<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1472-6750-10-23</ui>
   <ji>1472-6750</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Yeast functional screen to identify genetic determinants capable of conferring abiotic stress tolerance in <it>Jatropha curcas</it></p>
         </title>
         <aug>
            <au id="A1">
               <snm>Eswaran</snm>
               <fnm>Nalini</fnm>
               <insr iid="I1"/>
               <email>nalini_eswaran@relbio.com</email>
            </au>
            <au id="A2">
               <snm>Parameswaran</snm>
               <fnm>Sriram</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>oryzain@yahoo.com</email>
            </au>
            <au id="A3">
               <snm>Sathram</snm>
               <fnm>Balaji</fnm>
               <insr iid="I1"/>
               <email>balaji_sathram@relbio.com</email>
            </au>
            <au id="A4">
               <snm>Anantharaman</snm>
               <fnm>Bhagyam</fnm>
               <insr iid="I1"/>
               <email>bhagyam_anantharaman@relbio.com</email>
            </au>
            <au id="A5">
               <snm>Kumar G</snm>
               <mnm>Krishna</mnm>
               <fnm>Raja</fnm>
               <insr iid="I1"/>
               <email>raja_kumar@relbio.com</email>
            </au>
            <au ca="yes" id="A6">
               <snm>Tangirala</snm>
               <mnm>Johnson</mnm>
               <fnm>Sudhakar</fnm>
               <insr iid="I1"/>
               <email>ts_johnson@relbio.com</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Plant Metabolic Engineering Group, Reliance Life Sciences Pvt Ltd, Dhirubhai Ambani Life Sciences Center, R-282, Thane- Belapur Road, Rabale, Navi Mumbai- 400 701, India</p>
            </ins>
            <ins id="I2">
               <p>DuPont Knowledge Centre, ICICI Knowledge Park, Genome Valley, Turkapalli, Shamirpet, Hyderabad 500 078, India</p>
            </ins>
         </insg>
         <source>BMC Biotechnology</source>
         <issn>1472-6750</issn>
         <pubdate>2010</pubdate>
         <volume>10</volume>
         <issue>1</issue>
         <fpage>23</fpage>
         <url>http://www.biomedcentral.com/1472-6750/10/23</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">20302659</pubid>
               <pubid idtype="doi">10.1186/1472-6750-10-23</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>7</day>
               <month>7</month>
               <year>2009</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>20</day>
               <month>3</month>
               <year>2010</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>20</day>
               <month>3</month>
               <year>2010</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2010</year>
         <collab>Eswaran et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Environmentally inflicted stresses such as salinity and drought limit the plant productivity both in natural and agricultural system. Increasing emphasis has been directed to molecular breeding strategies to enhance the intrinsic ability of plant to survive stress conditions. Functional screens in microorganisms with heterologous genes are a rapid, effective and powerful tool to identify stress tolerant genes in plants. <it>Jatropha curcas </it>(Physic nut) has been identified as a potential source of biodiesel plant. In order to improve its productivity under stress conditions to benefit commercial plantations, we initiated prospecting of novel genes expressed during stress in <it>J. curcas </it>that can be utilized to enhance stress tolerance ability of plant.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>To identify genes expressed during salt tolerance, cDNA expression libraries were constructed from salt-stressed roots of <it>J. curcas</it>, regulated under the control of the yeast <it>GAL1 </it>system. Using a replica based screening, twenty thousand yeast transformants were screened to identify transformants expressing heterologous gene sequences from <it>J. curcas </it>with enhanced ability to tolerate stress. From the screen we obtained 32 full length genes from <it>J. curcas </it>[GenBank accession numbers <ext-link ext-link-id="FJ489601" ext-link-type="gen">FJ489601</ext-link>-<ext-link ext-link-id="FJ489611" ext-link-type="gen">FJ489611</ext-link>, <ext-link ext-link-id="FJ619041" ext-link-type="gen">FJ619041</ext-link>-<ext-link ext-link-id="FJ619057" ext-link-type="gen">FJ619057</ext-link> and <ext-link ext-link-id="FJ623457" ext-link-type="gen">FJ623457</ext-link>-<ext-link ext-link-id="FJ623460" ext-link-type="gen">FJ623460</ext-link>] that can confer abiotic stress tolerance. As a part of this screen, we optimized conditions for salt stress in <it>J. curcas</it>, defined parameters for salt stress in yeast, as well as isolated three salt hypersensitive yeast strains <it>shs-2, shs-6 </it>and <it>shs-8 </it>generated through a process of random mutagenesis, and exhibited growth retardation beyond 750 mM NaCl. Further, we demonstrated complementation of the salt sensitive phenotypes in the <it>shs </it>mutants, and analyzed the expression patterns for selected <it>J. curcas </it>genes obtained from the screen in both leaf and root tissues after salt stress treatments.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>The approach described in this report provides a rapid and universal assay system for large scale screening of genes for varied abiotic stress tolerance within a short span of time. Using this screening strategy we could isolate both genes with previously known function in stress tolerance as well as novel sequences with yet unknown function in salt stress tolerance from <it>J. curcas</it>. The isolated genes could be over-expressed using plant expression system to generate and evaluate transgenic plants for stress tolerance as well as be used as markers for breeding salt stress tolerance in plants.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Environmentally inflicted stresses such as extreme temperatures, low water availability, high salt levels, mineral deficiency and toxicity are frequently encountered by plants both in natural and agricultural system that affect plant productivity. According to Bayer <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, abiotic stresses are estimated to reduce yields to less than half of that possible under ideal growing conditions. The efforts to improve crop performance under environmental stresses have been moderately successful as the fundamental mechanisms of stress tolerance in plants are yet to be completely understood. Conventional approaches to breeding crop plants with improved stress tolerance have thus far met with limited success because of the difficulty of breeding tolerance associated traits from diverse plant backgrounds. Hence, an increasing emphasis has been directed to molecular strategies targeted at enhancing the intrinsic ability of the plants to survive stress conditions. Current approaches proposed to date focus attention on identification of genes associated with salinity, drought and abiotic stress resistance, followed by genetic modification of the plants expressing genes enabling them to withstand restrictive growth imposed by unfavourable environmental conditions <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>Functional screening of microorganisms that express heterologous cDNA libraries is a powerful tool for identifying genes with specific functions, independent of the regulation of their expression <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The screening of <it>E. coli </it>or yeast expressing plant cDNAs has been used successfully to identify genes that are involved in enhanced stress tolerance <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Functional screening of sodium-sensitive yeast expressing a cDNA library of the halotolerant plant sugar beet resulted in identification of the eukaryotic translation initiation factor (eIF1A), and overexpression of the eIF1A has been reported to increase salt tolerance of yeast and <it>Arabidopsis </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Cadmium (II)-sensitive yeast mutant <it>ycf1 </it>has been employed to screen <it>Arabidopsis </it>cDNA library to identify cadmium resistance gene, AtPcrs <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The genes for allene oxide cyclase and the cytosolic chaperonin containing TCP-1a homologue <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> have been isolated as salt tolerant genes from <it>B. sexangula </it>by functional screening on NaCl-containing medium using <it>E. coli </it>as the host organism. More recently, Ezawa and Tada <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> reported functional screening in <it>Agrobacterium </it>as an effective supplemental method to pre-screen genes involved in abiotic stress tolerance. These results demonstrate that microbial functional screening is an effective tool to quickly identify stress tolerant gene candidates in plants.</p>
         <p>Genetic engineering and modern molecular breeding methods have been used to isolate key genes involved in abiotic stress response from characterized model plants such as <it>Arabidopsis</it>, and several economically important crops <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. Directly applying these strategies to non-model plants is often challenging. Several other approaches such as DD-RT-PCR, subtractive hybridization, microarray analysis and FOX screening have also led to identification of genes regulated during stress response <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>. However, a functional effect of the gene(s) identified on stress resistance is not always clearly established from such experimental approaches <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. While it has been possible in certain instances to extend and utilize the information available on genes regulating and/or conferring salinity, drought and abiotic stress resistance in model plants, the ability to uncover novel or target plant specific genes/pathways regulating abiotic stress tolerance would be limited without a <it>de novo </it>screen.</p>
         <p><it>Jatropha curcas </it>(Physic nut), a member of Euphorbiaceae family has been identified as a biodiesel plant in tropical countries <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Being a Euphorbiaceae member, <it>J. curcas</it>, is to a certain extent, drought tolerant and has been documented in certain instances to grow in heavy metal contaminated soils <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Commercial plantation of <it>J. curcas </it>has been proposed as a sustainable source of biodiesel mainly due to high seed oil content, lipid composition similar to that of fossil diesel and non-competing demand with edible oil supplies <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Prospecting of novel genes expressed during stress tolerance from <it>J. curcas </it>and utilizing genetic information to modify and enhance the stress tolerance ability of this plant may enable development of <it>J. curcas </it>lines capable of producing growth in poor and marginal soils with acceptable oil yields. Besides, these novel genes isolated from <it>J. curcas </it>may also be applied for genetic improvement of other agriculturally important crops mediated via heterologous gene expression or to develop saline and drought tolerant varieties.</p>
         <p>However, due to limited genome information, large scale gene prospecting to identify genes that are linked to resistance to abiotic stress in <it>J. curcas </it>has been challenging. To overcome this limitation, we describe a functional genetic screen that utilizes yeast as a surrogate system to identify and isolate genes involved in stress tolerance. We have used yeast <it>GAL1 </it>regulated, cDNA expression libraries derived from <it>J. curcas</it>, to develop replica printing based functional screen for identification of yeast transformants expressing heterologous genes that confer abiotic stress tolerance. Through the above screen, we have demonstrated the ability to isolate several novel genes specific to <it>J. curcas </it>expressed during abiotic stress tolerance.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Identification of salt stress condition for wild-type yeasts and isolation of salt hypersensitive yeast mutants, <it>shs-2, shs-6 </it>and <it>shs-8</it></p>
            </st>
            <p>To identify and isolate <it>J. curcas </it>genes involved in salt tolerance, yeast cells were used for functional screening. Yeast cells have been shown to exhibit salt stress, which is reflected as retardation in cell growth. Wild type yeast strains have been reported to show salt sensitivity from 500 mM depending on growth conditions. In our assays we scored for survival of yeast-transformants that could survive at and beyond 750 mM NaCl. This condition selected for the screen at a stringent concentration of 750 mM NaCl, subjected the yeast transformants to ionic as well as osmotic stress, and imposed stringent conditions for salt and drought stresses. Further, to enhance sensitivity of the screen, three salt hypersensitive mutants <it>shs-2</it>, <it>shs-6 </it>and <it>shs-8 </it>were generated by random mutagenesis that exhibited growth retardation beyond 500 mM NaCl (Figure <figr fid="F1">1</figr>). The salt hypersensitive mutant <it>shs-2 </it>was used to demonstrate the ability of recovered <it>J. curcas </it>genes to complement the salt sensitive defect in this mutant.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Identification of salt stress conditions for wild-type <it>S. cerevisiae </it>(BY4741)</p>
               </caption>
               <text>
                  <p><b>Identification of salt stress conditions for wild-type <it>S. cerevisiae </it>(BY4741)</b>. Sectors in plates marked with red dot are wild-type, while other sectors represent salt hypersensitive yeast mutants obtained through random UV mutagenesis. Wild-type yeast BY4741 shows salt sensitivity from 500 mM NaCl, with complete growth arrest at 2.0 M NaCl. In contrast, salt hypersensitive mutants <it>shs-2, shs-4, shs-6 and shs-8 </it>(isolated in the BY4741 background) show growth retardation from 500 mM. Similar amount of inoculums were used in all the plates.</p>
               </text>
               <graphic file="1472-6750-10-23-1" hint_layout="double"/>
            </fig>
            <p>The underlying basis for the screen is the ability to use a catabolic regulated <it>GAL1 </it>promoter <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> to conditionally express a <it>J. curcas </it>gene in the yeast cells, cloned into a yeast shuttle vector <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>; while scoring the relative survival of yeast cells exposed to salinity or other abiotic stress to the same yeast transformants, grown under repressed state, subject to similar stress or under control conditions. Scoring the relative growth patterns allows the identification and characterization of the tolerant transformants by plasmid-rescue (Figure <figr fid="F2">2</figr>).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Schematic illustration of the underlying principle of the functional genetic screen</p>
               </caption>
               <text>
                  <p><b>Schematic illustration of the underlying principle of the functional genetic screen</b>. Identification and isolation of <it>J. curcas </it>genes conferring resistance to abiotic stress in <it>S. cerevisiae</it>. In <b>panel (A) </b>growth of <it>S. cerevisiae </it>colonies under abiotic stress conditions acquired due to heterologous gene expression was represented. In <b>panel (B) </b>transformation and screening of <it>J. curcas </it>root cDNA library in <it>S. cerevisiae </it>for ability to survive stress using inducible promoter was represented.</p>
               </text>
               <graphic file="1472-6750-10-23-2" hint_layout="double"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Construction of cDNA library from <it>J. curcas </it>to identify stress responsive genes</p>
            </st>
            <p>To understand the early salt-stress phenotypes and characterize the genes involved in early responses to salt stress on <it>J. curcas</it>, 3-4 week old seedlings were treated with various levels of salt stress (see additional file <supplr sid="S1">1</supplr>: salinity treatment to seedlings). The phenotypic effects of salt stress resulted in observable wilting and drooping in <it>J. curcas </it>seedlings. The effect of salt stress was evident at a concentration of 150 mM NaCl, and the effects were pronounced at higher salt concentrations, or when the seedlings were treated for prolonged time (see additional file <supplr sid="S1">1</supplr>). Further, from this time-course analysis, for salinity stress phenotype in <it>J. curcas </it>it was identified that the exposure of roots to 150 mM NaCl for 2 h, at a relative humidity of 40-50% was sufficient to observe early effects of salt stress, which was marked by low level-wilting of young leaf tissue prior to stem drooping (see additional file <supplr sid="S1">1</supplr>: salinity treatment to seedlings).</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Salinity treatment to seedlings</b>. Twenty one-day-old <it>J. curcas </it>seedlings were treated with 0, 150 mM, 250 mM and 750 mM NaCl for 0 h, 2 h, 4 h and 8 h. Total RNA was extracted from root and leaf tissues of 150 mM NaCl treated seedlings at 0 h, 2 h and 8 h and semi- quantitative RT-PCR expression of selected <it>J. curcas </it>genes was performed.</p>
               </text>
               <file name="1472-6750-10-23-S1.TIFF">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Salt and stress pathways in plants are perceived by signalling networks and regulated by transcription machinery <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. To enrich cDNA libraries for transcripts that represent a greater proportion of early acting factor to later responding regulators, we sampled root tissue at the early-time points of salt stress. <it>J. curcas </it>root tissue samples treated at 150 mM, for 2 h time point were used in construction of cDNA libraries using the SMART cDNA synthesis Kit <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> (see Methods).</p>
            <p>While plant genomes display large size variations, the number of expressed complement of genes involved in cellular processes are more conserved. Based on the information available for model plant <it>Arabidopsis </it>and rice, ~3000-5000 genes out of a transcriptome of ~27000 genes are expressed in root tissue <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Recent analysis indicates a modest genome size for the <it>J. curcas</it>, among Euphorbiaceae members, with an estimated genome size of ~450 Mb that provide an approximation of transcriptome complexity <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. To adequately represent root transcriptome, titers representing ~48000 c.f.u were recovered in each of the un-amplified pools that largely comprised of full-length cDNA sequences in 45-50% of the genes. This library was used for subsequent functional analysis in yeast.</p>
         </sec>
         <sec>
            <st>
               <p>Yeast based replica-printing method for isolating <it>J. curcas </it>genes involved in abiotic stress</p>
            </st>
            <p>To increase the probability of representation of each individual clone within these yeast expression libraries and to efficiently transform yeast, we amplified the copy numbers of clones contained in these libraries in <it>E. coli </it>(see Methods for details). A total of 20,000 yeast transformants (for the plasmid borne <it>URA3 </it>marker) representing the <it>J. curcas </it>root cDNA library was screened for salinity tolerance using a replica printing method (Figure <figr fid="F3">3</figr>). The replica printing process was devised to identify and isolate yeast transformants expressing heterologous gene sequences derived from <it>J. curcas </it>root cDNA libraries, with a low-rate of false negatives. Screening criteria included scoring relative survival advantage, for each transformant when subject to stress and gene expression status (Figures <figr fid="F2">2</figr> and <figr fid="F3">3</figr>). This method increased efficiency of gene recovery and reduced the screening errors by providing additional, more exhaustive controls that allowed the identification and elimination of both false-positive as well as false-negative phenotypes. The screening conditions select yeast transformants that are capable of survival under stress (acquired due to expression of <it>J. curcas </it>heterologous cDNA) and are able to grow; while eliminating events due to lethality, non-expression and other experimental artefacts.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Replica printing</p>
               </caption>
               <text>
                  <p><b>Replica printing</b>. Schematic outline of the quadruplet plate based replica-printing to screen yeast transformants to salt stress. In this assay each individual yeast transformant is placed on four selective plates. Comparison of growth of yeast between these plates allows scoring and isolation of transformants expressing genes, conferring stress tolerance.</p>
               </text>
               <graphic file="1472-6750-10-23-3" hint_layout="double"/>
            </fig>
            <p>Using the replica-printing based functional screen, 345 candidate yeast transformants expressing cDNA (derived from <it>J. curcas </it>roots) were isolated from a pool of 20,000 yeast transformants. A representative data set showing results of phenotypic selection of salt tolerance is presented in (Figure <figr fid="F4">4</figr>). The transformed yeast cells displayed an enhanced ability to tolerate unfavourable conditions imposed by salinity stress at a stringent selection of 750 mM NaCl concentration.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Yeast transformants expressing genes derived from <it>J. curcas </it>root library</p>
               </caption>
               <text>
                  <p><b>Yeast transformants expressing genes derived from <it>J. curcas </it>root library</b>. Photographs of representative replica plate screen (as described in Figure 3) demonstrating the ability to isolate yeast transformants during salinity stress. Yeast transformants (selected for plasmid borne <it>URA3 </it>marker), expressing genes derived from <it>J. curcas </it>root libraries, showing tolerance to stress induced by 750 mM NaCl are marked in <b>panel D </b>(black circles). Identical yeast transformants, (compare panel B to D) with repressed gene expression shows arrested growth. <b>(A) </b>describes control conditions where gene is repressed and stress is not provided to the yeast cells. Yeast transformants are expected to grow on synthetic selection plates with dextrose as the carbon source. Transformants in type <b>(B) </b>conditions (to identify false-positives) are grown in synthetic selection media with dextrose as the carbon source, but treated under stress conditions. In these plates all transformants are expected to show retarded growth, due to the stress conditions. In type <b>(C) </b>conditions, yeast transformants are grown on synthetic selection plates containing galactose, but without subjecting them to stress conditions. If the expression of any heterologous gene is detrimental to cell grown, it can be identified, thus eliminating recovery of false-negative transformants in the screen. In type <b>(D) </b>conditions, where the gene expression is induced by galactose and the cells are simultaneously subjected to stress, yeast transformants that are capable of survival under stress (acquired due to expression of <it>J. curcas </it>heterologous cDNA) are able to grow (Figure 3).</p>
               </text>
               <graphic file="1472-6750-10-23-4" hint_layout="double"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Plasmid rescue, complementation of salt sensitive yeast phenotypes and sequence analysis</p>
            </st>
            <p>To determine and characterize <it>J. curcas </it>cDNA gene sequences that conferred enhanced salinity tolerance at 750 mM NaCl to yeast transformants plasmid rescue was performed as described in Bates <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Analysis of the DNA sequence information, recovered from the yeast transformants showed that 32 sequences from 345 clones encoded full-length genes with assignable ORF's derived from <it>J. curcas; </it>while the remaining were truncated cDNA sequences. The ability to recover genes from <it>J. curcas </it>involved in these processes demonstrates the efficacy of our strategy.</p>
            <p>To demonstrate the robustness of the screening method, we have re-transformed the rescued plasmids into wild-type yeast (data not shown) and salt hypersensitive mutant <it>shs-2 </it>(Figure <figr fid="F5">5</figr>). We evaluated these transformants for growth at high-salt stress of 750 mM or higher concentration. Several transformants of <it>shs-2 </it>mutant allowed growth at 750 mM NaCl. The data demonstrated the ability of the plasmid encoded genes derived from <it>J. curcas </it>permitted survival of wild-type yeast transformants (data not shown), and complemented several salt sensitive phenotypes of the <it>shs-2 </it>mutants. The data provided functional support for the consistent ability of the recovered genes to confer salt tolerance, and support cell growth at conditions otherwise detrimental to cell survival.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Functional evaluation of transformants in salt hypersensitive <it>(shs-2) </it>mutant</p>
               </caption>
               <text>
                  <p><b>Functional evaluation of transformants in salt hypersensitive <it>(shs-2) </it>mutant</b>. Plasmid transformation of <it>shs-2 </it>with five selected genes. 235, late embryogenesis abundant protein-5; 392, cytosolic ascorbate peroxidase -1; 63, metallothionein; 513, mitochondrial ATP synthase 6 KD subunit; 619, profilin. Single colony of each transformants and mutant strain was plated on YPD media containing range of NaCl concentrations (0 mM, 250 mM, 500 mM, 750 mM and 1 M).</p>
               </text>
               <graphic file="1472-6750-10-23-5" hint_layout="double"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Computational sequence, annotation and analysis reveals novel abiotic stress tolerant genes from <it>J. curcas</it></p>
            </st>
            <p>Further, sequence analysis and computational annotation reveals presence of novel genes from <it>J. curcas </it>involved in abiotic stress tolerance (Table <tblr tid="T1">1</tblr>). To annotate the sequences, computational searches were performed for similarity to sequences deposited in plant sequence databases (see Methods), that suggest the presence of plant specific regions within these sequences (Table <tblr tid="T1">1</tblr>). In this analysis 31 out of 32 (~96%) sequences with assignable hit to the sequence databases showed matches greater than the accepted threshold as elaborated by Altshul <it>et al</it>. <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> to other known plant genes; while for a single sequence, significant matches to existing sequences in the sequence database was not apparent (Table <tblr tid="T1">1</tblr>). This sequence could represent novel determinant of salinity and drought stress tolerance, whose role needs to be further established. Of the 31 sequences, 7 sequences showed match to encoded ribosomal proteins, while 1 sequence was annotated as a eukaryotic translation initiation factor SUI1. Twenty three sequences have been reported to have a strong role in conferring abiotic stress tolerance in other plant species (Table <tblr tid="T1">1</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Annotation of 32 full length genes, derived from <it>J. curcas</it>, obtained from yeast functional genetic screen tolerant to abiotic stress*</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p><b>Sr. No</b>.</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Clone ID</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p><b>GenBank Accession No</b>.</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Putative function of gene</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Length of gene (bp)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>References*</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT30</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489601" ext-link-type="gen">FJ489601</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Allene oxide cyclase</p>
                     </c>
                     <c ca="left">
                        <p>777</p>
                     </c>
                     <c ca="left">
                        <p>Yamada <it>et al</it>. 2002 <abbrgrp><abbr bid="B28">28</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT70</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489602" ext-link-type="gen">FJ489602</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Thioredoxin H-type (<it>TRX-h</it>)</p>
                     </c>
                     <c ca="left">
                        <p>357</p>
                     </c>
                     <c ca="left">
                        <p>Hong <it>et al</it>. 2004 <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>; Serrato <it>et al</it>. 2004 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT63</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489603" ext-link-type="gen">FJ489603</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Metallothionein</p>
                     </c>
                     <c ca="left">
                        <p>234</p>
                     </c>
                     <c ca="left">
                        <p>Jin <it>et al</it>. 2006 <abbrgrp><abbr bid="B24">24</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT49</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489604" ext-link-type="gen">FJ489604</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Heterotrophic ferredoxin</p>
                     </c>
                     <c ca="left">
                        <p>492</p>
                     </c>
                     <c ca="left">
                        <p>Sheokand and Brewin, 2003 <abbrgrp><abbr bid="B41">41</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT91</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489605" ext-link-type="gen">FJ489605</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Defensin</p>
                     </c>
                     <c ca="left">
                        <p>234</p>
                     </c>
                     <c ca="left">
                        <p>Zhang <it>et al</it>. 2008 <abbrgrp><abbr bid="B42">42</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT95</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489606" ext-link-type="gen">FJ489606</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Calmodulin-7 (<it>CAM-7</it>)</p>
                     </c>
                     <c ca="left">
                        <p>810</p>
                     </c>
                     <c ca="left">
                        <p>Pardo <it>et al</it>. 1998 <abbrgrp><abbr bid="B43">43</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT29</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489607" ext-link-type="gen">FJ489607</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Major allergen Pru ar1-like protein</p>
                     </c>
                     <c ca="left">
                        <p>495</p>
                     </c>
                     <c ca="left">
                        <p>Mbeguie <it>et al</it>. 1997 <abbrgrp><abbr bid="B30">30</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT19</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489608" ext-link-type="gen">FJ489608</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>S18.A ribosomal protein</p>
                     </c>
                     <c ca="left">
                        <p>495</p>
                     </c>
                     <c ca="left">
                        <p>Williams <it>et al</it>. 2003 <abbrgrp><abbr bid="B27">27</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT69</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489609" ext-link-type="gen">FJ489609</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>60S ribosomal protein L18a</p>
                     </c>
                     <c ca="left">
                        <p>537</p>
                     </c>
                     <c ca="left">
                        <p>Carroll <it>et al</it>. 2008 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT108</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489610" ext-link-type="gen">FJ489610</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Protease inhibitor/seed storage/lipid transfer protein family</p>
                     </c>
                     <c ca="left">
                        <p>348</p>
                     </c>
                     <c ca="left">
                        <p>Choi <it>et al</it>. 2008 <abbrgrp><abbr bid="B45">45</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT174</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ489611" ext-link-type="gen">FJ489611</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Unknown protein</p>
                     </c>
                     <c ca="left">
                        <p>195</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT231</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619041" ext-link-type="gen">FJ619041</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Membrane protein -2</p>
                     </c>
                     <c ca="left">
                        <p>189</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT235</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619042" ext-link-type="gen">FJ619042</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Late embryogenesis abundant protein 5 (<it>LEA-5</it>)</p>
                     </c>
                     <c ca="left">
                        <p>267</p>
                     </c>
                     <c ca="left">
                        <p>Hundertmark and Hincha, 2008 <abbrgrp><abbr bid="B29">29</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT365</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619043" ext-link-type="gen">FJ619043</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Cold-induced plasma membrane protein</p>
                     </c>
                     <c ca="left">
                        <p>174</p>
                     </c>
                     <c ca="left">
                        <p>Imai <it>et al</it>. 2005 <abbrgrp><abbr bid="B46">46</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT392</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619044" ext-link-type="gen">FJ619044</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Cytosolic ascorbate peroxidase -1 (<it>Apx-1</it>)</p>
                     </c>
                     <c ca="left">
                        <p>753</p>
                     </c>
                     <c ca="left">
                        <p>Badawi <it>et al</it>. 2004 <abbrgrp><abbr bid="B31">31</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT619</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619045" ext-link-type="gen">FJ619045</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Profilin-like protein</p>
                     </c>
                     <c ca="left">
                        <p>384</p>
                     </c>
                     <c ca="left">
                        <p>Ramachandran <it>et al</it>. 2000 <abbrgrp><abbr bid="B33">33</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT618</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619046" ext-link-type="gen">FJ619046</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Caffeoyl-CoA-O-methyltransferase (<it>CCoAOMT</it>)</p>
                     </c>
                     <c ca="left">
                        <p>741</p>
                     </c>
                     <c ca="left">
                        <p>Day <it>et al</it>. 2009 <abbrgrp><abbr bid="B47">47</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT557</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619047" ext-link-type="gen">FJ619047</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Eukaryotic translation initiation factor SUI1</p>
                     </c>
                     <c ca="left">
                        <p>381</p>
                     </c>
                     <c ca="left">
                        <p>Langland <it>et al</it>. 1996 <abbrgrp><abbr bid="B48">48</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT401</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619048" ext-link-type="gen">FJ619048</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Copper chaperone</p>
                     </c>
                     <c ca="left">
                        <p>282</p>
                     </c>
                     <c ca="left">
                        <p>Wintz and Vulpe, 2002 <abbrgrp><abbr bid="B32">32</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT391</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619049" ext-link-type="gen">FJ619049</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Ubiquitin conjugating enzyme 2 (<it>JcE2</it>)</p>
                     </c>
                     <c ca="left">
                        <p>447</p>
                     </c>
                     <c ca="left">
                        <p>Criqui <it>et al</it>. 2002 <abbrgrp><abbr bid="B49">49</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT513</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619050" ext-link-type="gen">FJ619050</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Mitochondrial ATP synthase 6 KD subunit (<it>JcMtATP6</it>)</p>
                     </c>
                     <c ca="left">
                        <p>171</p>
                     </c>
                     <c ca="left">
                        <p>Zhang <it>et al</it>. 2006 <abbrgrp><abbr bid="B17">17</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT442</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619051" ext-link-type="gen">FJ619051</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Ferritin-2, chloroplast precursor</p>
                     </c>
                     <c ca="left">
                        <p>771</p>
                     </c>
                     <c ca="left">
                        <p>Masuda <it>et al</it>. 2001 <abbrgrp><abbr bid="B50">50</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT483</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619052" ext-link-type="gen">FJ619052</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Annexin-like protein</p>
                     </c>
                     <c ca="left">
                        <p>945</p>
                     </c>
                     <c ca="left">
                        <p>Gidrol <it>et al</it>. 1996 <abbrgrp><abbr bid="B51">51</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYTC-4</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619053" ext-link-type="gen">FJ619053</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Al-induced protein</p>
                     </c>
                     <c ca="left">
                        <p>711</p>
                     </c>
                     <c ca="left">
                        <p>Taylor <it>et al</it>. 1997 <abbrgrp><abbr bid="B52">52</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT399</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619054" ext-link-type="gen">FJ619054</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Avr9/cf-9 rapidly elicited (<it>JcACRE</it>) gene</p>
                     </c>
                     <c ca="left">
                        <p>231</p>
                     </c>
                     <c ca="left">
                        <p>Rowland <it>et al</it>. 2005 <abbrgrp><abbr bid="B53">53</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT354</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619055" ext-link-type="gen">FJ619055</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>60S ribosomal protein L39</p>
                     </c>
                     <c ca="left">
                        <p>156</p>
                     </c>
                     <c ca="left">
                        <p>Carroll <it>et al</it>. 2008 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT370</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619056" ext-link-type="gen">FJ619056</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Ribosomal protein L37</p>
                     </c>
                     <c ca="left">
                        <p>291</p>
                     </c>
                     <c ca="left">
                        <p>Carroll <it>et al</it>. 2008 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT381</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ619057" ext-link-type="gen">FJ619057</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Ribosomal protein L15</p>
                     </c>
                     <c ca="left">
                        <p>729</p>
                     </c>
                     <c ca="left">
                        <p>Carroll <it>et al</it>. 2008 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT413</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ623457" ext-link-type="gen">FJ623457</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>40S ribosomal protein S15</p>
                     </c>
                     <c ca="left">
                        <p>456</p>
                     </c>
                     <c ca="left">
                        <p>Carroll <it>et al</it>. 2008 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT461</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ623458" ext-link-type="gen">FJ623458</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>40S ribosomal S18</p>
                     </c>
                     <c ca="left">
                        <p>459</p>
                     </c>
                     <c ca="left">
                        <p>Van Lijsebetkens <it>et al</it>. 1994 <abbrgrp><abbr bid="B54">54</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT512</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ623459" ext-link-type="gen">FJ623459</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor</p>
                     </c>
                     <c ca="left">
                        <p>306</p>
                     </c>
                     <c ca="left">
                        <p>Lin <it>et al</it>. 2005 <abbrgrp><abbr bid="B55">55</abbr></abbrgrp></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32.</p>
                     </c>
                     <c ca="left">
                        <p>JcRHDYT591</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-id="FJ623460" ext-link-type="gen">FJ623460</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Low-molecular weight cysteine rich 69</p>
                     </c>
                     <c ca="left">
                        <p>234</p>
                     </c>
                     <c ca="left">
                        <p>Vanoosthuyse <it>et al</it>. 2001 <abbrgrp><abbr bid="B56">56</abbr></abbrgrp></p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*Sequence ortholog with previous reports to abiotic stress tolerance have been marked with references in the table.</p>
               </tblfn>
            </tbl>
            <p>To understand the possible role of the genes and regulatory pathway for abiotic stress tolerance in <it>J. curcas</it>, we assigned functional classes for the gene sequences recovered in the present study. Comparison of functional annotation for several of the sequences obtained from plasmid rescue indicated a possible role in tolerance to abiotic stress. Some of the sequence orthologs of these genes have been reported to be involved in conferring stress tolerance in other plant species. We find among the list of known functions sequence classes mechanistically involved in abiotic stress tolerance due to wounding, response to cellular redox or oxidative damage, and modulation of cell physiology in response to stresses. For example, previous investigations indicate the involvement of metallothioneins <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>, thioredoxins, cellular redox machinery <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp> and factors involved in the regulation of protein translation <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> to be associated with stress resistance in rice and <it>Arabidopsis</it>. Among gene sequences listed in Table <tblr tid="T1">1</tblr>, the most notable examples with implied roles in stress tolerance are discussed below: we isolated a sequence ortholog corresponding to allene oxide cyclase. Sequences of allene oxide cyclase, isolated from mangrove have been reported to confer salinity stress tolerance in multiple organisms <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Previous research data also indicate that accumulation of late embryogenesis abundant protein (<it>LEA-5</it>) transcripts in response to stress conditions such as cold, drought, UV light, salinity and wounding <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. In this report, we isolated <it>J. curcas LEA-5 </it>like sequences, suggesting a conservation in stress response pathway. Additionally, we identified genes encoding major allergen <it>Pru ar1</it>-like proteins, defensin and protease inhibitor/seed storage/lipid transfer protein family reported to get up-regulated upon pathogen attack and/or environmental stimuli <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. Plants have been known to have specific mechanism for detoxification of reactive oxygen species (ROS) induced in stress response which includes activation expression of antioxidant enzymes such as cytosolic ascorbate peroxidase-1 (<it>Apx1</it>). Experiments involving over-expression of <it>Apx-1 </it>in transgenic tobacco, conferred enhanced tolerance to salt and water stress, by effectively detoxifying accumulated H<sub>2</sub>O<sub>2 </sub>in the chloroplasts <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Mitochondrial ATP synthase 6 KD subunit (<it>MtATP6</it>) is reported to be involved in NaHCO<sub>3 </sub>induced stress, whose over-expression in tobacco led to greater salt stress tolerance <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Al-induced protein and copper chaperone have been implicated to provide protection to cellular function during cytotoxic reactions caused by metal ions <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. We identified <it>J. curcas </it>sequence ortholog of a profilin. Profilins have previously been implicated in root elongation and root hair system, a response that is directly linked to response of plants to adapt and source water during drought resistance <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. The high frequency of occurrence of functionally conserved genetic components indicates a possible conservation in some of the genetic pathways and/or the genes regulating salinity and drought stress among diverse plants <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The fact that some of these factors are conserved suggests that certain aspects of mechanism of salt and water deficit stress sensing and response may be evolutionarily conserved among diverse taxa.</p>
         </sec>
         <sec>
            <st>
               <p>Gene-expression analysis of selected <it>J. curcas </it>sequences involved in salinity stress tolerance using semi-quantitative RT-PCR</p>
            </st>
            <p>To understand and correlate the gene expression pattern of selected genes to functional roles in stress determination, we performed gene expression analysis in leaf and root tissues of <it>J. curcas</it>. In the present study, we selected five genes i.e., late embryogenesis abundant protein 5 (<it>LEA-5</it>), cytosolic ascorbate peroxidase (<it>Apx-1</it>), metallothionein, profilin and annexin, based on the diverse functional classes and varied mechanisms implicated in stress avoidance/tolerance pathways in model plants. While our functional screen has been designed to identify functional genes to abiotic stress tolerance, rather than rely on changes in gene expression; several reports have correlated changes in gene expression to possible gene functions mediating stress tolerance <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. To correlate gene function and gene-expression status for each of the genes, semi-quantitative RT-PCR analysis was conducted. We assayed for changes in transcript abundance for each of the genes that have been normalized to actin, in both leaf and root tissue, that were either control treated or salt stressed, before sampling at various time-intervals (see Methods). Changes in expression for each transcript normalized to actin have been plotted in Figure <figr fid="F6">6</figr> and Figure <figr fid="F7">7</figr>.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Semi-quantitative RT-PCR analysis of expression of five different genes in leaf tissue after treating <it>J. curcas </it>seedlings with 150 mM NaCl</p>
               </caption>
               <text>
                  <p><b>Semi-quantitative RT-PCR analysis of expression of five different genes in leaf tissue after treating <it>J. curcas </it>seedlings with 150 mM NaCl</b>. <it>Apx-1</it>, cytosolic ascorbate peroxidase -1; <it>Mth</it>, metallothionein; <it>LEA-5</it>, late embryogenesis abundant protein-5. Bars represent S.E. of mean (<it>n </it>value is 3).</p>
               </text>
               <graphic file="1472-6750-10-23-6" hint_layout="single"/>
            </fig>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Semi-quantitative RT-PCR analysis of expression of five different genes in root tissue after treating <it>J. curcas </it>seedlings with 150 mM NaCl</p>
               </caption>
               <text>
                  <p><b>Semi-quantitative RT-PCR analysis of expression of five different genes in root tissue after treating <it>J. curcas </it>seedlings with 150 mM NaCl</b>. <it>Apx-1</it>, cytosolic ascorbate peroxidase -1; <it>Mth</it>, metallothionein; <it>LEA-5</it>, late embryogenesis abundant protein-5. Bars represent S.E. of mean (<it>n </it>value is 3).</p>
               </text>
               <graphic file="1472-6750-10-23-7" hint_layout="single"/>
            </fig>
            <p>Analysis of the gene-expression data suggests dynamic changes in the transcript abundance of these genes, with changes in transcript level being apparent from 2 h time-point, indicating an early regulation of the genes in response to salt stress. Gene expression of the normalized transcripts suggests both up-regulation as well as repression of the transcripts. We noted increased expression of profilin in root tissue between 2 h to 8 h time-points of exposure to 150 mM salt stress; whereas profilin was repressed in leaves (Figure <figr fid="F7">7</figr> vs. Figure <figr fid="F6">6</figr>) consistent with previously reported function during salt stress <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. In contrast, we observed an initial repression in the expression of annexin that was subsequently induced in the root-tissue, while the expression was down-regulated upon salt-stress in the leaves (Figure <figr fid="F6">6</figr> vs. Figure <figr fid="F7">7</figr>). Transcript abundance in the levels of <it>Apx-1 </it>and metallothioneins were down-regulated in roots, while a more dynamic expression pattern was observed in the leaf tissues, implicating a role in stress adaptive responses <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Among the transcripts we profiled in this study, only <it>LEA-5 </it>was up-regulated in leaves at the 8 h time interval, after initial down-regulation at the 2 h time-point; while in roots <it>LEA-5 </it>expression was unaffected by salt stress. Such an induction of <it>LEA-5 </it>in leaf-tissue demonstrated either a longer range signal or the terminal effects of long exposure to ions by the roots. Further experiments are required to de-lineate these effects. The gene-expression data, indirectly suggests varied modes of gene-regulation between the leaf and root tissue (Compare Figure <figr fid="F6">6</figr> to Figure <figr fid="F7">7</figr>). The data indicates a complex framework for gene regulation during adaptation to salt stress in different tissues. The data in conjunction with gene function may help unravel certain aspects of plant abiotic stress response.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The approach described in the report provides a rapid and universal assay system for large scale screening of genes for varied abiotic stress tolerance within a short span of time. Using the above screening strategy, we could isolate genes with previously known function in stress tolerance and novel sequences with unknown function in salt stress tolerance from <it>J. curcas</it>. The semi-quantitative RT-PCR expression analysis of selected genes revealed differential expression in leaves and roots in response to salt stress. The isolated genes could be over-expressed using plant expression system to generate and evaluate transgenic plants for stress tolerance as well as be used as markers for breeding salt stress tolerance in plants. With minor modification, the functional screening methodology reported in the present study may be extended to isolate plant genes that confer tolerance to a diverse array of possible abiotic stresses. The stress conditions that can be screened with this assay include a) pH stress (due to acidic or basic conditions) b) oxidative stresses c) unfavorable temperature d) heavy metal and e) DNA damage/radiation (by exposure to UV, chemicals that induce DNA breakage).</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Plant material</p>
            </st>
            <p>Seeds of <it>J. curcas </it>(S003) were collected from Reliance Life Sciences' agricultural farm at Kakinada, South of Andhra Pradesh, India. Seed coats were removed from the seeds, surface sterilized with 70% ethanol followed by 5% hypochloride solution prior to being placed onto MS basal salts <abbrgrp><abbr bid="B34">34</abbr></abbrgrp> distributed into 150-mm culture tubes. MS basal salts supplemented with 3% sucrose and solidified with 0.8% agar (Hi-Media, India) were used to grow seeds. The cultures were maintained at 23-25&#176;C at 50-60% RH, under long day conditions as described previously <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Stress treatment and sample collection</p>
            </st>
            <p>Young 3-4 week-old <it>in vitro </it>germinated <it>J. curcas </it>seedlings were removed from the media and randomly separated into groups of 15-20 plantlets. Roots (both main and lateral roots) of these plants were either placed in sterile water or into 150 mM NaCl solution for 2 h. The treated <it>Jatropha </it>root tissue from plants that were untreated or treated were dissected and frozen in liquid nitrogen, prior to being stored at -80&#176;C.</p>
         </sec>
         <sec>
            <st>
               <p>Total RNA isolation</p>
            </st>
            <p><it>J. curcas </it>root samples control treated or challenged with 150 mM NaCl were used to generate pools of cDNA. Total RNA for cDNA synthesis was extracted from <it>J. curcas </it>root samples using Qiagen RNA Miniprep Kit (Qiagen, Germany). Briefly, the root tissue samples were homogenized to a fine powder in liquid nitrogen and total RNA was extracted as described in the Plant mini RNA prep kit (Qiagen, Germany). Total RNA was estimated spectrophotometrically using Nanodrop.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of cDNA and expression libraries</p>
            </st>
            <p>To prepare poly (A+) mRNA pools suitable for cDNA synthesis, 10 &#956;g total RNA was treated with RNAase free DNAaseI (Sigma-Aldrich, St Louis, USA) for 15-20 min at 37&#176;C, and mRNA fraction was enriched using oligo-d(T) beads (Oligotex, Qiagen, Germany). First strand cDNA pools were synthesized from normalized amounts of RNA either derived from untreated root tissue or from tissue challenged with salt stress, using PowerScript reverse transcriptase (Takara, CloneTech) as described in the Super SMART cDNA synthesis Kit <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Double stranded DNA was generated through PCR amplification using conditions described in Table <tblr tid="T2">2</tblr><abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. The cDNA pools were size separated using NucleoSpin columns (BD CloneTech, USA). The yield and quality of the amplicons were monitored on agarose gel analysis. A profile of amplification patterns obtained after 22 and 25 cycles of PCR amplifications as described in the Super SMART cDNA synthesis Kit <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B36">36</abbr></abbrgrp> is shown in Figure <figr fid="F8">8</figr>. A schematic diagram elaborating the construction of <it>Jatropha </it>root cDNA libraries is outlined (see additional file <supplr sid="S2">2</supplr>:-process flow).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>PCR cycling conditions and primer information used for double stranded cDNA generation and colony PCR analysis, as described in SMART cDNA Library Construction Kit <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Process</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Cycling Conditions</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Primer information</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>cDNA synthesis</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>95&#176;C - 2 min</p>
                        <p>&#8595;</p>
                        <p>95&#176;C - 30 sec</p>
                        <p>65&#176;C - 30 sec</p>
                        <p>68&#176;C - 4 min</p>
                        <p>repeated 18-24 cycles</p>
                        <p>&#8595;</p>
                        <p>68&#176;C - 15 min</p>
                        <p>Hold at 4&#176;C</p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>SMART IV&#8482; Oligonucleotide (10 &#956;M)</b>
                        </p>
                        <p>5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'</p>
                        <p>
                           <b>CDS III/3' PCR Primer (10 &#956;M)</b>
                        </p>
                        <p>5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)<sub>30</sub>N-1N-3'</p>
                        <p>
                           <b>5' PCR Primer (10 &#956;M)</b>
                        </p>
                        <p>5'AAGCAGTGGTATCAACG CAGAGT-3'</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Colony PCR</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>95&#176;C - 5 min</p>
                        <p>&#8595;</p>
                        <p>95&#176;C - 30 sec</p>
                        <p>55&#176;C - 30 sec</p>
                        <p>72&#176;C - 3 min</p>
                        <p>repeated 29 cycles</p>
                        <p>&#8595;</p>
                        <p>72&#176;C - 5 min</p>
                        <p>Hold at 4&#176;C</p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>
                           <b>Forward Primer: <it>Gal 1</it></b>
                        </p>
                        <p>5'-AATATACCTCTATACTTTAACGTC-3'</p>
                        <p>
                           <b>Reverse Primer: V5/6XHIS</b>
                        </p>
                        <p>5'-ACCGAGGAGAGGGTTAGGGAT-3'</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>Amplicons obtained from <it>J. curcas </it>L. root tissue</p>
               </caption>
               <text>
                  <p><b>Amplicons obtained from <it>J. curcas </it>L. root tissue</b>. Gel analysis of amplicons after amplification of double-stranded cDNA library pools as described in the SUPER SMART cDNA construction kit. Yield and distribution of cDNA sizes after 22 or 25 cycles of PCR amplification (as described in Table 2), for double-stranded cDNA prepared from various root RNA pools (marked in the legend) have been shown. Amplicon size distributions ranged from 0.5 to >5.0 kb.</p>
               </text>
               <graphic file="1472-6750-10-23-8" hint_layout="single"/>
            </fig>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Process flow</b>. Process flow of genetic screen: Outline of the process to identify and isolate specific genes from <it>J. curcas </it>involved in abiotic stress responses using yeast functional genetic screen.</p>
               </text>
               <file name="1472-6750-10-23-S2.PPT">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Screening for saline tolerant yeast strain and isolation of <it>shs </it>mutants</p>
            </st>
            <p>To identify and define the condition that lead to salt stress to wild-type yeast BY4741 (See additional file <supplr sid="S3">3</supplr>: genotype details) (yeast strain obtained from EUROSCARF, Germany), we measured relative growth of yeast (YPD media 2% Peptone, 1% Yeast extract, 2% Dextrose, solidified with 1.5% Agar, Hi-Media, Mumbai, India) under a range of salinity stress, from 0.0 mM NaCl to 2.0 M NaCl. Salt-hyper-sensitive mutants were isolated through UV induced random mutagenesis and selected on salt containing plates by replica-plating.</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p><b>Genotype details</b>. Strain details of genotype of yeast, <it>Saccharomyces cerevisiae </it>used in the screen.</p>
               </text>
               <file name="1472-6750-10-23-S3.DOC">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Yeast functional screening</p>
            </st>
            <p>To express the cDNA libraries in yeast, the cDNA library amplicons were cloned into a yeast expression vector, pYES 2.1 TOPO TA (Invitrogen, Carlsbad, USA). The pYES 2.1 TOPO TA is a <it>E. coli</it>-<it>Yeast </it>shuttle vector <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, propagated in <it>E. coli </it>using bacterial selection marker for Amp<sup>r</sup>; while the transformants in the yeast BY4741 strain background are selected for the <it>URA3 </it>marker. Cloning of gene of interest downstream of the <it>GAL1 </it>promoter allows regulated gene expression of the library in yeast (Invitrogen, Carlsbad, USA). The <it>J. curcas </it>root cDNA libraries in pYES 2.1 TOPO TA were transformed into <it>E. coli </it>TOP 10F' (Invitrogen, Carlsbad, USA). Subsequently, the cDNA library were recovered from the plates and plasmid DNA representing the pooled libraries, derived from <it>J. curcas </it>root cDNA was extracted using Plasmid Midi preparation Kit (Qiagen, Germany).</p>
         </sec>
         <sec>
            <st>
               <p>Plasmid transformation of yeast</p>
            </st>
            <p>Plasmid transformation of yeast (<it>Saccharomyces cerevisiae</it>) was accomplished using PEG-lithium acetate based transformation protocols <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, while the plasmid selection in yeast was based on the <it>URA3 </it>marker borne on the yeast expression plasmid pYES2.1 TOPO TA (Invitrogen, Carlsbad, USA). Amplified plasmids containing cloned inserts derived from <it>J. curcas</it>, regulated by the galactose-inducible <it>GAL1 </it>promoter, were transformed into wild-type yeast strain BY4741; following heat-shock at 15 min at 42&#176;C, the yeast cells were revived in YPD media and plated on synthetic minimal medium plates lacking uracil (see additional file <supplr sid="S4">4</supplr>: stock composition), and placed at 23-25&#176;C for 48-96 h.</p>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p><b>Stock composition</b>. Stock compositions used in synthetic media</p>
               </text>
               <file name="1472-6750-10-23-S4.DOC">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Replica printing</p>
            </st>
            <p>The yeast (BY4741) containing <it>J. curcas </it>root cDNA library clones, in <it>GAL1 </it>regulated yeast expression systemwere screened for salinity and drought resistance. Twenty thousand yeast transformants were picked and inoculated into sterile 96 well U-bottom microtitre plates (Nunc, USA) containing synthetic selection media (see additional file <supplr sid="S5">5</supplr>: composition of synthetic selection media). Subsequently, the individual yeast transformants were replica printed on quadruplet selection plates containing either 0 mM NaCl or 750 mM NaCl using a 96-pin replicator (Nunc, USA)(Figure <figr fid="F3">3</figr>). Under these screening conditions each individual yeast transformant (arrayed from 96-well plates) was tested for its ability to grow under four conditions described earlier. The <it>J. curcas </it>cDNA expression in yeast could be regulated by the yeast <it>GAL1 </it>system <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>.</p>
            <suppl id="S5">
               <title>
                  <p>Additional file 5</p>
               </title>
               <text>
                  <p><b>Composition of synthetic selection media used in the functional screen</b>. Composition of synthetic selection media used in the functional screen</p>
               </text>
               <file name="1472-6750-10-23-S5.DOC">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Back transformation to <it>E. coli</it></p>
            </st>
            <p>Isolated yeast transformants were grown on synthetic selection media containing 2% dextrose without salt (see additional file <supplr sid="S5">5</supplr>: composition of synthetic selection media) for 36-72 h. The transformants were lysed with 10 U/&#956;l lyticase (Sigma-Aldrich, St Louis, USA) and 2-4% SDS. Nucleic acid fraction recovered from yeast were purified with two sequential rounds of phenol:chloroform:isoamyl alcohol (25:24:1) extraction, followed by ethanol precipitation of nucleic acids. To analyze the inserts cloned in the pYES2.1 TOPO TA based yeast expression plasmid, nucleic acid preparations recovered from individual yeast transformants showing resistance to salinity stress were backtransformed into <it>E. coli </it>via electroporation (GenePulser II, BioRad, USA) <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Colony PCR and Plasmid DNA preparation</p>
            </st>
            <p><it>E. coli </it>backtransformants for yeast expression plasmids were analyzed for inserts by colony PCR analysis with the <it>GAL1 </it>and <it>V5/6XHIS </it>primers as described in the pYES2.1 TOPO TA kit (Invitrogen, Carlsbad, USA). The conditions for colony PCR analysis were provided in Table <tblr tid="T2">2</tblr>. <it>E. coli </it>re-transformants (representing the yeast plasmid expression vector containing <it>Jatropha </it>cDNA) were grown and plasmid DNA extracted as described in Qiagen plasmid miniprep kit (Qiagen, Germany).</p>
         </sec>
         <sec>
            <st>
               <p>Sequencing</p>
            </st>
            <p>Sequencing of <it>Jatropha </it>cDNA conferring salinity tolerance was performed as described with BigDye Sequencing Kit (ABI, USA), and analyzed on Genetic Analyzer (ABI 3100, USA). Sequencing reaction was with vector specific <it>GAL1 </it>and <it>V5/6XHIS </it>primers</p>
         </sec>
         <sec>
            <st>
               <p>Computer analyses and annotation</p>
            </st>
            <p>Prior to annotation, the sequences were subjected to quality check and vector masking using NCBI's UniVec <url>http://www.ncbi.nlm.nih.gov/blast/</url>. To understand and assign functional classes to the sequence information determined in this screen, we performed computational searches against sequence databases at NCBI <url>http://www.ncbi.nlm.nih.gov/blast/</url> and TIGR plant transcript assemblies <url>http://tigrblast.tigr.org/euk-blast/plantta_blast.cgi</url> using the BLAST algorithm <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B40">40</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Evaluation of transformants in hyper-salt sensitive mutant</p>
            </st>
            <p>Plasmid transformation of yeast hyper-salt sensitive mutant (<it>shs-2</it>) with five selected genes viz., <it>LEA 5</it>, mitochondrial ATP synthase 6 KD subunit, cytosolic ascorbate peroxidase, metallothionein and profilin was done as mentioned earlier. Single colony of each transformants and mutant strain was dissolved in 100 &#956;l sterile water. YPD media containing range of NaCl concentrations (0 mM, 250 mM, 500 mM, 750 mM and 1 M) were prepared in Petri dishes. Each Petri plate was divided into six sectors. 10 &#956;l of each yeast transformants and the mutant strain were patched on the salt series plates uniformly and incubated overnight at 30&#176;C incubator. Survival of transformants was scored against hyper-salt sensitive mutant strain.</p>
         </sec>
         <sec>
            <st>
               <p>Semi-quantitative RT-PCR expression analysis of selected genes</p>
            </st>
            <p>The semi-quantitative RT-PCR expression of selected genes was performed with specific oligonucleotide primers (Table <tblr tid="T3">3</tblr>) on first strand cDNA synthesised from RNA isolated from root and leaf tissues samples of 21-day-old <it>J. curcas </it>seedlings. The total RNA was extracted from the 150 mM salt treated leaves and roots at different durations of 0 h, 2 h and 8 h as described in the Plant mini RNA prep kit (Qiagen, Germany). The total RNA was estimated spectrophotometrically at 230, 260 and 280 nm (Nanodrop). Eight hundred ng of total RNA was taken to synthesize the first strand cDNA with oligodT using Superscript reverse transcriptase (Invitrogen) as per manufacturer's protocol. For PCR, 1 &#956;L of cDNA was used as DNA template in a reaction volume of 50 &#956;L using PCR master mix (Lucigene) with cycling conditions of 95&#176;C for 5 min, 95&#176;C for 1 min, 60&#176;C for 1 min, 72&#176;C for 1 min. The amplification reaction was carried out for 32 cycles for all genes with a final extension at 72&#176;C for 10 min. <it>J. curcas </it>actin gene was used as an internal control for analysis of gene expression. RT-PCR analyses were carried out with three independent total RNA samples.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>List of forward and reverse primers used for semi-quantitative RT-PCR.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p><b>Name of Gene</b>*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Forward primer</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reverse primer</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>LEA-5</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5' ATGGCTCGCCCTTTCTCAAACG 3'</p>
                     </c>
                     <c ca="left">
                        <p>5' TCAGTTTTTCTTCAGAAGCATAGCTCTTAATTCGG 3'</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Apx-1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5'ATGGCTAAGAACTATCCAAAAGTAAGC</p>
                        <p>GAAGAGTA3'</p>
                     </c>
                     <c ca="left">
                        <p>5' TTAGGCATCAGCAAATCCCAGCTCTG3'</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Metallothionein</p>
                     </c>
                     <c ca="left">
                        <p>5' ATGTCTTGCTGCGGAGGAAACTG 3'</p>
                     </c>
                     <c ca="left">
                        <p>5' CACACGACAGGGTTTGAGAAGGTAC 3'</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Profilin</p>
                     </c>
                     <c ca="left">
                        <p>5' ATGTCGTGGCAAACATACGTAGATGAGC 3'</p>
                     </c>
                     <c ca="left">
                        <p>5' CCAAGCCTTTCGACAATCATGTTGC 3'</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Annexin</p>
                     </c>
                     <c ca="left">
                        <p>5' ATGGCTACCATTGTTGTTCCTGCC 3'</p>
                     </c>
                     <c ca="left">
                        <p>5' AGCTGTGTCTTGCTCCTTGTAGTGAG 3'</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*<it>LEA-5</it>, late embryogenesis abundant protein-5; <it>Apx-1</it>, cytosolic ascorbate peroxidase -1.</p>
               </tblfn>
            </tbl>
            <p>Quantitation of RT-PCR product was determined by densitometer. Two &#956;l of RT-PCR products derived from target gene and actin gene were resolved on 2%agarose gels stained with ethidiumbromide. Densitometeric scan analysis was carried out using Kodak MI Imaging software program as per the supplier's instructions. Percent gene expression was determined by normalizing values against internal control actin. Values were represented as per cent of gene expression with respect to corresponding controls and plotted using Microsoft Excel.</p>
         </sec>
         <sec>
            <st>
               <p>Accession Numbers</p>
            </st>
            <p>Sequence data from this article can be found in the GenBank data libraries under accession numbers <ext-link ext-link-id="FJ489601" ext-link-type="gen">FJ489601</ext-link>-<ext-link ext-link-id="FJ489611" ext-link-type="gen">FJ489611</ext-link>, <ext-link ext-link-id="FJ619041" ext-link-type="gen">FJ619041</ext-link>-<ext-link ext-link-id="FJ619057" ext-link-type="gen">FJ619057</ext-link> and <ext-link ext-link-id="FJ623457" ext-link-type="gen">FJ623457</ext-link>-<ext-link ext-link-id="FJ623460" ext-link-type="gen">FJ623460</ext-link>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>NE carried out the functional screen studies, sequence analysis and helped in drafting the figures and tables. BS assisted in the functional screen and sequence analysis. BA assisted in the functional screen. SP conceived the study, participated in its design and helped in drafting the manuscript. RKK carried out semi-quantitative RT-PCR expression analysis along with NE. TSJ coordinated the whole project and drafted the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors are thankful to Dr. Dhananjaya Saranath of Molecular Medicine Group of Reliance Life Sciences for DNA sequencing. The authors gratefully acknowledge the encouragement and support of Reliance Life Sciences Pvt. Ltd. in carrying out the research work.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Plant productivity and environment</p>
            </title>
            <aug>
               <au>
                  <snm>Bayer</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1982</pubdate>
            <volume>218</volume>
            <fpage>443</fpage>
            <lpage>448</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.218.4571.443</pubid>
                  <pubid idtype="pmpid" link="fulltext">17808529</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Deciphering the regulatory mechanisms of abiotic stress tolerance in plants by genomic approaches</p>
            </title>
            <aug>
               <au>
                  <snm>Sreenivasulu</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sopory</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Kavi Kishor</snm>
                  <fnm>PB</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>2007</pubdate>
            <volume>388</volume>
            <fpage>1</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.gene.2006.10.009</pubid>
                  <pubid idtype="pmpid" link="fulltext">17134853</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Microbial models and salt stress tolerance in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Serrano</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gaxiola</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>CRC Crit Rev Plant Sci</source>
            <pubdate>1994</pubdate>
            <volume>13</volume>
            <fpage>121</fpage>
            <lpage>138</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1080/713608057</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Identification of salt tolerance genes from the mangrove plant <it>Bruguiera gymnorhiza </it>using <it>Agrobacterium </it>functional screening</p>
            </title>
            <aug>
               <au>
                  <snm>Ezawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tada</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Plant</source>
            <pubdate>2009</pubdate>
            <volume>176</volume>
            <fpage>272</fpage>
            <lpage>278</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.plantsci.2008.11.005</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The translation initiation factor eIF1A is an important determinant in the tolerance to NaCl stress in yeast and plants</p>
            </title>
            <aug>
               <au>
                  <snm>Rausell</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kanhonou</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Yenush</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Serrano</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ros</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Plant J</source>
            <pubdate>2003</pubdate>
            <volume>34</volume>
            <fpage>257</fpage>
            <lpage>267</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-313X.2003.01719.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12713533</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>A novel family of cys-rich membrane proteins mediates cadmium resistance in <it>Arabidopsis </it></p>
            </title>
            <aug>
               <au>
                  <snm>Song</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Martinoia</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>D-Y</fnm>
               </au>
               <au>
                  <snm>Vogt</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Shim</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Choi</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Hwang</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2004</pubdate>
            <volume>135</volume>
            <fpage>1027</fpage>
            <lpage>1039</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.103.037739</pubid>
                  <pubid idtype="pmcid">514137</pubid>
                  <pubid idtype="pmpid" link="fulltext">15181212</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Stress inducible expression of the <it>DREB1A </it>transcription factor from <it>xeric</it>, <it>Hordeum spontaneum L</it>. in turf and forage grass (<it>Paspalum notatum Flugge</it>) enhances abiotic stress tolerance</p>
            </title>
            <aug>
               <au>
                  <snm>James</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Neibaur</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Altpeter</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Transgenic Res</source>
            <pubdate>2008</pubdate>
            <volume>17</volume>
            <fpage>93</fpage>
            <lpage>104</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s11248-007-9086-y</pubid>
                  <pubid idtype="pmpid" link="fulltext">17415675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>T-DNA tagged knockout mutation of rice <it>OsGSK1</it>, an orthologue of <it>Arabidopsis BIN2</it>, with enhanced tolerance to various abiotic stresses</p>
            </title>
            <aug>
               <au>
                  <snm>Koh</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>S-C</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>M-K</fnm>
               </au>
               <au>
                  <snm>Koh</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>An</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Choe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>S-R</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2007</pubdate>
            <volume>65</volume>
            <fpage>453</fpage>
            <lpage>466</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s11103-007-9213-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">17690841</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Microarray analysis of transcriptional responses to abscisic acid and osmotic, salt, and drought stress in the moss, <it>Physcomitrella patens </it></p>
            </title>
            <aug>
               <au>
                  <snm>Cuming</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Cho</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Kamisugi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Quatrano</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>New Phytol</source>
            <pubdate>2007</pubdate>
            <volume>176</volume>
            <fpage>275</fpage>
            <lpage>287</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-8137.2007.02187.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17696978</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Identification of stress-tolerance-related transcription-factor genes via mini-scale Full-length cDNA Over-eXpressor (FOX) gene hunting system</p>
            </title>
            <aug>
               <au>
                  <snm>Fujita</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mizukado</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fujita</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ichikawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nakazawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Seki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Matsui</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yamaguchi-Shinozaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shinozaki</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2007</pubdate>
            <volume>364</volume>
            <fpage>250</fpage>
            <lpage>257</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2007.09.124</pubid>
                  <pubid idtype="pmpid" link="fulltext">17937930</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Engineering drought and salinity tolerance in plants: lessons from genome-wide expression profiling in <it>Arabidopsis.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Denby</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Gehring</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Trends</source>
            <pubdate>2005</pubdate>
            <volume>23</volume>
            <fpage>547</fpage>
            <lpage>552</lpage>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Occurrence of vivipary in <it>Jatropha curcas </it></p>
            </title>
            <aug>
               <au>
                  <snm>Deore</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Curr Sci</source>
            <pubdate>2008</pubdate>
            <volume>95</volume>
            <fpage>321</fpage>
            <lpage>322</lpage>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Effect of biosludge and biofertilizer amendment on growth of <it>Jatropha curcas </it>in heavy metal contaminated soils</p>
            </title>
            <aug>
               <au>
                  <snm>Juwarkar</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Yadav</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Kumar</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Singh</snm>
                  <fnm>SK</fnm>
               </au>
            </aug>
            <source>Environ Monit Assess</source>
            <pubdate>2008</pubdate>
            <volume>145</volume>
            <fpage>7</fpage>
            <lpage>15</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10661-007-0012-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">17973198</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Lipase-mediated conversion of vegetable oils into biodiesel using ethyl acetate as acyl acceptor</p>
            </title>
            <aug>
               <au>
                  <snm>Modi</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Reddy</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>BV</fnm>
               </au>
               <au>
                  <snm>Prasad</snm>
                  <fnm>RB</fnm>
               </au>
            </aug>
            <source>Bioresour Technol</source>
            <pubdate>2007</pubdate>
            <volume>98</volume>
            <fpage>1260</fpage>
            <lpage>1264</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.biortech.2006.05.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">16822671</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Transcriptional regulation in the yeast <it>GAL </it>gene family: a complex genetic network</p>
            </title>
            <aug>
               <au>
                  <snm>Lohr</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Venkov</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zlatanova</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Faseb J</source>
            <pubdate>1995</pubdate>
            <volume>9</volume>
            <fpage>777</fpage>
            <lpage>787</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7601342</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>New shuttle vectors for direct cloning in <it>Saccharomyces cerevisiae.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Silar</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thiele</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>1991</pubdate>
            <volume>104</volume>
            <fpage>99</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0378-1119(91)90472-N</pubid>
                  <pubid idtype="pmpid" link="fulltext">1916284</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Identification of a mitochondrial ATP synthase small subunit gene (<it>RMtATP6</it>) expressed in response to salts and osmotic stresses in rice (<it>Oryza sativa </it>L.)</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Takano</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Exp Bot</source>
            <pubdate>2006</pubdate>
            <volume>57</volume>
            <fpage>193</fpage>
            <lpage>200</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jxb/erj025</pubid>
                  <pubid idtype="pmpid" link="fulltext">16317034</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>SMART cDNA Library synthesis Kit</p>
            </title>
            <source>Clontechniques</source>
            <pubdate>1998</pubdate>
            <volume>XIII</volume>
            <fpage>12</fpage>
            <lpage>13</lpage>
         </bibl>
         <bibl id="B19">
            <title>
               <p>The <it>Arabidopsis </it>root transcriptome by Serial Analysis of Gene Expression. Gene identification using the genome sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Fizames</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mu&#241;os</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cazettes</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Nacry</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Boucherez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gaymard</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Piquemal</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Delorme</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Commes</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Doumas</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cooke</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Marti</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sentenac</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gojon</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2004</pubdate>
            <volume>134</volume>
            <fpage>67</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.103.030536</pubid>
                  <pubid idtype="pmcid">316288</pubid>
                  <pubid idtype="pmpid" link="fulltext">14730065</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The maize root transcriptome by serial analysis of gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Poroyko</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Hejlek</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Spollen</snm>
                  <fnm>WG</fnm>
               </au>
               <au>
                  <snm>Springer</snm>
                  <fnm>GK</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>HT</fnm>
               </au>
               <au>
                  <snm>Sharp</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Bohnert</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2005</pubdate>
            <volume>138</volume>
            <fpage>1700</fpage>
            <lpage>1710</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.104.057638</pubid>
                  <pubid idtype="pmcid">1176439</pubid>
                  <pubid idtype="pmpid" link="fulltext">15965024</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Genome size, base composition and karyotype of <it>Jatropha curcas </it>L., an important biofuel plant</p>
            </title>
            <aug>
               <au>
                  <snm>Carvalho</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Clarindo</snm>
                  <fnm>WR</fnm>
               </au>
               <au>
                  <snm>Prac</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Arau' jo</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Carels</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Plant Sci</source>
            <pubdate>2008</pubdate>
            <volume>174</volume>
            <fpage>613</fpage>
            <lpage>617</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.plantsci.2008.03.010</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Isolation of YAC ends by plasmid rescue</p>
            </title>
            <aug>
               <au>
                  <snm>Bates</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Methods Mol Biol</source>
            <pubdate>1996</pubdate>
            <volume>54</volume>
            <fpage>139</fpage>
            <lpage>144</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8597786</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Basic local alignment search tool</p>
            </title>
            <aug>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Gish</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1990</pubdate>
            <volume>215</volume>
            <fpage>403</fpage>
            <lpage>410</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2231712</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A metallothionein-like protein of rice (<it>rgMT</it>) functions in <it>E. coli </it>and its gene expression is induced by abiotic stresses</p>
            </title>
            <aug>
               <au>
                  <snm>Jin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Guan</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tetsuo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Biotechnol Lett</source>
            <pubdate>2006</pubdate>
            <volume>28</volume>
            <fpage>1749</fpage>
            <lpage>1753</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10529-006-9152-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">16912923</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Stress-dependent regulation of the gene encoding thioredoxin reductase from the fission yeast</p>
            </title>
            <aug>
               <au>
                  <snm>Hong</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>H-W</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>I-H</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>E-H</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>C-J</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>2004</pubdate>
            <volume>234</volume>
            <fpage>379</fpage>
            <lpage>385</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1574-6968.2004.tb09557.x</pubid>
                  <pubid idtype="pmpid">15135546</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A novel NADPH thioredoxin reductase, localized in the chloroplast, which deficiency causes hypersensitivity to abiotic stress in <it>Arabidopsis thaliana </it></p>
            </title>
            <aug>
               <au>
                  <snm>Serrato</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Perez-Ruiz</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Spinola</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Cejudo</snm>
                  <fnm>FJ</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>43821</fpage>
            <lpage>43827</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M404696200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15292215</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Regulated phosphorylation of 40S ribosomal protein S6 in root tips of maize</p>
            </title>
            <aug>
               <au>
                  <snm>Williams</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Werner-Fraczek</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>IF</fnm>
               </au>
               <au>
                  <snm>Bailey-Serres</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2003</pubdate>
            <volume>132</volume>
            <fpage>2086</fpage>
            <lpage>2097</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.103.022749</pubid>
                  <pubid idtype="pmcid">181292</pubid>
                  <pubid idtype="pmpid" link="fulltext">12913163</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Expression of mangrove allene oxide cyclase enhances salt tolerance in <it>Escherichia coli</it>, yeast, and tobacco cells</p>
            </title>
            <aug>
               <au>
                  <snm>Yamada</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Saitoh</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Mimura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ozeki</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Plant Cell Physiol</source>
            <pubdate>2002</pubdate>
            <volume>43</volume>
            <fpage>903</fpage>
            <lpage>910</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/pcp/pcf108</pubid>
                  <pubid idtype="pmpid" link="fulltext">12198193</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>LEA (Late Embryogenesis Abundant) proteins and their encoding genes in <it>Arabidopsis thaliana</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hundertmark</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Hincha</snm>
                  <fnm>DK</fnm>
               </au>
            </aug>
            <source>BMC Genomics</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>118</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2164-9-118</pubid>
                  <pubid idtype="pmcid">2292704</pubid>
                  <pubid idtype="pmpid" link="fulltext">18318901</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Sequence of allergen-, stress-, and pathogenesis related protein from Apricot fruit. Gene expression during fruit ripening</p>
            </title>
            <aug>
               <au>
                  <snm>Mbeguie</snm>
                  <fnm>DM-A</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>R-M</fnm>
               </au>
               <au>
                  <snm>Fils-Lycaon</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Plant Gene Register 97-180, Plant Physiol</source>
            <pubdate>1997</pubdate>
            <volume>115</volume>
            <fpage>97</fpage>
            <lpage>180</lpage>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Enhanced tolerance to salt stress and water deficit by overexpressing superoxide dismutase in tobacco (<it>Nicotiana tabacum</it>) chloroplasts</p>
            </title>
            <aug>
               <au>
                  <snm>Badawi</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Yamauchi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shimada</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Sasaki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kawano</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Plant Sci</source>
            <pubdate>2004</pubdate>
            <volume>166</volume>
            <fpage>919</fpage>
            <lpage>928</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.plantsci.2003.12.007</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Plant chaperones</p>
            </title>
            <aug>
               <au>
                  <snm>Wintz</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Vulpe</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Biochem Soc Trans</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <fpage>732</fpage>
            <lpage>735</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1042/BST0300732</pubid>
                  <pubid idtype="pmpid" link="fulltext">12196180</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Profilin plays a role in cell elongation, cell shape maintenance and flowering in <it>Arabidopsis </it></p>
            </title>
            <aug>
               <au>
                  <snm>Ramachandran</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Christensen</snm>
                  <fnm>HEM</fnm>
               </au>
               <au>
                  <snm>Ishimaru</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Dong</snm>
                  <fnm>C-H</fnm>
               </au>
               <au>
                  <snm>Chao-Ming</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Cleary</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>N-H</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2000</pubdate>
            <volume>124</volume>
            <fpage>1637</fpage>
            <lpage>1647</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.124.4.1637</pubid>
                  <pubid idtype="pmcid">59862</pubid>
                  <pubid idtype="pmpid" link="fulltext">11115881</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>A revised medium for rapid growth and bioassays with tobacco tissue cultures</p>
            </title>
            <aug>
               <au>
                  <snm>Murashige</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Skoog</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Physiol Plant</source>
            <pubdate>1962</pubdate>
            <volume>15</volume>
            <fpage>473</fpage>
            <lpage>497</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1399-3054.1962.tb08052.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>High-frequency plant regeneration from leaf-disc cultures of <it>Jatropha curcas </it>L.: an important biodiesel plant</p>
            </title>
            <aug>
               <au>
                  <snm>Deore</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Plant Biotech</source>
            <pubdate>2008</pubdate>
            <volume>2</volume>
            <fpage>7</fpage>
            <lpage>11</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s11816-008-0042-y</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Great Lengths cDNA Synthesis Kit for high yields of full-length cDNA</p>
            </title>
            <aug>
               <au>
                  <snm>Chenchik</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Diatchenko</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kuchibhatla</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Clontechniques</source>
            <pubdate>1994</pubdate>
            <volume>IX</volume>
            <fpage>9</fpage>
            <lpage>12</lpage>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Introduction of DNA into yeast cells</p>
            </title>
            <aug>
               <au>
                  <snm>Becker</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Lundblad</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Curr Protoc Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>Chapter 13</volume>
            <issue>Unit 13</issue>
            <fpage>7</fpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18265102</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Two systems of glucose repression of the <it>GAL1 </it>promoter in <it>Saccharomyces cerevisiae </it></p>
            </title>
            <aug>
               <au>
                  <snm>Flick</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Johnston</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1990</pubdate>
            <volume>10</volume>
            <fpage>4757</fpage>
            <lpage>4769</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">361077</pubid>
                  <pubid idtype="pmpid" link="fulltext">2201902</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Manipulation of plasmids from yeast cells</p>
            </title>
            <aug>
               <au>
                  <snm>Lundblad</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Curr Protoc Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>Chapter 13</volume>
            <issue>Unit 13</issue>
            <fpage>9</fpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18265104</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Identification of protein coding regions by database similarity search</p>
            </title>
            <aug>
               <au>
                  <snm>Gish</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>States</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>1993</pubdate>
            <volume>3</volume>
            <fpage>266</fpage>
            <lpage>272</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng0393-266</pubid>
                  <pubid idtype="pmpid" link="fulltext">8485583</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Cysteine proteases in nodulation and nitrogen fixation</p>
            </title>
            <aug>
               <au>
                  <snm>Sheokand</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brewin</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Ind J Exp Biol</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <fpage>1124</fpage>
            <lpage>1132</lpage>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Two cysteine proteinase inhibitors from <it>Arabidopsis thaliana</it>, <it>AtCYSa </it>and <it>AtCYSb</it>, increasing the salt, drought, oxidation and cold tolerance</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Takano</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2008</pubdate>
            <volume>68</volume>
            <fpage>131</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s11103-008-9357-x</pubid>
                  <pubid idtype="pmpid" link="fulltext">18523728</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Stress signaling through Ca2+/calmodulin-dependent protein phosphatase calcineurin mediates salt adaptation in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Pardo</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Reddy</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maggio</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Huh</snm>
                  <fnm>G-H</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Coca</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Paino-D'Urzo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Koiwa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yun</snm>
                  <fnm>D-J</fnm>
               </au>
               <au>
                  <snm>Watad</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Bressan</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>9681</fpage>
            <lpage>9686</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.95.16.9681</pubid>
                  <pubid idtype="pmcid">21399</pubid>
                  <pubid idtype="pmpid" link="fulltext">9689141</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Analysis of <it>Arabidopsis </it>cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification</p>
            </title>
            <aug>
               <au>
                  <snm>Carroll</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Heazlewood</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Ito</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Mol Cell Proteomics</source>
            <pubdate>2008</pubdate>
            <volume>7</volume>
            <fpage>347</fpage>
            <lpage>369</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17934214</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Isolation and characterization of multiple abundant lipid transfer protein isoforms in developing sesame seeds</p>
            </title>
            <aug>
               <au>
                  <snm>Choi</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Cho</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Hwang</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Hur</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Suh</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>Plant Physiol Biochem</source>
            <pubdate>2008</pubdate>
            <volume>46</volume>
            <fpage>127</fpage>
            <lpage>139</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.plaphy.2007.10.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">18037306</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Molecular characterization of a cold-induced plasma membrane protein gene from wheat</p>
            </title>
            <aug>
               <au>
                  <snm>Imai</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Koike</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sutoh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kawakami</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Torada</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oono</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Mol Gen Genomics</source>
            <pubdate>2005</pubdate>
            <volume>274</volume>
            <fpage>445</fpage>
            <lpage>453</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s00438-005-0050-3</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Caffeoyl coenzyme A O-methyltransferase down-regulation is associated with modifications in lignin and cell-wall architecture in flax secondary xylem</p>
            </title>
            <aug>
               <au>
                  <snm>Day</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Neutelings</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Nolin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Grec</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Habrant</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cr&#244;nier</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Maher</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rolando</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>David</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Chabbert</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hawkins</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Plant Physiol Biochem</source>
            <pubdate>2009</pubdate>
            <volume>47</volume>
            <fpage>9</fpage>
            <lpage>19</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.plaphy.2008.09.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">19004632</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Phosphorylation of plant eukaryotic initiation factor-2 by the plant-encoded double-stranded RNA-dependent protein kinase, pPKR, and inhibition of protein synthesis in vitro</p>
            </title>
            <aug>
               <au>
                  <snm>Langland</snm>
                  <fnm>JO</fnm>
               </au>
               <au>
                  <snm>Langland</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Browning</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Roth</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1996</pubdate>
            <volume>271</volume>
            <fpage>4539</fpage>
            <lpage>4544</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.271.8.4539</pubid>
                  <pubid idtype="pmpid" link="fulltext">8626809</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Molecular characterization of plant ubiquitin conjugation enzymes belonging to the UbcP4/E2-C/UBcx/Ubc H10 gene family</p>
            </title>
            <aug>
               <au>
                  <snm>Criqui</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>de Almeida Engler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Camasses</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Capron</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Parmentier</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Inze</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Genschik</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Plant</source>
            <pubdate>2002</pubdate>
            <volume>130</volume>
            <fpage>1230</fpage>
            <lpage>1240</lpage>
         </bibl>
         <bibl id="B50">
            <title>
               <p>A novel plant ferritin subunit from soybean that is related to a mechanism in iron release</p>
            </title>
            <aug>
               <au>
                  <snm>Masuda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Yoshihara</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2001</pubdate>
            <volume>276</volume>
            <fpage>19575</fpage>
            <lpage>19579</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M011399200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11278898</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Annexin-like protein from <it>Arabidopsis thaliana </it>rescues delta OxyR mutant of <it>E. Coli </it>from H<sub>2</sub>O<sub>2 </sub>stress</p>
            </title>
            <aug>
               <au>
                  <snm>Gidrol</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Sabelli</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Fern</snm>
                  <fnm>YS</fnm>
               </au>
               <au>
                  <snm>Kush</snm>
                  <fnm>AK</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <fpage>11268</fpage>
            <lpage>11273</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.93.20.11268</pubid>
                  <pubid idtype="pmcid">38319</pubid>
                  <pubid idtype="pmpid">8855345</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Al-induced, 51-kilodalton, membrane-bound proteins are associated with resistance to Al in a segregating population of wheat</p>
            </title>
            <aug>
               <au>
                  <snm>Taylor</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Basu</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Basu</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Slaski</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Good</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1997</pubdate>
            <volume>114</volume>
            <fpage>363</fpage>
            <lpage>372</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">158312</pubid>
                  <pubid idtype="pmpid" link="fulltext">12223709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Functional analysis of Avr9/cf-9 rapidly elicited gene identifies a protein kinase, ACIK1, that is essential for full cf-9-dependentant disease resistance in tomato</p>
            </title>
            <aug>
               <au>
                  <snm>Rowland</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ludwig</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Merrick</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Baillieul</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Tracy</snm>
                  <fnm>FE</fnm>
               </au>
               <au>
                  <snm>Durrant</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Fritz-Laylin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nekrasov</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sj&#246;lander</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yoshioka</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2005</pubdate>
            <volume>17</volume>
            <fpage>295</fpage>
            <lpage>310</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1105/tpc.104.026013</pubid>
                  <pubid idtype="pmcid">544506</pubid>
                  <pubid idtype="pmpid" link="fulltext">15598806</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>An S18 ribosomal protein gene copy at the <it>Arabidopsis </it>PFL locus affects plant development by its specific expression in meristems</p>
            </title>
            <aug>
               <au>
                  <snm>Van Lijsebetkens</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vanderhaeghen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>De Block</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bauw</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Villarroel</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Van Montagu</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>1994</pubdate>
            <volume>13</volume>
            <fpage>3378</fpage>
            <lpage>3388</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">395235</pubid>
                  <pubid idtype="pmpid">7913892</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Characterization and structural analyses of non specific lipid transfer protein 1 from mung bean</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>YN</fnm>
               </au>
               <au>
                  <snm>Hsu</snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Samuel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Bonvin</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Lyu</snm>
                  <fnm>PC</fnm>
               </au>
            </aug>
            <source>Biochem</source>
            <pubdate>2005</pubdate>
            <volume>44</volume>
            <fpage>5703</fpage>
            <lpage>5712</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1021/bi047608v</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Two large <it>Arabidopsis thaliana </it>gene families are homologous to the <it>Brassica </it>gene superfamily that encodes pollen coat proteins and the male component of the self-incompatibility response</p>
            </title>
            <aug>
               <au>
                  <snm>Vanoosthuyse</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Miege</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dumas</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cock</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>46</volume>
            <fpage>17</fpage>
            <lpage>34</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1010664704926</pubid>
                  <pubid idtype="pmpid" link="fulltext">11437247</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

