Background
DNA damage induces a G2 phase cell-cycle arrest in most tumour cell lines that lack functional p53 protein. Following abrogation of the G2 checkpoint, these cells arrest in mitosis and can subsequently form polyploid cells. This response is thought to represent an alternative to immediate death through apoptosis. This abnormal arrest in mitosis and the subsequent formation of mono-and multi-nucleated endopolyploid giant cells is incorporated under the collective term 'mitotic catastrophe' 1. The mechanisms underlying such responses remain unclear 1234. Our group has previously described the morphological features of these endopolyploid cells and observed that certain stages of the cytological rearrangements that lead to their de-polyploidisation, and return to mitosis are partly reminiscent of meiotic prophase 56. Interestingly, ectopic expression of meiotic proteins of the so-called cancer/testis antigens group, namely SCP1 and SPO11, has been reported in the literature as a feature of progressing tumours 789 and it has been suggested that this phenomenon could represent a link between the malignant behaviour of tumours and a gametogenesis-like processes 101112.
One of the central signalling pathways involved in switching cells from mitosis to meiosis is regulated by the MOS kinase. During meiosis, MOS is translationally up-regulated, where it first stimulates the first reduction division of the cell and then further acts as a cytostatic factor to maintain the oocyte in metaphase arrest at meiosis II until fertilization occurs 13. These separate functions are attributed to two different downstream targets of the MOS/MAPK pathway, cdk1 and Rsk90, respectively. In addition, MOS directly interacts with kinetochores thereby interrupting mitosis 14.
Meiosis functions to generate cells with a reduced number of chromosome sets. There are two obligate and interdependent requirements for this reduction division: (1) Sister chromatid cohesion and homologous chromosome pairing to facilitate the correct segregation and reduction of maternal and paternal chromosomes; (2) recombination between homologous chromosomes 1516. Pivotal to these processes is the meiotic cohesin REC8 1718 which sustains the cohesion between sister chromatids and particularly centromeres preventing separation until anaphase II 19. Rec8 functions to ensure that both homolog pairing and reduction division occurs during meiosis. Recently, Rec8 dominant negative mutants have been shown to prevent synapse formation of homologs in mammalian cells 20, whilst in yeast mutants over-expressing REC8 fail to produce sister chromatid separation 21.
During pre-meiotic replication REC8 associates with an axial structure on the meiotic chromosomes which later forms the lateral element of the synaptonemal complex (SC) 22. REC8 has been found to form complexes with the meiosis-specific recombinase DMC1 23. This enzyme is necessary for the Rad51-mediated stable DNA strand invasion and homology search which occurs during the homologous recombination stages of meiosis 24. Other important proteins of the SC are SCP3 and SCP2 which form the lateral elements of the SC. A third protein, SCP1 forms the central element of the SC, providing a bridge to hold the two homologous chromosomes together, assisted by recombination chiasma between the homologs 252627. REC8 colocalizes with another meiosis specific cohesin, STAG3. STAG3 stabilizes cohesion between sister chromatids during meiosis I and together with REC8 marks the lateral element of the SC 28.
Thus, REC8 and MOS, together with a number of specific cohesins and recombinases are important in the regulation and execution of meiosis, combining to achieve homologous recombination and chromosome separation/reduction. Although the molecular machinery for meiotic reduction divisions is largely understood, little is known regarding the regulation of reduction division in somatic polyploid cells which is thought to be a rare event 29. We hypothesised that polyploid cells may have the same common regulators involved in reduction division as meiosis on the basis that meiosis has probably evolved as a means of reducing the chromosome number in asexual polyploid protists 1030. Therefore, we sought to address whether the transformations observed in the endopolyploid tumour cells were linked with the ectopic expression of these genes. In this study we demonstrate the expression of several key meiotic prophase genes including MOS, SYCP1, REC8, DMC1, STAG3 and SYCP3 in tumour cells.
Methods
Cell lines and irradiation of cells
The Burkitt's lymphoma cell line Namalwa was obtained from the American Type Culture Collection (ATCC) and carries mutated p53 31. The TK6 and WI-L2-NS human lymphoblastoid cell lines were derived from the same WI-L2 isolate and were obtained from Dr. P. Olive (Vancouver, Canada). TK6 cells are p53 wild type and WI-L2-NS p53-mutated 32. The p53 mutation status of all three cell lines was confirmed by sequencing analysis. Cells were grown in RPMI 1640 medium, 10 % Foetal Calf Serum (FCS; Gibco, Paisley, UK) at 37°C in a 5 % CO2 humidified incubator. Cells were maintained in log phase of growth for at least 24 hours prior to irradiation which was at a density of 5 × 105 cells/ml using a Gulmay D3 225 X-ray source at a dose rate of 0.77 Gy/min. Cell culture medium was replenished every 48–72 hours.
Mitotic counts and DNA flow cytometry
Mitotic counts were measured from cytospins stained for DNA. Metaphases, anaphases and telophases were counted per 1000 cells, in at least three independent experiments. DNA flow cytometry for detection of polyploid cells (>4C) was performed as described previously 32.
Isolation of mRNA and conversion into cDNA
mRNA was isolated using the microquickprep mRNA kit (Amersham Pharmacia Biotech UK Ltd, Little Chalfont, UK) and converted to cDNA using the first strand cDNA synthesis kit (Amersham Pharmacia Biotech UK Ltd) according to the manufacturer's instructions.
RT-PCR
Reverse transcription polymerase chain reaction (RT-PCR) was performed in thin walled PCR tubes with 100 ng of cDNA, 100 ng of 5' and 3' primers, 1 unit (U) of DNA polymerase in the presence of dNTPs, 1 × reaction buffer and Taq polymerase (Promega, Southampton, UK). DNA was denatured at 95°C for 1 min, followed by 30 amplification cycles, using an annealing temperature of 56°C and extension at 72°C. The sequences of primers used are listed in Table 1. PCR products were analysed by electrophoresis in 1–2 % agarose gels and visualized under UV light after staining with ethidium bromide.
<p>Table 1</p>
Sequences of primers used in the RT-PCR experiments.
Gene
Forward
Reverse Primer
MOS
5'-CGGTGTTCCTGTGGCCATAA
5'-GCAGGCCGTTCACAACATC
REC8
5'-TGAGGGTGAATGTGGTGAAA
5'-CTGGGATTGCAGCCTCTAAG
SYCP3
5'- TGCAGAAAGCTGAGGAACAA
5'-TGCTGCTGAGTTTCCATCAT
SYCP1
5'- TGGCGATGTGATGGAATTTA
5'- TGTTTTCCCCATTTTTGGAG
SPO11
5'- AGGAAGATGGCACCAAAGTG
5'-GGTCCCTTTTTGTCAGTGGA
STAG3
5'- GGATGCAAAGCTACAGCA
5'- CATCCGGTCCTTGAAGC
DMC1
5'- AGCAGCAAAGTTCCATGAAG
5'- TGAGCTCTCCTCTTCCCTTT
Sequencing
To verify the sequence of the RT-PCR products, additional PCR experiments were performed with Pfu polymerase rather than Taq. These products were gel purified and cloned into PCR-Blunt II- TOPO vector (Invitrogen Life Technologies, UK). Sequencing was performed with T7 and sp6 primers along with standard PCR dye based di-deoxy chain termination technology and analyzed on an AB Prism 377 sequencer (Perkin-Elmer Applied Biosystems, Warrington, UK). The MOS nucleotide sequence was submitted to GenBank (accession number AY279177).
Western blotting
Western blotting was performed on cytoplasmic cell lysates to detect MOS and β-actin proteins accordingly to the methods as previously described 33. The anti-nuclear REC8 antibody (Santa Cruz Biotech.) was used to detect REC8. For MOS detection, 2 × 106 cells were lysed in 100 μl of 2× PSB, sonicated for 30 seconds, heated at 96°C for 5 minutes, resolved via 10% SDS-PAGE and transferred to PVDF membranes. After incubation with appropriately diluted primary antibodies (see Table 2), membranes were incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG (Sigma; Dorset, UK) for 1 hour at room temperature and washed. Antibody binding was visualized by SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology, Perbio Science UK Ltd., UK) before exposure to light-sensitive film (Hyperfilm ECL, Amersham Pharmacia Biotech, UK).
<p>Table 2</p>
Antibody source and usage
Primary antibodies
Secondary antibodies
Polyclonal goat anti-human REC8 (E-18):sc-15152 (Santa Cruz)
Rabbit anti-goat-Cy3 (Sigma)
Polyclonal rabbit anti-mouse REC8 antibody (602; kindly donated by Dr. C. Heyting, Wageningen, NL [23])
Goat anti-rabbit IgG-Texas red (Vector Laboratories Ltd., UK),
CREST serum against human kinetochore proteins (Acris Antibodies, Hiddenhausen, Germany)
Mouse anti-human IgG-FITC (Dr. MS Cragg)
Polyclonal rabbit anti-MOS (C237: sc-86; Santa Cruz Biotech;Wembley, UK)
Mouse anti-rabbit IgG-FITC (Sigma, Dorset, UK)
Polyclonal rabbit anti-SCP3 antiserum (kindly donated by Dr. C. Heyting, Wageningen, NL [46])
Goat anti-rabbit IgG-FITC (Vector Laboratories Ltd., UK),
Immunofluorescent (IF) staining
For immunofluorescent staining, harvested cells were suspended in FCS, cytospun onto poly-L-lysine coated microscope slides, fixed in absolute methanol for 10–20 minutes at -20°C. Slides were then rinsed in ice-cold acetone, semi-dried and washed in PBS. Detection of various proteins was performed with the respective antibodies according to34. The pairs of antibodies used and their source are presented in Table 2. Samples were counterstained with DAPI (0.5 μg/ml) (Molecular Probes, Cambridge, UK). Slides were mounted in mowiol (Harlow Chemical Company Ltd, UK), containing 0.1% citifluor (Agar Scientific, Stansted, UK). Images were taken with a Leica DM LS2 fluorescent microscope.
Results
Translation of MOS is enhanced by irradiation in p53 mutated lymphoma cell lines
MOS was transcriptionally expressed in all three lymphoma cell lines, and no significant changes were detected following irradiation (Fig. 1A). However, when protein expression was assessed by Western blotting, a particularly pronounced accumulation of p39mos was observed in Namalwa cells after irradiation (Fig. 1B) with the peak levels of expression coinciding with the maximal metaphase arrest on day 3 (Fig. 2A and 2B). The p39mos expression was also elevated in WI-L2-NS cells after irradiation, which again coincided with the maximum mitotic arrest (in this case on day 2), albeit less pronounced (both the expression of p39mos and cell arrest) than that observed in the Namalwa cells. In contrast, p39mos protein was expressed at a very low level in p53 wild-type TK6 cells and its expression was not enhanced following irradiation. The expression level of p39mos also correlated with the amount of polyploid cells produced (Fig. 2C). These data suggest that the post-translational events responsible for the induction of MOS only occur in p53 mutated irradiated lymphoma cells following irradiation. Next we sought to examine the expression of the meiotic cohesin REC8.
<p>Figure 1</p>
Post transcriptional accumulation of p39mos protein in response to 10 Gy irradiation
Post transcriptional accumulation of p39mos protein in response to 10 Gy irradiation. (A) Transcription of MOS from Namalwa, WI-L2-NS or TK6 cells on different days after irradiation. Messenger RNA was first isolated from samples and then reverse transcribed to yield cDNA for semi-quantitative PCR. Primers for GAPDH were used to verify integrity and quantity of cDNA. Mos expression was observed in all 3 cell lines with minor differences seen during the five days after irradiation; (B) upper panel: in comparison to non-treated control (NT), accumulation of p39mos was detected by Western blotting on days 1 to 4 afterirradiation, with maximum expression observed on days 2–3 in Namalwa, and days 1 and 2 for WI-L2-NS cells. In TK6 cells, p39mos was not detectable after irradiation. Lower panel: for loading control PVDF membranes were re-blotted with mouse monoclonal anti-b-actin antibodies.
![]()
<p>Figure 2</p>
Metaphase arrest and levels of polyploidy in lymphoma cell-lines after 10 Gy irradiation
Metaphase arrest and levels of polyploidy in lymphoma cell-lines after 10 Gy irradiation. p53 mutated Namalwa cells show a pronounced arrest in metaphase as seen by the high mitotic index on day 3 to day 5 (A) and near absence of anaphases and telophases (B) for a period of almost 10 days. Metaphase arrest is smaller and shorter in W1-L2-NS; (C) typical changes in the levels of polyploidy observed by DNA flow cytometry in Namalwa, W1-L2-NS and TK6 cells. (C) Reprinted from Ivanov et al., 2003. Both mitotic and endo-cycling are abrogated in wt p53 TK6 cells, which do not survive this irradiation insult.
![]()
Expression of REC8 is enhanced after irradiation
Although transcribed at a low level in untreated cells, REC8 was substantially up-regulated following irradiation in all five independent experiments performed with the Namalwa cell-line (Figure 3A). Up-regulation was observed from day 3 until day 7–9 post-irradiation over the period during which the largest number of polyploid cells are present in the culture (Fig. 2C). REC8 was also expressed in WI-L2-NS cells and elevated following irradiation, albeit with different kinetics than that seen in Namalwa cells where a prominent increase in transcription was seen only from day 5. In contrast, in TK6 cells, REC8 was transcribed prior to irradiation but its expression fell afterwards. Due to almost all of the TK6 cells undergoing apoptosis by day 3, it was impossible to analyze expression levels on subsequent days. Western blot analysis performed for REC8 protein in Namalwa cells further confirmed the translation of this meiotic cohesion protein over this protracted period post-irradiation with a peak in protein expression on day 3 (Fig. 3B).
<p>Figure 3</p>
The expression of meiosis-specific genes DMC1, REC8, STAG3, SYCP1 and SYCP3 in irradiated lymphoma cells in the time-course post-irradiation: (A) Transcription of REC8, STAG3 and DMC1, shown by RT-PCR of mRNA isolated from WI-L2-NS, TK6 or Namalwa cells on different days post irradiation and from non-treated control cells (NT)
The expression of meiosis-specific genes DMC1, REC8, STAG3, SYCP1 and SYCP3 in irradiated lymphoma cells in the time-course post-irradiation: (A) Transcription of REC8, STAG3 and DMC1, shown by RT-PCR of mRNA isolated from WI-L2-NS, TK6 or Namalwa cells on different days post irradiation and from non-treated control cells (NT). Primers for actin were used to verify integrity and quantity of cDNA; (B) Expression of REC8 protein in Namalwa cells, detected by Western blotting (antibody from Santa Cruz). The highest level of transcription was detected on day 3. Lower panel: for loading control PVDF membranes were re-blotted with mouse monoclonal anti-b-actin antibodies. (C) Transcription of SYCP1 and SYCP3 shown by RT-PCR of mRNA isolated from non treated Namalwa cells or on day 7 post irradiation showing very weak background expression. NB: In this experiment three times as much cDNA was used for the WI-L2-NS non treated samples as was used for the WI-L2-NS samples post irradiation. This was done in order to verify the increase in transcription after irradiation treatment. Although the amount of cDNA taken for PCR with the REC8 primers is much smaller on day 5 post irradiation (as judged by beta actin level) it still shows obviously higher level of REC8 expression.
![]()
Distribution of REC8 in endopolyploid cells
Given the pronounced upregulation of REC8 following irradiation, we next assessed the localisation of REC8 in cells at various times after irradiation. As a positive control for REC8 staining we first assessed two different antibodies directed to REC8 on rat testes tissue and, as expected, we observed strongly positive staining in the primary spermatocytes (Fig. 4A insert). Using the same antibodies, we then assessed the expression of REC8 in the lymphoma cells. Untreated Namalwa cells in interphase or undergoing mitosis were negative for REC8. Interestingly, however, a few bright, large, REC8-positive foci were observed in the chromatin of rare mitotic cells undergoing arrest in metaphase (data not shown).
<p>Figure 4</p>
In situ localisation of REC8 post-mitotic catastrophe in endopolyploid Namalwa cells: (A) REC8 (red) appears on day 3 in the metaphase-arrested cells which, as judged by the adhered swollen chromosomes, undergo restitution into endopolyploid cells
In situ localisation of REC8 post-mitotic catastrophe in endopolyploid Namalwa cells: (A) REC8 (red) appears on day 3 in the metaphase-arrested cells which, as judged by the adhered swollen chromosomes, undergo restitution into endopolyploid cells. DNA counterstained by DAPI (blue) (insert- rat testis control for Rec8); (B) IF double-staining for kinetochores/centromeres by CREST antibody (FITC, green) and REC8 (red) in a polyploid interphasic cell, where interaction of REC8 foci with kinetochores/centromeres is shown; arrow and arrowhead indicate the insertion of several REC8 foci in CREST-positive arrayed structures; the image insert shows a higher magnification of a centromere doublet cohesed with a focus of REC8.
![]()
Following irradiation of Namalwa cells, bright REC8-positive foci appeared in about 10–15% of the cells on day 3. These data are in accordance with the western blot REC8 protein expression coincident with the peak of mitotic arrest. REC8 was localised within the arrested aberrant metaphases characterised by the swollen and adhered chromosomes (Fig 4A), evidently undergoing restitution into interphase. After day 3, the amount of REC8 staining increased in the nuclei of subsequent endopolyploid interphase cells. During this period (day 3–6), DNA endoreduplication and repair by homologous recombination were observed as documented by us previously 53536.
Subsequently, we assessed if REC8 was associated with centromeres by combining immunostaining with REC8 and a CREST antibody known to detect kinetochore proteins associated with centromeres. This staining revealed REC8- and CREST-positive foci to be associated and juxta-posed from day 5 to day 9–11, although somewhat irregularly. REC8 foci were seen inserted between doublets or chains of CREST-positive foci (Fig. 4B).
Expression of other meiosis-specific genes
Next, we assessed whether other meiosis specific proteins were expressed in the lymphoma cells. The DMC1 gene encodes for a meiosis specific recombinase from the RecA family and appears to act in cooperation with REC8 23 and Rad51 37. We found by RT-PCR that DMC1 was also expressed, both in irradiated and non-treated samples of all three cell lines, with a prominent decrease after irradiation in the p53 wild-type TK6 cells (Fig. 3A). We also found that STAG3, a meiosis-specific cohesin, is transcribed in all three cell lines, although with no apparent change in transcription after irradiation. The translational expression of Rad51 in endopolyploid cells, a recombinase engaged in DNA repair, has previously been shown by us to occur following irradiation in these same p53 mutated cell lines 33. Studies of the genes involved in the formation of the synaptonemal complex, SYCP1 and SYCP3 revealed some weak background expression in Namalwa cells. Although only weakly transcribed, the identity of these PCR products was confirmed by sequencing. The transcriptional expression of these genes was not elevated by irradiation (Fig. 3C).
On day 6 post-irradiation, approximately 8% of irradiated Namalwa cell nuclei displayed atypical weak SCP3 staining by IF in the perinuclear region (not shown).
Discussion
In this study we have investigated the expression of several meiotic genes in p53 wild-type and p53 mutated lymphoma cells both before and after an irradiation insult that induces mitotic catastrophe. This study reveals that a group of previously well defined meiosis-specific proteins are clearly upregulated in the p53 mutated cells after DNA damage with irradiation. In particular, the meiosis-regulatory protein, MOS, was strongly post-transcriptionally up-regulated in the Namalwa and WIL2NS cells after irradiation. This up-regulation was only apparent in p53 mutated cells and was lacking from the wild-type TK6 cells, implying that up-regulation of MOS by DNA damage is inhibited by wild type p53 function. Interestingly, this elevation in MOS protein was a post-translational event as transcription remained constant after irradiation. Therefore increases in MOS may arise from either increased translation from the mRNA or increased protein stability. For example, post-translational modification of the MOS protein by (auto)phosphorylation on Ser-3 could lead to its increased stability and decreased proteasome-mediated degradation 14.
This observation of mos upregulation in p53 mutated cells, is in line with data of Fukasawa and Vande Woude 38 who demonstrated that only p53-/- somatic cells can tolerate high levels of MOS and the subsequent downstream elevation of MAPK activity. It should also be noted that up-regulation of MOS protein has been previously shown in human ovarian cancer cells arrested at the spindle checkpoint by microtubule-damaging agents 39. Hence, the quantitative and temporal relationship between MOS up-regulation and the arrest in the spindle checkpoint were also found in that system, although a different type of tumour cell was used and a different metaphase arrest strategy employed. These data strengthen the notion that MOS expression may be directly involved in the metaphase arrest in mitotic catastrophe.
During the homologous recombination processes of meiosis, Rad51 is known to cooperate with the meiotic cohesin Rec8 and meiotic recombinase DMC1 37. It is striking that in the irradiated p53 mutant lymphoid tumours shown here, we observed the expression of a major meiotic cohesin REC8 and the meiotic recombinase DMC1. In addition to its potential role in DNA recombination and repair, the chromatid-cohesing function of REC8 may also provide for the induction of polyploidising ('catastrophic') mitosis. Whether it represents an adaptive response which favours escape from mitotic cell death, providing an option for the formation of giant cells, additional DNA repair and their segregation by somatic reduction still remains to be elucidated.
An interesting and unexpected finding was that a number of other meiotic prophase-specific genes are also expressed in the lymphoma cell lines. Importantly, the induced activation of these meiotic genes seen in the p53 mutated cell lines was not observed in the wild-type p53 TK6 cells. In accord, TK6 cells produce a very small polyploid cell fraction after irradiation, approximately 6 to 10 times less than WI-L2-NS or Namalwa cells and do not survive the 10 Gy irradiation dose (see Fig. 1).
It is noteworthy that the meiosis-specific genes that were observed by us to be aberrantly expressed in the p53 mutated lymphoma cells (MOS, REC8, DMC1, STAG3, SYCP1, and SYCP3) can all be classified as cancer/testis antigens as defined by Simpson et al. 12. Many of the cancer/testis gene products belong to a broad and ever expanding group of tumour antigens 710 and some have been used, with various success rates, as targets for vaccine therapy in clinical trials 40.
To our knowledge, four of these meiotic prophase-associated genes (REC8, DMC1, STAG3 and SYCP3) are reported to be expressed in malignant tissue for the first time. Interestingly, at least a proportion of these meiosis specific genes appear to be associated with the induction of mitotic catastrophe and the generation of endopolyploid tumour cells.
Finally, recent advances in long-term video-microscopy have found that the endopolyploid cells resulting from mitotic catastrophe appear to have some reproductive potential 44142434445. Given these observations and the potential importance of the meiosis-specific genes in the response of p53 mutated tumour cells to genotoxic treatment, further study of these meiotic genes in tumours may reveal novel therapeutic strategies.
List of abbreviations used
IF- immunofluorescence
SC- synaptonemal complex
Competing interests
The author(s) declare that they have no competing interests.
Authors' contributions
MK carried out the RT-PCR studies together with GP, performed the IF experiments, participated in REC8 western analysis and did most of the manuscript preparation. AI carried out RT-PCR and western for MOS and REC8 as well as the counts of mitotic plates. GP carried out part of the RT-PCR studies of cohesins including primer design. MSC carried out flow cytometry studies, contributed substantially to the data analysis and editing of the manuscript. DzE did the calculations for and designed the irradiation procedure and participated in data analysis. TMI participated in data analysis and critical editing of the manuscript. JeE is the principal investigator, proposed working hypotheses, coordinated research, together with MK carried out IF studies, and edited the manuscript.
All authors participated in the design of the study, read and approved the final manuscript.