≈ 5.10⁶ cells/mL in normal culture medium, with or without 48 hour tetracycline induction. 1 mL of these cultures was dispensed to 5 plastic spectrophotometry cuvettes, for time points 0, 2, 4, 6, 8 hours, and left still. At each time point, the optical density at 600 nm was measured twice: first without mixing (O.D._{no mix}) and second after mixing the cuvette (O.D._mix). Data were plotted as a function of time.