<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2407-6-55</ui>
   <ji>1471-2407</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Cyclin A1 promoter hypermethylation in human papillomavirus-associated cervical cancer</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Kitkumthorn</snm>
               <fnm>Nakarin</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>Art_khuan@hotmail.com</email>
            </au>
            <au id="A2">
               <snm>Yanatatsanajit</snm>
               <fnm>Pattamawadee</fnm>
               <insr iid="I1"/>
               <email>Nuchjoe@hotmail.com</email>
            </au>
            <au id="A3">
               <snm>Kiatpongsan</snm>
               <fnm>Sorapop</fnm>
               <insr iid="I3"/>
               <email>Ksorapop@yahoo.com</email>
            </au>
            <au id="A4">
               <snm>Phokaew</snm>
               <fnm>Chureerat</fnm>
               <insr iid="I1"/>
               <email>Hoshleys@hotmail.com</email>
            </au>
            <au id="A5">
               <snm>Triratanachat</snm>
               <fnm>Surang</fnm>
               <insr iid="I3"/>
               <email>Surangtrirattanachat@hotmail.com</email>
            </au>
            <au id="A6">
               <snm>Trivijitsilp</snm>
               <fnm>Prasert</fnm>
               <insr iid="I3"/>
               <email>Tprasert@chula.ac.th</email>
            </au>
            <au id="A7">
               <snm>Termrungruanglert</snm>
               <fnm>Wichai</fnm>
               <insr iid="I3"/>
               <email>Wichaiterm@hotmail.com</email>
            </au>
            <au id="A8">
               <snm>Tresukosol</snm>
               <fnm>Damrong</fnm>
               <insr iid="I3"/>
               <email>Dtresukosol@hotmail.com</email>
            </au>
            <au id="A9">
               <snm>Niruthisard</snm>
               <fnm>Somchai</fnm>
               <insr iid="I3"/>
               <email>Ndsomchai@hotmail.com</email>
            </au>
            <au id="A10" ca="yes">
               <snm>Mutirangura</snm>
               <fnm>Apiwat</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>mapiwat@chula.ac.th</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Molecular Biology and Genetics of Cancer Development Research Unit, Faculty of Medicine, Chulalongkorn University, Rama IV., Bangkok 10330, Thailand</p>
            </ins>
            <ins id="I2">
               <p>Department of Microbiology, Faculty of Medicine, Chulalongkorn University, Rama IV., Bangkok 10330, Thailand</p>
            </ins>
            <ins id="I3">
               <p>Department of Obstetrics and Gynecology, Faculty of Medicine, Chulalongkorn University, Rama IV., Bangkok 10330, Thailand</p>
            </ins>
            <ins id="I4">
               <p>Department of Anatomy, Faculty of Medicine, Chulalongkorn University, Rama IV., Bangkok 10330, Thailand</p>
            </ins>
         </insg>
         <source>BMC Cancer</source>
         <issn>1471-2407</issn>
         <pubdate>2006</pubdate>
         <volume>6</volume>
         <issue>1</issue>
         <fpage>55</fpage>
         <url>http://www.biomedcentral.com/1471-2407/6/55</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16524460</pubid>
               <pubid idtype="doi">10.1186/1471-2407-6-55</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>23</day>
               <month>11</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>08</day>
               <month>3</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>08</day>
               <month>3</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Kitkumthorn et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The aim of this study was to evaluate epigenetic status of <it>cyclin A1 </it>in human papillomavirus-associated cervical cancer. Y. Tokumaru <it>et al</it>., <it>Cancer Res </it><b>64</b>, 5982-7 (Sep 1, 2004)demonstrated in head and neck squamous-cell cancer an inverse correlation between <it>cyclin A1 </it>promoter hypermethylation and <it>TP53 </it>mutation. Human papillomavirus-associated cervical cancer, however, is deprived of TP53 function by a different mechanism. Therefore, it was of interest to investigate the epigenetic alterations during multistep cervical cancer development.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>In this study, we performed duplex methylation-specific PCR and reverse transcriptase PCR on several cervical cancer cell lines and microdissected cervical cancers. Furthermore, the incidence of <it>cyclin A1 </it>methylation was studied in 43 samples of white blood cells, 25 normal cervices, and 24, 5 and 30 human papillomavirus-associated premalignant, microinvasive and invasive cervical lesions, respectively.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We demonstrated <it>cyclin A1 </it>methylation to be commonly found in cervical cancer, both in vitro and in vivo, with its physiological role being to decrease gene expression. More important, this study demonstrated that not only is <it>cyclin A1 </it>promoter hypermethylation strikingly common in cervical cancer, but is also specific to the invasive phenotype in comparison with other histopathological stages during multistep carcinogenesis. None of the normal cells and low-grade squamous intraepithelial lesions exhibited methylation. In contrast, 36.6%, 60% and 93.3% of high-grade squamous intraepithelial lesions, microinvasive and invasive cancers, respectively, showed methylation.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This methylation study indicated that <it>cyclin A1 </it>is a potential tumor marker for early diagnosis of invasive cervical cancer.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Cervical cancer (CC) is an important health problem and is a leading cause of cancer mortality worldwide in women. <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> When exposed to and infected by one of the high-risk human papillomaviruses (HPV), vulnerable cervical epithelium may enter a complex multistep process and develop an invasive carcinoma. <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp> The spectrum of histologic alterations during the intricate processes of multistep carcinogenesis can be classified as premalignant lesions, including low-grade and high-grade squamous intraepithelial lesions (SILs), and malignant invasive cervical cancers. <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> Despite its strong association with CC, HPV infection alone is not sufficient for the cervical epithelium to fully develop an invasive cervical cancer. Persistent HPV infection contributes to the development of SILs, with viral oncoproteins facilitating the dysregulation of cellular proliferation and the apoptotic process. However, additional accumulation of mutations, as well as epigenetic alterations in the crucial oncogenes and tumor suppressor genes, is required before these premalignant lesions fully transform into invasive cancers. <abbrgrp><abbr bid="B6">6</abbr></abbrgrp></p>
         <p>The aim of this study was to evaluate DNA methylation status of <it>cyclin A1 </it>(<it>CCNA1</it>) in HPV-associated CC. <it>CCNA1</it>, a second A-type cyclin, has been shown to be essential for entry into metaphase of male meiosis I<abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp> Consistent with this function, <it>CCNA1 </it>is highly expressed in testis and hematopoietic progenitor cells, but is present at low levels in most other tissues. <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> No phenotype other than male infertility has been reported in mice lacking <it>CCNA1</it>. <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> Surprisingly, several lines of evidence suggest that <it>CCNA1 </it>may be a potential epithelial tumor suppressor gene. First, the expression of <it>CCNA1 </it>has been demonstrated to be downregulated in several cancers, such as nasopharyngeal carcinoma and head and neck squamous-cell cancer (HNSCC). <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp> Second, CCNA1 plays an important role in DNA double-strand break repair following radiation damage by activation of the non-homologous end-joining process that confers DNA stability. <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> Finally, the promoter, similar to several key tumor suppressor genes, is frequently hypermethylated in colon cancer and HNSCC. <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B15">15</abbr></abbrgrp></p>
         <p>Expression of <it>CCNA1 </it>has been shown to be correlated with the activation of <it>TP53</it>. In a HNSCC model, there is an inverse relationship between <it>CCNA1 </it>promoter methylation and <it>TP53 </it>mutation status in HNSCC tissues. <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> Similar to HNSCC, the majority of CC is of squamous cell origin and its molecular carcinogenesis strongly correlates with impaired TP53 function. <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp> However, unlike HNSCC, the functional loss of TP53 in CC is not ascribed to gene mutation, but is processed by viral and host protein-protein interaction. CC is strongly associated with infection by high-risk HPV types and its oncoprotein E6 has the ability to associate with and neutralize the function of TP53. <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp> E6 binds to TP53 and catalyzes multi-ubiquitination and degradation of TP53. Consequently, the majority of CC cells have a wild-type <it>TP53</it>, but the protein levels are decreased. Therefore, in comparison with HNSCC, it was of interest to determine if <it>CCNA1 </it>is methylated in HPV-associated squamous cell CC.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Cell lines and tissue samples</p>
            </st>
            <p>SiHa and two HeLa CC cell lines from different sources were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. All three cells were purchased from ATCC. SiHa, HeLa (S), and HeLa (K) were grown and maintained in laboratories of Dr. Ponglikitmongkol M, Mahidol University, Dr. Gutkind JS, NIH, USA and Dr. Ruxrungthum K, Chulalongkorn University, respectively.</p>
            <p>With approval of ethical committee, faculty of medicine, Chulalongkorn university, normal cervical tissues, cancer tissues and blood samples were obtained and prepared as previously described. <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> Cervical tissues were obtained by punch biopsy of lesions under direct visualization or under colposcopic examination. Specimens were divided in two. The first sample was submitted to routine histological examination, and the second was reserved for DNA isolation. Blood samples were obtained by venipuncture from CC patients and healthy blood donors. All HPV-positive premalignant lesions were exfoliated cells, selected from routine cytological screening. In brief, cervical cells were collected with a cervical sampler (Digene Corporation, Gaithersburg, MD, USA) using the cervical cytobrush technique, and were divided into three parts. The first was reserved for routine cytological diagnosis. The second was tested for the presence of high-risk HPV (types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68) DNA by Hybrid Capture 2 (Digene Corporation, Gaithersburg, MD, USA). <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> In cases of positive high-risk HPV and complete histological tissue evaluation, the third part was subjected to <it>CCNA1 </it>methylation analysis. DNA extraction was performed using Tris/SDS and proteinase K at 50&#176;C overnight, followed by phenol/chloroform extraction and ethanol precipitation.</p>
            <p>Cervical biopsy specimens and Papanicolaou smears were examined and reviewed by at least two gynecologic pathologists to ensure good quality control of the final pathology results. All CCs contained 20&#8211;95% malignant cells. The histological diagnoses distinguished among normal epithelium, low-grade SILs, high-grade SILs, microinvasive and invasive cancer. In case of invasive cancer, only those samples classified as squamous-cell lesions were used for further analysis.</p>
            <p>Additional six OTC-embedded frozen CCs and five normal cervices, obtained from hysterectomy specimens, were microdissected as previously described.<sup>22 </sup>Histologically normal epithelium, connective tissue and malignant cells were subjected to <it>CCNA1 </it>methylation and expression studies.</p>
         </sec>
         <sec>
            <st>
               <p>HPV detection and typing</p>
            </st>
            <p>HPV <it>L1</it>, <it>E6 </it>gene amplification and dot blot hybridization were performed as previously described<abbrgrp><abbr bid="B19">19</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp> Briefly, each L1 amplification reaction contained the L1 degenerate primers MY11 and MY09. The E6 reactions contained WD72, WD66, WD154, WD67 and WD76. Both reactions were used to amplify genomic DNA during 40 PCR cycles. To analyze the amplicons for the presence of high-risk HPV, we applied dot blot hybridization using the HPV type-specific oligo probes, WD170, WD132, RR1, RR2, WD103, WD165, WD, consensus L1, MY12/13, WD126, WD128, MY16, WD133/134, MY14 and WD174. The membranes were subjected to analysis by a phosphoimager. Results for L1 and E6 dot blots were scored independently. Duplicate filters were prepared for all specimens.</p>
         </sec>
         <sec>
            <st>
               <p>Sodium bisulfite modification and duplex methylation-specific PCR (MSP)</p>
            </st>
            <p>The DNA samples were subjected to bisulfite treatment. <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp> Briefly, 2 &#956;g of genomic DNA was denatured with NaOH (final concentration 0.2 M). Subsequently, 10 mM hydroquinone and 3 M sodium bisulfite were added and incubated at 50&#176;C for 16 h. The modified DNA was then purified using Wizard DNA purification resin (Promega, Madison, WI, USA) followed by ethanol precipitation. Duplex MSPs were performed to identify the <it>CCNA1 </it>methylation status of all samples. The duplex PCR mixtures contained 10&#215; PCR buffer (Qiagen, Chuo-ku, Tokyo), deoxynucleotide triphosphates (0.2 mM), primers CCNA1metF, CCNA1metR, CCNA1unmetF and CCNA1unmetR (final concentration 0.4 &#956;M each per reaction) (Table <tblr tid="T1">1</tblr>), 1 U of HotStarTaq (Qiagen, Chuo-ku, Tokyo) and bisulfited DNA (80 ng). The amplification reaction was carried out for 30 cycles in a 2400 Perkin Elmer thermal cycler. Then 10-&#956;l aliquots of the PCR products were stained with cyber green, run on an 8% non-denaturing polyacrylamide gel. The band intensity was visualized and measured by using a phosphoimager.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Oligonucleotide sequences and conditions for PCR analyses</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Primer</p>
                     </c>
                     <c ca="left">
                        <p>Sequence</p>
                     </c>
                     <c ca="center">
                        <p>Amplicon size (bp)</p>
                     </c>
                     <c ca="center">
                        <p>Annealing temperature (&#176;C)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1metF</p>
                     </c>
                     <c ca="left">
                        <p>TTTCGAGGATTTCGCGTCGT</p>
                     </c>
                     <c ca="center">
                        <p>46</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1metR</p>
                     </c>
                     <c ca="left">
                        <p>CTCCTAAAAACCCTAACTCGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1unmetF</p>
                     </c>
                     <c ca="left">
                        <p>TTAGTGTGGGTAGGGTGTT</p>
                     </c>
                     <c ca="center">
                        <p>67</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1unmetR</p>
                     </c>
                     <c ca="left">
                        <p>CCCTAACTCAAAAAAACAACACA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1cloningF</p>
                     </c>
                     <c ca="left">
                        <p>TGGGTAGGGCGTCGTAGTT</p>
                     </c>
                     <c ca="center">
                        <p>196</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1cloningR</p>
                     </c>
                     <c ca="left">
                        <p>GCCCCCGACCTAAAAAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1cDNAF</p>
                     </c>
                     <c ca="left">
                        <p>ATTCATTAAGTGAAATTGTGC</p>
                     </c>
                     <c ca="center">
                        <p>170</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCNA1cDNAR</p>
                     </c>
                     <c ca="left">
                        <p>CTTCCATTCAGAAACTTATTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GAPDHF</p>
                     </c>
                     <c ca="left">
                        <p>GTGGGCAAGGTATCCCTG</p>
                     </c>
                     <c ca="center">
                        <p>460</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GAPDHR</p>
                     </c>
                     <c ca="left">
                        <p>GATTCAGTGTGGTGGGGGAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>RNA preparation and analysis</p>
            </st>
            <p>Expression of <it>CCNA1 </it>in the CC cell lines was examined by RT-PCR. Total RNA was extracted using the TRIZOL reagent (Invitrogen, Singapore) according to the manufacturer's specifications and 5 &#956;g of each sample was subjected to cDNA synthesis using MMLV reverse transcriptase (Fermentas, Hanover, MD, USA). PCR mixtures contained 10&#215; PCR buffer, 0.2 mM dNTPs, 0.4 &#956;M each of primers CCNA1cDNAF and CNA1cDNAR, 1 U of HotStartaq and 80 ng cDNA. <it>GAPDH </it>served as the internal control (Table <tblr tid="T1">1</tblr>). Aliquots of 10 &#956;l of the PCR products were subjected to electrophoresis on a 2% agarose gel stained with ethidium bromide on preparation, and were visualized by a UV trans-illuminator.</p>
         </sec>
         <sec>
            <st>
               <p>Bisulfite genome sequence analysis</p>
            </st>
            <p>Some <it>CCNA1 </it>methylation-positive CCs were selected for sequence analysis. The bisulfited DNAs were amplified using CCNA1cloningF and CCNA1cloningR (Table <tblr tid="T1">1</tblr>). The amplified fragments were cloned using the PGemT easy vector and sequenced.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>The aim of this study was to determine if the <it>CCNA1 </it>promoter is methylated in CC and to elucidate how the epigenetic alteration occurs during multistep CC development. The experiments conducted comprised of: first, establishment of <it>CCNA1 </it>MSP; second, identification of the methylation status and correlation with expression in CC cell lines, normal cervix and CC; and finally, investigation of the frequency of methylation in normal tissues, high-risk HPV-associated low SILs, high SILs, microinvasive and invasive squamous cell CC.</p>
         <sec>
            <st>
               <p>CCNA1 methylation in CC cell lines</p>
            </st>
            <p>Duplex MSP for <it>CCNA1 </it>was designed according to the sequence in Figure <figr fid="F1">1A</figr>. The methylated sequence comprised of 46 bp and the non-methylated sequence, 67 bp, shown as the lower and the upper amplicons, respectively.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Schematic representation of inverse correlation between promoter methylation and expression of <it>CCNA1 </it>in CC cell lines</p>
               </caption>
               <text>
                  <p>Schematic representation of inverse correlation between promoter methylation and expression of <it>CCNA1 </it>in CC cell lines. (A) Diagram of methylated and non-methylated sequences after bisulfite modification covering the area of both primers (underlined) in the promoter region of <it>CCNA1</it>. M, DNA size marker. Top panel, 10-bp ladder; bottom four panels, 100-bp ladder. Neg, negative. (B) Duplex MSP analysis of cell lines. Upper and lower arrows indicate non-methylated and methylated amplicons, respectively. MSP, methylation-specific PCR. (C-E) RT-PCR of the <it>CCNA1 </it>gene after 28, 30 and 35 cycles, respectively. (F) RT-PCR of the <it>GAPDH </it>gene as an internal control.</p>
               </text>
               <graphic file="1471-2407-6-55-1"/>
            </fig>
            <p>Previously, Carsten M&#252;ller-Tidow et al. <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp> extensively studied the role of <it>CCNA1 </it>methylation and found that <it>CCNA1 </it>was methylated in several non-expressing tumor cell lines, including HeLa. To confirm this particular finding in CC cell lines, we investigated methylation and expression in HeLa and SiHa cells. Our preliminary study in HeLa, HeLa(S), revealed complete non-methylation, which contradicts the previous report (Fig. <figr fid="F1">1B</figr>). To settle this controversy, we attempted to further evaluate additional CC cell lines, including HeLa(K) grown in a different laboratory, and SiHa. The result confirmed the Carsten M&#252;ller-Tidow et al. <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp> finding, in that the majority of Hela(K) cells, as well as all SiHa cells, were hypermethylated. CCNA1 RT-PCR confirmed the inverse relation between DNA methylation and gene expression. CCNA1 RNA levels were high, intermediate and low in HeLa(S), HeLa(K) and SiHa cells, respectively (Fig. <figr fid="F1">1</figr>). These data indicate that <it>CCNA1 </it>methylation is common in CC cell lines and its physiological role is to decrease gene expression. The absence of methylation in HeLa(S) might indicate a demethylation process that occurs under different cell culture and maintenance conditions.</p>
            <p>We validated the reliability of this duplex MSP by performing calibration experiments using SiHa mixed with HeLa(S), CCNA1 completely hypermethylated and non-methylated cells, respectively (Fig. <figr fid="F2">2A</figr>). With at least three replicates for each experiment, the result demonstrates the consistency of the current approach, with minimal intra- and inter-assay variations (Fig. <figr fid="F2">2B</figr>). It is noteworthy that the correlation between measured and actual CCNA1 methylation percentages was not linear, but exponential.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Intra- and inter-assay variation of the duplex MSP</p>
               </caption>
               <text>
                  <p>Intra- and inter-assay variation of the duplex MSP. (A) Duplex MSP of a mixture of <it>CCNA1 </it>complete and non-methylated CC cell lines, SiHa and HeLa(S), respectively. M, DNA size marker; Neg, negative; 0, 25, 50, 75, 100 Met (%) represent the proportion of SiHa DNA in the mixture, varied from 0 to 100%, respectively. The upper and lower bands are non-methylated and methylated bands, respectively, indicated by labeled arrows. (B) Graphical comparison between measured <it>CCNA1 </it>methylation, percentage intensity of methylation amplicon (x-axis), and actual methylation, the proportion of SiHa DNA (y-axis). The bar height indicates the mean and error bars, T, represent standard deviation (SD) across experiments.</p>
               </text>
               <graphic file="1471-2407-6-55-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>CCNA1 methylation and expression in cervical tissues</p>
            </st>
            <p>The discovery of an inverse correlation between CCNA1 methylation and expression in CC lines suggested possibility of the same situation in vivo. To test this hypothesis, we evaluated the epigenetic control in vivo. Six frozen OTC-embedded CCs and five normal cervices were microdissected and subjected to duplex MSP and CCNA1 RT-PCR. Figure <figr fid="F3">3</figr> shows examples of typical in vivo results. First, whereas no methylation could be observed, CCNA1 mRNA was discoverable by RT-PCR in normal cervix from both epithelium and connective tissue cells (Fig. <figr fid="F3">3A</figr>). In contrast, epigenetic control was detectable in cervical epithelia of CC patients from both malignant cells and adjacent histologically normal cervical epithelia. Nonetheless, in matched cases, a higher degree of methylation could be demonstrated in cancer than in normal cells. From all CCs, no CCNA1 mRNA was detectable. Interestingly, even if methylation was detected, CCNA1 was expressed in malignancy-adjacent histologically normal cervical tissues. Moreover, an inverse correlation between the methylation level and mRNA quantity was observed. CCNA1 expression in methylated malignancy-adjacent histologically normal cervical epithelium may be due to normal cell contamination or partial methylation at the promoter according to CC multistep progression. Whereas complete methylation could be observed in most cancer cells, partial and non-methylated CCNA1 was discovered in the adjacent epithelia (Fig. <figr fid="F3">3B</figr>). In conclusion, this experiment evaluating cervical tissue in vivo led to three conclusions. First, <it>CCNA1 </it>methylation was exclusively associated with cervical carcinogenesis. Second, the epigenetic alteration occurred earlier than morphological transformation of the cellular phenotype. Finally, methylation may play a role in this gene inactivation.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p><it>CCNA1 </it>methylation and expression in microdissected cervical tissues</p>
               </caption>
               <text>
                  <p><it>CCNA1 </it>methylation and expression in microdissected cervical tissues. (A) Duplex MSP and <it>CCNA1 </it>PCR; E and CNT are epithelium and connective tissue cells from normal cervix; N and T are adjacent histological normal and cancer cervical epithelium from CC, respectively. Arrows indicate non-methylated, methylated, <it>CCNA1 </it>cDNA and <it>GAPDH </it>cDNA, respectively. (B) Bisulfite sequencing at the <it>CCNA1 </it>promoter, with circles denoting the methylation status of each selected clone. Black and white circles are methylated CG dinucleotides, and non-methylated CpG dinucleotides and TG dinucleotides, respectively.</p>
               </text>
               <graphic file="1471-2407-6-55-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>CCNA1 methylation incidence during multistep cervical carcinogenesis</p>
            </st>
            <p>Cervical intraepithelial neoplasia provides a crucial model to study the multistep process of carcinogenesis. Therefore, we evaluated the frequency of CCNA1 methylation in several cervical epithelial tissues with a distinctive degree of malignant transformation, normal cervix, CIN, microinvasive and CC, respectively. We selected 43, 25 and 30 cases of white blood cells (WBC), normal cervical biopsies and invasive CCs, respectively (Table <tblr tid="T2">2</tblr>). Among these samples, 13 WBC samples and 6 normal cervical samples, located at least 3 cm from the tumor margin and showing the absence of HPV DNA, originated from CC patients. For all cases, when a methylated amplicon was visible and the methylation percentage measured exceeded 5%, the test was deemed positive. All selected CCs were squamous and positive for HPV. Of the cases, 24 harbored HPV type 16, 4 had HPV type 18 and 2 cases displayed unclassifiable HPV types. Interestingly, a high frequency of methylation was exclusively present in CCs, i.e., 28 cases or 93.3% (Fig. <figr fid="F4">4A,B</figr> and Table <tblr tid="T2">2</tblr>). To reveal multistep carcinogenesis, we included 24 cases of SILs and 5 microinvasive cancers from exfoliated cervical cells. All cases were positive for oncogenic HPV, analyzed by Hybrid Capture 2. Whereas 60% and 36.6% of the microinvasive cancers and high SILs, respectively, demonstrated <it>CCNA1 </it>methylation, none of the HPV-associated low SILs exhibited these epigenetic changes (Fig. <figr fid="F4">4B</figr> and Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p><it>CCNA1 </it>methylation and clinico-pathological correlation</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>Histological characteristics</p>
                     </c>
                     <c ca="center">
                        <p>Total number of cases</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p><it>CCNA1 </it>promoter hypermethylation</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Absent</p>
                     </c>
                     <c ca="center">
                        <p>Present</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>WBC</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Normal cervix</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Low-grade SIL</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>High-grade SIL</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Microinvasive cancer</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Squamous cell CC</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>FIGO stage I-IIA</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>FIGO stage IIB-IV</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Grade 1, keratinized type</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Grade 2, non-keratinized type</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>FIGO, International Federation of Gynecology and Obstetrics.</p>
               </tblfn>
            </tbl>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Schematic representation of methylation-specific PCR in CC</p>
               </caption>
               <text>
                  <p>Schematic representation of methylation-specific PCR in CC. (A) PCR analysis of CC: M, DNA size marker; Neg, water; N and T, matched normal cervices and tumors, respectively. (B) Bar graph demonstrating the frequency of DNA methylation. Numbers on the y-axis are the percentage of positive methylation cases. Sample types are on the x-axis. WBC, normal cervix, Low-grade SIL, High-grade SIL, microinvasive cancer and squamous cell CCs number are 43, 25, 13, 11, 5, and 30, respectively. The methylation frequencies of each tissue type are represented by the height of each rectangular bar. </p>
               </text>
               <graphic file="1471-2407-6-55-4"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>This study demonstrated that: (i) <it>CCNA1 </it>promoter hypermethylation in HPV-associated squamous cell CC is unusually common; (ii) it is specific to CC; and (iii) the methylation is more common in invasive phenotypes compared to other histopathological stages during multistep carcinogenesis. This finding identifies both the interesting biology of CC and a potential clinical application of <it>CCNA1 </it>methylation as an additional molecular marker for the early diagnosis of invasive CC.</p>
         <p>Annual cytology screening has dramatically increased the effectiveness of early CC detection. Nonetheless, additional tests will help to improve the sensitivity and specificity of a single Papanicolaou smear for histological analysis. Recently, testing for oncogenic HPVs has been introduced to aid in the triage of women with atypical squamous cells of undetermined significance (ASCUS). <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> However, because the majority of patients with HPV-associated lesions do not progress to invasive cancer, several studies have attempted to add a panel of tumor suppressor gene methylations to improve the effectiveness of molecular cytological diagnosis. <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp> Since the frequency of <it>CCNA1 </it>methylation is high and specific to invasive CC, this gene should be a good candidate to increase the coverage rate for early cancer detection.</p>
         <p>In HNSCC, <it>CCNA1 </it>promoter hypermethylation is inversely related to <it>TP53 </it>mutation. <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> Nonetheless, the frequency of <it>CCNA1 </it>promoter hypermethylation in CC is high, whereas the function of TP53 in CC is usually impaired as a consequence of protein degradation induced by binding of the viral E6 protein. <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> This observation may be due to either differences in tissue types or pathophysiological outcomes of <it>TP53 </it>between mutations and diminution of the protein function subsequent to E6 binding. We prefer the latter hypothesis, since <it>TP53 </it>and <it>CCNA1 </it>have been shown to augment each other's expression. <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp> Consequently, the CCNA1 protein could help to increase physiologic TP53 to counter the function of E6, except for cases of <it>TP53 </it>mutation. In other words, alterations of both <it>CCNA1 </it>and <it>TP53 </it>in HNSCC will be redundant. In contrast, in CC, a decrease in CCNA1 protein should prevent the increment of TP53 that would have compensated for the protein destruction by E6.</p>
         <p>Multistep process analysis revealed that <it>CCNA1 </it>methylation is remarkably specific for cervical carcinogenesis. The biological function of CCNA1 is to activate DNA breakage repair by mechanisms depending on CDK2 activity and Ku proteins. <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> It is interesting to hypothesize why the genomic instability, triggered by impairment of the CCNA1 function, is crucial as an early event in CC development. Perhaps the rate of spontaneous mutations in cervical epithelial cells is too low to accumulate sufficient malignancy-transformation-dependent oncogene and tumor suppressor gene mutations if the cells possess fully functional CCNA1. Therefore, the frequency of invasive CC devoid of <it>CCNA1 </it>methylation is limited.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>This study demonstrates the strong association between <it>CCNA1 </it>promoter hypermethylation and invasive HPV-associated CC indicates that this gene could serve as an effective molecular marker. Moreover, our finding, in comparison with previous reports, <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp> also suggests that there is a possible molecular link between oncogenic HPVs, TP53 and <it>CCNA1 </it>promoter hypermethylation.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CC: cervical cancer, CCNA1: cyclin A1, SILs: squamous intraepithelial lesions, HPV: <it>Human papillomavirus</it>, WBC: white blood cell</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>NK: Perform all experiments, data analysis and write the article. PY: set up duplex MSP experiment, CP: collecting and HPV analysis of CIN, SK, ST, PT, WT, DT and SN: collect clinical samples and data, AM: Hypothesize, design and analyze the experiments and write the article</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We would like to thank the entire staff of the Department of Obstetrics and Gynecology for their assistance in collecting and providing the tissue samples, Drs. Virote Sriuranpong and Gutkind JS, Kiat Ruxrungthum, and Mathurose Ponglikitmongkol for the CC cell lines, HeLa(S), HeLa(K) and SiHa, respectively, peripheral nerve research unit for assisting in microdissection and Dr. Virote Sriuranpong, Ms Petra Hirsch, Mrs. Nita Suyarnsestakorn and Asia Science Editing for language editing the manuscript. This work has been supported by the National Center for Biotechnology and Genetic Engineering (Thailand), The Royal Golden Jubilee Ph.D. program, the Thailand Research Funds and the Molecular Biology and Genetics of Cancer Development research unit, Chulalongkorn University.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Estimates of the worldwide mortality from 25 cancers in 1990</p>
            </title>
            <aug>
               <au>
                  <snm>Pisani</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Parkin</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Bray</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ferlay</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>1999</pubdate>
            <volume>83</volume>
            <issue>1</issue>
            <fpage>18</fpage>
            <lpage>29</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1097-0215(19990924)83:1&lt;18::AID-IJC5>3.0.CO;2-M</pubid>
                  <pubid idtype="pmpid" link="fulltext">10449602</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Human papillomavirus type 16 (HPV 16) gene expression and DNA replication in cervical neoplasia: analysis by in situ hybridization</p>
            </title>
            <aug>
               <au>
                  <snm>Durst</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Glitz</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schneider</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>zur Hausen</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1992</pubdate>
            <volume>189</volume>
            <issue>1</issue>
            <fpage>132</fpage>
            <lpage>140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(92)90688-L</pubid>
                  <pubid idtype="pmpid">1318602</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group</p>
            </title>
            <aug>
               <au>
                  <snm>Bosch</snm>
                  <fnm>FX</fnm>
               </au>
               <au>
                  <snm>Manos</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Munoz</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sherman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jansen</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Peto</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schiffman</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Moreno</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Kurman</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Shah</snm>
                  <fnm>KV</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>1995</pubdate>
            <volume>87</volume>
            <issue>11</issue>
            <fpage>796</fpage>
            <lpage>802</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7791229</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Papillomaviruses and cancer: from basic studies to clinical application</p>
            </title>
            <aug>
               <au>
                  <snm>zur Hausen</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Nat Rev Cancer</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <issue>5</issue>
            <fpage>342</fpage>
            <lpage>350</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrc798</pubid>
                  <pubid idtype="pmpid" link="fulltext">12044010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The 1988 Bethesda System for reporting cervical/vaginal cytological diagnoses. National Cancer Institute Workshop</p>
            </title>
            <source>Jama</source>
            <pubdate>1989</pubdate>
            <volume>262</volume>
            <issue>7</issue>
            <fpage>931</fpage>
            <lpage>934</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/jama.262.7.931</pubid>
                  <pubid idtype="pmpid">2754794</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Persistent human papillomavirus infection and cervical neoplasia</p>
            </title>
            <aug>
               <au>
                  <snm>Ferenczy</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Franco</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Lancet Oncol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <issue>1</issue>
            <fpage>11</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1470-2045(01)00617-9</pubid>
                  <pubid idtype="pmpid">11905599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A distinct cyclin A is expressed in germ cells in the mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Sweeney</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kubelka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ravnik</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Hawkins</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Wolgemuth</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Carrington</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>1996</pubdate>
            <volume>122</volume>
            <issue>1</issue>
            <fpage>53</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8565853</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Cyclin A1 is required for meiosis in the male mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Matzuk</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Sung</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Guo</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wolgemuth</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>1998</pubdate>
            <volume>20</volume>
            <issue>4</issue>
            <fpage>377</fpage>
            <lpage>380</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/3855</pubid>
                  <pubid idtype="pmpid" link="fulltext">9843212</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Characterization of a second human cyclin A that is highly expressed in testis and in several leukemic cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Morosetti</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Koeffler</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1997</pubdate>
            <volume>57</volume>
            <issue>5</issue>
            <fpage>913</fpage>
            <lpage>920</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9041194</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Cyclin A1 protein shows haplo-insufficiency for normal fertility in male mice</p>
            </title>
            <aug>
               <au>
                  <snm>van der Meer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Palazon</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Nieduszynski</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sobczak-Thepot</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Carrington</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Colledge</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Reproduction</source>
            <pubdate>2004</pubdate>
            <volume>127</volume>
            <issue>4</issue>
            <fpage>503</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1530/rep.1.00131</pubid>
                  <pubid idtype="pmpid" link="fulltext">15047941</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Differential gene expression in p53-mediated apoptosis-resistant vs. apoptosis-sensitive tumor cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Maxwell</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>GE</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2000</pubdate>
            <volume>97</volume>
            <issue>24</issue>
            <fpage>13009</fpage>
            <lpage>13014</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">27169</pubid>
                  <pubid idtype="pmpid" link="fulltext">11069295</pubid>
                  <pubid idtype="doi">10.1073/pnas.230445997</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Global gene expression profile of nasopharyngeal carcinoma by laser capture microdissection and complementary DNA microarrays</p>
            </title>
            <aug>
               <au>
                  <snm>Sriuranpong</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mutirangura</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Amornphimoltham</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Molinolo</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Kerekhanjanarong</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Supanakorn</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Supiyaphun</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rangdaeng</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Voravud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Gutkind</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Clin Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>15</issue>
            <fpage>4944</fpage>
            <lpage>4958</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/1078-0432.CCR-03-0757</pubid>
                  <pubid idtype="pmpid" link="fulltext">15297395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Inverse correlation between cyclin A1 hypermethylation and p53 mutation in head and neck cancer identified by reversal of epigenetic silencing</p>
            </title>
            <aug>
               <au>
                  <snm>Tokumaru</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamashita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Osada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nomoto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hoque</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Westra</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Califano</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Sidransky</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>64</volume>
            <issue>17</issue>
            <fpage>5982</fpage>
            <lpage>5987</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-0993</pubid>
                  <pubid idtype="pmpid" link="fulltext">15342377</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The cyclin A1-CDK2 complex regulates DNA double-strand break repair</p>
            </title>
            <aug>
               <au>
                  <snm>Muller-Tidow</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ji</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Diederichs</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Potratz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Baumer</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kohler</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Cauvet</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Choudary</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>van der Meer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Nieduszynski</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Colledge</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Carrington</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Koeffler</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Restle</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wiesmuller</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Sobczak-Thepot</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Berdel</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Serve</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <issue>20</issue>
            <fpage>8917</fpage>
            <lpage>8928</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">517883</pubid>
                  <pubid idtype="pmpid" link="fulltext">15456866</pubid>
                  <pubid idtype="doi">10.1128/MCB.24.20.8917-8928.2004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Methylation profile of the promoter CpG islands of 31 genes that may contribute to colorectal carcinogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Xu</snm>
                  <fnm>XL</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>HY</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Gu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Du</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Shi</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>ZH</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>World J Gastroenterol</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>23</issue>
            <fpage>3441</fpage>
            <lpage>3454</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15526363</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Frequent p53 mutations in head and neck cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Somers</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Merrick</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Lopez</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Incognito</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Schechter</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Casey</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1992</pubdate>
            <volume>52</volume>
            <issue>21</issue>
            <fpage>5997</fpage>
            <lpage>6000</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1394225</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>The role of TP53 in Cervical carcinogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Tommasino</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Accardi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Caldeira</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dong</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Malanchi</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Smet</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zehbe</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2003</pubdate>
            <volume>21</volume>
            <issue>3</issue>
            <fpage>307</fpage>
            <lpage>312</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.10178</pubid>
                  <pubid idtype="pmpid" link="fulltext">12619117</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>The role of the E6-p53 interaction in the molecular pathogenesis of HPV</p>
            </title>
            <aug>
               <au>
                  <snm>Thomas</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pim</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Banks</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>1999</pubdate>
            <volume>18</volume>
            <issue>53</issue>
            <fpage>7690</fpage>
            <lpage>7700</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1202953</pubid>
                  <pubid idtype="pmpid" link="fulltext">10618709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Telomerase activity and human papillomavirus in malignant, premalignant and benign cervical lesions</p>
            </title>
            <aug>
               <au>
                  <snm>Mutirangura</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sriuranpong</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Termrunggraunglert</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Tresukosol</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lertsaguansinchai</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Voravud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Niruthisard</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Br J Cancer</source>
            <pubdate>1998</pubdate>
            <volume>78</volume>
            <issue>7</issue>
            <fpage>933</fpage>
            <lpage>939</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9764586</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Human papillomavirus DNA in plasma of patients with cervical cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Pornthanakasem</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Shotelersuk</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Termrungruanglert</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Voravud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Niruthisard</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mutirangura</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>BMC Cancer</source>
            <pubdate>2001</pubdate>
            <volume>1</volume>
            <issue>1</issue>
            <fpage>2</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">32170</pubid>
                  <pubid idtype="pmpid" link="fulltext">11244579</pubid>
                  <pubid idtype="doi">10.1186/1471-2407-1-2</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Human papillomavirus testing methods</p>
            </title>
            <aug>
               <au>
                  <snm>Hubbard</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Arch Pathol Lab Med</source>
            <pubdate>2003</pubdate>
            <volume>127</volume>
            <issue>8</issue>
            <fpage>940</fpage>
            <lpage>945</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12873165</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers</p>
            </title>
            <aug>
               <au>
                  <snm>Resnick</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Cornelissen</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Eichinger</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Fox</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>ter Schegget</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Manos</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>1990</pubdate>
            <volume>82</volume>
            <issue>18</issue>
            <fpage>1477</fpage>
            <lpage>1484</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2167986</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Genital human papillomavirus infection in female university students as determined by a PCR-based method</p>
            </title>
            <aug>
               <au>
                  <snm>Bauer</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Ting</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Greer</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Chambers</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Tashiro</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Chimera</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reingold</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Manos</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Jama</source>
            <pubdate>1991</pubdate>
            <volume>265</volume>
            <issue>4</issue>
            <fpage>472</fpage>
            <lpage>477</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/jama.265.4.472</pubid>
                  <pubid idtype="pmpid">1845912</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands</p>
            </title>
            <aug>
               <au>
                  <snm>Herman</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Graff</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Myohanen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nelkin</snm>
                  <fnm>BD</fnm>
               </au>
               <au>
                  <snm>Baylin</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <issue>18</issue>
            <fpage>9821</fpage>
            <lpage>9826</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">38513</pubid>
                  <pubid idtype="pmpid" link="fulltext">8790415</pubid>
                  <pubid idtype="doi">10.1073/pnas.93.18.9821</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Distinctive pattern of LINE-1 methylation level in normal tissues and the association with carcinogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Chalitchagorn</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shuangshoti</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hourpai</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kongruttanachok</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Tangkijvanich</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thong-ngam</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Voravud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sriuranpong</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mutirangura</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <issue>54</issue>
            <fpage>8841</fpage>
            <lpage>8846</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1208137</pubid>
                  <pubid idtype="pmpid" link="fulltext">15480421</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Analyses of the genomic methylation status of the human cyclin A1 promoter by a novel real-time PCR-based methodology</p>
            </title>
            <aug>
               <au>
                  <snm>Muller-Tidow</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bornemann</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Diederichs</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Westermann</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Klumpen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zuo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Berdel</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Serve</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>2001</pubdate>
            <volume>490</volume>
            <issue>1-2</issue>
            <fpage>75</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0014-5793(01)02128-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">11172814</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Methylation of the cyclin A1 promoter correlates with gene silencing in somatic cell lines, while tissue-specific expression of cyclin A1 is methylation independent</p>
            </title>
            <aug>
               <au>
                  <snm>Muller</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Readhead</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Diederichs</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Idos</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Tidow</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Serve</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Berdel</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Koeffler</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2000</pubdate>
            <volume>20</volume>
            <issue>9</issue>
            <fpage>3316</fpage>
            <lpage>3329</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">85625</pubid>
                  <pubid idtype="pmpid" link="fulltext">10757815</pubid>
                  <pubid idtype="doi">10.1128/MCB.20.9.3316-3329.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Atypical squamous cells of undetermined significance in liquid-based cytologic specimens: results of reflex human papillomavirus testing and histologic follow-up in routine practice with comparison of interpretive and probabilistic reporting methods</p>
            </title>
            <aug>
               <au>
                  <snm>Levi</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Kelly</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Rosenthal</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Ronnett</snm>
                  <fnm>BM</fnm>
               </au>
            </aug>
            <source>Cancer</source>
            <pubdate>2003</pubdate>
            <volume>99</volume>
            <issue>4</issue>
            <fpage>191</fpage>
            <lpage>197</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/cncr.11507</pubid>
                  <pubid idtype="pmpid" link="fulltext">12925979</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Analysis of aberrant DNA methylation and human papillomavirus DNA in cervicovaginal specimens to detect invasive cervical cancer and its precursors</p>
            </title>
            <aug>
               <au>
                  <snm>Widschwendter</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gattringer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ivarsson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fiegl</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Schneitter</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ramoni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Wiedemair</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jerabek</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Muller-Holzner</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Goebel</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Marth</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Widschwendter</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Clin Cancer Res</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>10</issue>
            <fpage>3396</fpage>
            <lpage>3400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/1078-0432.CCR-03-0143</pubid>
                  <pubid idtype="pmpid" link="fulltext">15161694</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Detection of hypermethylated genes in women with and without cervical neoplasia</p>
            </title>
            <aug>
               <au>
                  <snm>Feng</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Balasubramanian</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hawes</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Toure</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sow</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Dem</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dembele</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Critchlow</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Xi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>McIntosh</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Kiviat</snm>
                  <fnm>NB</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>2005</pubdate>
            <volume>97</volume>
            <issue>4</issue>
            <fpage>273</fpage>
            <lpage>282</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15713962</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2407/6/55/prepub</url>
         </p>
      </sec>
   </bm>
</art>

