1471-2407-6-188 1471-2407 Research article <p>Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review</p> Balasubramanian SP s.p.balasubramanian@sheffield.ac.uk Azmy IAF i.azmy@doctors.net.uk Higham SE s.e.higham@shef.ac.uk Wilson AG a.g.wilson@shef.ac.uk Cross SS s.s.cross@shef.ac.uk Cox A a.cox@shef.ac.uk Brown NJ n.j.brown@shef.ac.uk Reed MW m.w.reed@shef.ac.uk

Academic Surgical Oncology Unit, University of Sheffield, Sheffield, UK

Academic Rheumatology Unit, University of Sheffield, Sheffield, UK

Academic Unit of Pathology, University of Sheffield, Sheffield, UK

Institute of Cancer Studies, University of Sheffield, Sheffield, UK

 BMC Cancer 1471-2407 2006 6 1 188 http://www.biomedcentral.com/1471-2407/6/188 1684261710.1186/1471-2407-6-188 23 1 2006 14 7 2006 14 7 2006 2006 Balasubramanian et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity.

Methods

Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer.

Results

None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised.

Conclusion

Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity.

Background

The role of cytokines in cancer immunity and carcinogenesis in general has been well established 1. Single nucleotide polymorphisms in specific candidate genes are thought to influence expression and/or activity of the encoding proteins thereby predisposing to solid cancers especially breast cancer 2. Many cytokine polymorphisms have been studied for associations with susceptibility to gastric cancer 345, liver cancer 67, lung cancer8, prostate cancer 9 and ovarian cancer 10 with mixed results.

The cytokines of the IL-1 family 11, IL-4 and its receptor 1213, IL-6 1415 and IL-10 1617 are important candidate genes as they play an important role in breast cancer pathogenesis. IL1-alpha promotes growth of breast cancer cells and cachexia 18. In breast cancer cells, IL1-beta increases the transcriptional activity of ER-alpha 19 which is a prognostic factor in breast cancer and the expression and stabilisation of IL-8 RNA 20 which is a potent angiogenic factor. IL-4 inhibits tumour growth by its anti-angiogenic effect 21 and inhibits growth and induces apoptosis of breast cancer cell lines in the presence of IL-4R 12. Circulating IL6 levels have been found to be higher in breast cancer patients compared to healthy controls and among those with breast cancer, correlate with the stage of the disease 14. IL10 is over expressed in breast tumours 16 and exogenous administration can mediate regression of tumour growth and breast cancer metastases in mice models 17.

The polymorphisms studied were selected in the light of previous reports of their effect on differential gene expression and/or disease susceptibility. The IL1A +4845 G>T polymorphism situated in exon 5 of the IL1A gene was described in 1993 22 and results in an Ala to Ser amino acid substitution at residue 114 of the proIL1α molecule. Pro IL1α is cleaved between amino acids 112 and 113 and it has been suggested that this polymorphism may affect the proteolytic process 23. The polymorphism is thought to influence C reactive protein levels in patients referred for coronary angiography 24 and influence the development of aggressive periodontitis in Chinese males 25. Three polymorphisms commonly studied in the IL1B gene include -511 and -31 in the promoter region and the +3954 in exon 5, all representing a C>T single nucleotide change. The -511C>T and the +3954C>T SNPs are thought to influence C reactive protein levels in healthy individuals 26 and the +3954C>T polymorphism has been shown to influence IL1β production by monocytes in vitro 27. The -511 polymorphism has been shown to be associated with vascular diseases such as stroke 28 and along with the +3954 polymorphisms has been extensively studied in gastric cancer 293031. The IL1RN +2018T>C polymorphism in exon 2 of the gene is in complete linkage disequilibrium with a penta-allelic 86 bp variable number of tandem repeat polymorphism in intron 2 of the gene which is strongly linked to increased production of IL1RA 32 and IL1β in vitro 33. The penta-allelic polymorphism has been studied in several cancers including gastric cancer 293031, lung cancer 34, ovarian cancer 35 and cervical cancer 36. The +2018 SNP itself has been linked with Barrett's oesophagus and oesophageal cancer 37. The IL4R 1902A>G polymorphism is an A to G transition at nucleotide 1902, causing a change in amino acid from glutamine to arginine at codon 576 in the interleukin-4 receptor alpha protein. This seems to alter the signalling function of the receptor, thereby predisposing carriers to disease 38. Preliminary studies show some association of this polymorphism with Crohn's disease 39 and adult asthma 40. The polymorphism has also been associated with an increased risk of renal cancer 41. The IL6 -174G>C polymorphism in the 5' flanking region of the gene was initially reported in 1998 to influence IL6 expression and plasma levels (the -174C allele associated with lower expression and lower levels) 42. Subsequent studies of this polymorphism show that the -174C allele decreases susceptibility to systemic juvenile idiopathic arthritis 43 and increases the risk of coronary artery disease presumably through inflammatory mechanisms 4445. It also has been shown to increase the risk of bladder cancer 46, colorectal cancer 47 and Kaposi's sarcoma in HIV infected men 48. The IL10 -1082G>A polymorphism, situated in the promoter region of the gene, has been shown to influence IL10 protein production in vitro by concanavalin-A stimulated peripheral mononuclear cells 49. The G allele is associated with an increased risk of Crohn's disease 50 and thought to increase predisposition to lung cancer 51. The AA genotype has been shown to be associated with decreased survival in melanoma 52.

The aim of this study was to evaluate polymorphisms in specific cytokine genes [IL1A +4845G>T, IL1B -511C>T, IL1B +3954C>T, IL1RN +2018T>C, IL4R -1902A>G, IL6-174G>C and IL10-1082G>A] in a case control model to determine any associations with breast cancer susceptibility, severity and survival. A systematic review of the English language Medline literature through PubMed was performed to summarise all previous breast cancer related studies of the polymorphisms characterised in the current study.

Methods

Case-control study

The design and methodology of this case control study have previously been described 5354. Briefly, recruitment started in November 1998 and is ongoing. The cases include women diagnosed with breast cancer and being followed up at the Royal Hallamshire Hospital in Sheffield and Rotherham District General Hospital and controls were recruited from women attending the Sheffield Breast Screening Service. The study was restricted to white Caucasians, as there were insufficient individuals from other ethnic groups, for meaningful analysis. The South Sheffield Research Ethics Committee approved the study [Ref. no. SS98/137] and informed written consent was obtained from all subjects. Demographic, environmental risk factors and family history data were recorded for all breast cancer cases and mammography screening controls, using a standard questionnaire. Pathological data (including tumour grade, lymph node status and presence of vascular invasion) were obtained from medical records and validated by an experienced histopathologist (SSC). Data on disease recurrence and overall survival were obtained from the hospital records and the Trent Cancer Registry. The data was entered by trained personnel and stored in a Microsoft Access database and maintained by a dedicated database administrator. The data was validated for all the records (by SPB and database manager).

Genotyping methods

Genomic DNA was extracted from frozen EDTA preserved peripheral venous blood from all individuals, as described previously 55. The polymorphisms studied, along with the genes, location and unique ID is shown in Table 1. Genotyping of the polymorphisms was performed by the 5'nuclease PCR method, using the ABI/PE Biosystems Taqman™ system, essentially as described earlier 55. Using specific primer and probe sequences (Table 1), PCR amplification was carried out separately for the different polymorphisms. The final concentrations of the different constituents of the PCR mixture and the cycling temperatures for the various SNPs studied are shown in Tables 2 and 3. Levels of FAM and TET fluorescence were determined and allelic discrimination was carried out using the ABI 7200 Sequence Detector. Quality control for the genotyping results was achieved by using only 72 of the 96 wells in each of the plates for the individual DNA samples subjected to PCR. Six to eight wells were allotted to 'no sample' controls, 'common homozygous' controls and 'rare homozygous' controls each, in addition to retesting of samples with indeterminate results. The common and rare homozygous controls included samples tested before and shown to be 'common homozygous' and 'rare homozygous' respectively.

<p>Table 1</p>

Candidate single nucleotide polymorphisms (SNPs) and their respective probes and primers

Gene

Location

SNP ID

Forward primer

Reverse primer

FAM probe

TET probe

IL-1A

+4845 G>T

rs17561

TGCACTTGTGATCATGGTTTTAGA

TCCTCATAAAGTTGTATTTCACATTGC

CAAGCCTAGGTCATCACCTTTTAGCTTCC

AAGCCTAGGTCAGCACCTTTTAGCTTCC

IL-1B

-511 C>T

rs16944

TTGAGGGTGTGGGTCTCTACCT

AGGAGCCTGAACCCTGCATAC

TTCTCTGCCTCGGGAGCTCTCTGT

TTCTCTGCCTCAGGAGCTCTCTGTCA

IL-1B

+3954 C>T

rs1143634

GCCTGCCCTTCTGATTTTATACC

CATCGTGCACATAAGCCTCGTTA

TTCAGAACCTATCTTCTTTGACACATGGGA

CAGAACCTATCTTCTTCGACACATGGGA

IL-1RN

+2018 T>C

rs419598

GGGATGTTAACCAGAAGACCTTCTATCT

CAACCACTCACCTTCTAAATTGACATT

AACAACCAACTAGTTGCTGGATACTTGCAA

ACAACCAACTAGTTGCCGGATACTTGC

IL-4R

+1902 A>G

rs1801275

AGGCTTGAGAAGGCCTTGTAA

CCGAAATGTCCTCCAGCAT

CATGTACAAACTCCTGATAGCCACTGGTG

CATGTACAAACTCCCGATAGCCACTGG

IL-6

-174 G>C

rs1800795

GCTGATTGGAAACCTTATTAAGATTGT

AATGACGACCTAAGCTGCACTTT

ACGTCCTTTAGCATCGCAAGACACAAC

ACGTCCTTTAGCATGGCAAGACACAAC

IL-10

-1082 G>A

rs1800896

GATAGGAGGTCCCTTACTTTCCTCTTA

CACACACAAATCCAAGACAACACTAC

CTACTTCCCCCTCCCAAAGAAGCCT

CCTACTTCCCCTTCCCAAAGAAGCC

Note: All sequences are from 5' end to 3' end.

 <p>Table 2</p>

Final concentration of the different constituents of the PCR mixture

PCR constituents

Final concentrations for the various SNPs

IL1A +4845

IL1B -511

IL1B +3954

IL1RN +2018

IL4R +1902

IL6 -174

IL10 -1082

Taqman mastermix (2X)

1X

1X

1X

1X

1X

1X

1X

Forward primer (10 μM)

500 nM

100 nM

300 nM

250 nM

50 nM

50 nM

50 nM

Reverse primer (10 μM)

500 nM

100 nM

300 nM

250 nM

500 nM

50 nM

300 nM

FAM probe (5 μM)

50 nM

50 nM

50 nM

30 nM

30 nM

30 nM

50 nM

TET probe (5 μM)

100 nM

100 nM

75 nM

150 nM

120 nM

60 nM

150 nM

Template (20 ng/μl)

0.8 ng/μl

0.8 ng/μl

0.8 ng/μl

0.8 ng/μl

0.8 ng/μl

0.8 ng/μl

0.8 ng/μl

Taqman mastermix: Universal PCR mastermix (PE Biosystems) containing MgCl2, dNTPs, Taq polymerase, optimised buffer components and Rox reference dye; FAM probe: 6-carboxy-fluorescein-labelled probe; TET: 6-carboxy-4,7,2',7'-tetrechlorofluorescein-labelled probe.

 <p>Table 3</p>

Cycling conditions for the PCRs for the different polymorphisms

Steps

Time

Temperature for the various SNPs

IL1A +4845

IL1B -511

IL1B +3954

IL1RN +2018

IL4R +1902

IL6 -174

IL10 -1082

1

2 minutes

50°C

50°C

50°C

50°C

50°C

50°C

50°C

2

10 minutes

95°C

95°C

95°C

95°C

95°C

95°C

95°C

3

15 seconds

95°C

95°C

95°C

95°C

95°C

95°C

95°C

4

1 minutes

59°C

59°C

61°C

64°C

61°C

62°C

62°C

5

40 times

Go to step 3

Go to step 3

Go to step 3

Go to step 3

Go to step 3

Go to step 3

Go to step 3

6

Hold

15°C

15°C

15°C

15°C

15°C

15°C

15°C

Methodology for systematic review

A Medline search was conducted on 26th September 2005 with the following search strategy: (("interleukins"[TIAB] NOT Medline [SB]) OR "interleukins"[MeSH Terms] OR interleukin[Text Word]) OR (("cytokines"[TIAB] NOT Medline[SB]) OR "cytokines"[MeSH Terms] OR cytokine[Text Word]) AND ("genetic polymorphism"[Text Word] OR "polymorphism, genetic"[MeSH Terms] OR polymorphism[Text Word]) OR SNP[All Fields] AND (("neoplasms"[TIAB] NOT Medline[SB]) OR "neoplasms"[MeSH Terms] OR cancer[Text Word]) AND English[Lang]. Only articles on the polymorphisms evaluated in this study were included for the purposes of the review and their results are summarised in the discussion.

Data processing and analysis

All data were entered initially into a Microsoft Access database and exported to SPSS (version 12.0.1 for Windows) for statistical analyses. Chi-square test for trend was performed to compare the genotype frequencies (1:1, 1:2 and 2:2 representing the common homozygous, heterozygous and the rare heterozygous respectively) between cases and controls and also for comparison of the genotype frequencies among the various subgroups of breast cancer. Kaplan Meier curves and the log rank test was used for the survival analyses. All tests were two sided. Haplotype analysis was then performed on the genotype data of the four polymorphisms (IL1A +4845G>T, IL1B +3954C>T, IL1B -511C>T and IL1RN +2018T>C) in chromosomal region 2q13 using Haploview 56.

Results

The demographic characteristics and comparability of case and control cohorts have been reported previously 5354. Briefly, the case and control groups were all Caucasian and female. There were no significant differences in the percentage of postmenopausal women, age at menarche and age at menopause between the cancer and control groups. The women in the control groups were however younger [median (IQR) of 57 (53–61) in the control group vs. 63 (54–70) in the cancer group; p < 0.001; Mann-Whitney U test], were younger when first pregnant [median (IQR) of 23 (20–26) in the control group vs. 24 (21–27) in the cancer group; p < 0.001; Mann-Whitney U test], had more children [median (IQR) of 2 (2–3) in the control group vs. 2 (1–3) in the cancer group; p < 0.001; Mann-Whitney U test], were less likely to have a family history of breast cancer [22.2% in controls vs. 27.4% in cancers; p = 0.007; Chi-square test] and were more likely not to have smoked [63.1% in controls vs. 53.4% in cancers; p < 0.001; Chi-square test].

Table 4 shows the total numbers, the observed frequencies and the expected genotype frequencies (expected genotype frequencies were calculated from the respective allele frequencies) in the control population and the testing for the Hardy Weinberg Equilibrium. The observed frequencies of the genotypes for all polymorphisms are not significantly different from the expected frequencies except for the IL1A +4845 and the IL4R +1902 polymorphisms.

<p>Table 4</p>

Observed and Expected genotype frequencies and the HardyWeinberg Equilibrium in the control population

SNP

Controls (n)

Observed Genotype Frequency

Allele Frequency (in %)

Expected Genotype Frequency

Chi-square Goodness of fit test statistic (p value)

1:1

1:2

2:2

1

2

1:1

1:2

2:2

2:2

IL1A +4845

498

215

245

38

67.8

32.2

229

217

52

χ2 = 7.49; p = 0.01

IL1B -511

489

232

206

51

66.5

31.5

230

211

48

χ2 = 0.20; p = 0.66

IL1B +3954

420

231

167

22

74.9

25.1

235

158

27

χ2 = 1.13; p = 0.29

IL1RN +2018

490

247

202

41

71

29

247

202

41

χ2 = 0; p = 0.95

IL4R +1902

767

451

288

28

77.6

22.4

461

267

39

χ2 = 4.45; p = 0.03

IL6 -174

490

168

235

87

58.3

41.7

167

238

85

χ2 = 0.06; p = 0.81

IL10 -1082

498

117

260

121

49.6

50.4

123

249

126

χ2 = 0.85; p = 0.36

The comparison of genotype frequencies between the control and cancer groups for each of the polymorphisms (along with the actual numbers studied) are shown in Table 5. In addition to overall comparisons, the genotype frequencies were compared in subgroups classified according to family history and age at diagnosis. Table 6 shows the genotype frequencies for the seven polymorphisms within subgroups of invasive breast cancer (defined by tumour grade, nodal status and vascular invasion). Figures 1, 2, 3, 4, 5, 6, 7, 8 show survival curves demonstrating that none of the polymorphisms had any impact on time to death or development of metastases in those with invasive breast cancer.

<p>Table 5</p>

Genotype frequencies of the seven polymorphisms in subgroups of breast cancer and control populations

Subsets

Case/control

Genotype Frequencies (%)

Chi square test for trend (p value)

1:1

1:2

2:2

IL1A +4845 G>T

Overall

Cancers (n = 697)

360 (51.6%)

275 (39.5%)

62 (8.9%)

X2 = 3.71; p = 0.05

Controls (n = 498)

215 (43.2%)

245 (49.2%)

38 (7.6%)

Positive Family History

Cancers (n = 192)

106 (55.2%)

71 (37%)

15 (7.8%)

X2 = 2.74; p = 0.10

Controls (n = 104)

44 (42.3%)

52 (50%)

8 (7.7%)

Negative Family History

Cancers (n = 505)

254 (50.3%)

204 (40.4%)

47 (9.3%)

X2 = 1.47; p = 0.23

Controls (n = 394)

171 (43.4%)

193 (49%)

30 (7.6%)

Young cancers vs. controls

Cancers (n = 113)

55 (48.7%)

43 (38%)

15 (13.3%)

X2 = 0; p = 0.98

Controls (n = 498)

215 (43.2%)

245 (49.2%)

38 (7.6%)

IL1B -511 C>T

Overall

Cancers (n = 703)

339 (48.2%)

294 (41.8%)

70 (10%)

X2 = 0.10; p = 0.75

Controls (n = 489)

232 (47.4%)

206 (42.1%)

51 (10.4%)

Positive Family History

Cancers (n = 195)

96 (49.2%)

85 (43.6%)

14 (7.2%)

X2 = 0.45; p = 0.51

Controls (n = 103)

48 (46.6%)

45 (43.7%)

10 (9.7%)

Negative Family History

Cancers (n = 508)

243 (47.8%)

209 (41.1%)

56 (11%)

X2 = 0.003; p = 0.96

Controls (n = 386)

184 (47.7%)

161 (41.7%)

41 (10.6%)

Young cancers vs. controls

Cancers (n = 115)

55 (47.8%)

49 (42.6%)

11 (9.6%)

X2 = 0.033; p = 0.86

Controls (n = 489)

232 (47.4%)

206 (42.1%)

51 (10.4%)

IL1B +3954 C>T

Overall

Cancers (n = 691)

410 (59.3%)

242 (35%)

39 (5.6%)

X2 = 1.12; p = 0.29

Controls (n = 420)

231 (55%)

167 (39.8%)

22 (5.2%)

Positive Family History

Cancers (n = 193)

129 (66.8%)

55 (28.5%)

9 (4.7%)

X2 = 8.75; p = 0.003*

Controls (n = 91)

43 (47.3%)

41 (45.1%)

7 (7.7%)

Negative Family History

Cancers (n = 498)

281 (56.4%)

187 (37.6%)

30 (6%)

X2 = 0.26; p = 0.61

Controls (n = 329)

188 (57.1%)

126 (38.3%)

15 (4.6%)

Young cancers vs. controls

Cancers (n = 112)

64 (57.1%)

41 (36.6%)

7 (6.3%)

X2 = 0.03; p = 0.86

Controls (n = 420)

231 (55%)

167 (39.8%)

22 (5.2%)

IL1RN +2018 T>C

Overall

Cancers (n = 697)

349 (50.1%)

286 (41%)

62 (8.9%)

X2 = 0.05; p = 0.82

Controls (n = 490)

247 (50.4%)

202 (41.2%)

41 (8.4%)

Positive Family History

Cancers (n = 193)

94 (48.7%)

84 (43.5%)

15 (7.8%)

X2 = 0.074; p = 0.79

Controls (n = 103)

48 (46.6%)

47 (45.6%)

8 (7.8%)

Negative Family History

Cancers (n = 504)

255 (50.6%)

202 (40.1%)

47 (9.3%)

X2 = 0.14; p = 0.71

Controls (n = 387)

199 (51.4%)

155 (40.1%)

33 (8.5%)

Young cancers vs. controls

Cancers (n = 113)

61 (54%)

44 (38.9%)

8 (7.1%)

X2 = 0.53; p = 0.47

Controls (n = 490)

247 (50.4%)

202 (41.2%)

41 (8.4%)

IL4R +1902 A>G

Overall

Cancers (n = 775)

493 (63.6%)

249 (32.1%)

33 (4.3%)

X2 = 2.1; p = 0.15

Controls (n = 767)

451 (58.8%)

288 (37.5%)

28 (3.7%)

Positive Family History

Cancers (n = 212)

133 (62.7%)

70 (33%)

9 (4.2%)

X2 = 0.19; p = 0.66

Controls (n = 168)

98 (58.3%)

66 (39.3%)

4 (2.4%)

Negative Family History

Cancers (n = 563)

360 (63.9%)

179 (31.8%)

24 (4.3%)

X2 = 2.00; p = 0.16

Controls (n = 599)

353 (58.9%)

222 (37.1%)

24 (4.0%)

Young cancers vs. controls

Cancers (n = 122)

85 (69.7%)

36 (29.5%)

1 (0.8%)

X2 = 6.36; p = 0.012*

Controls (n = 767)

451 (58.8%)

288 (37.5%)

28 (3.7%)

IL6 -174 G>C

Overall

Cancers (n = 497)

170 (34.2%)

244 (49.1%)

83 (16.7%)

X2 = 0.05; p = 0.83

Controls (n = 490)

168 (34.3%)

235 (48%)

87 (17.8%)

Positive Family History

Cancers (n = 127)

47 (37%)

55 (43.3%)

25(19.7%)

X2 = 0.20; p = 0.66

Controls (n = 102)

38 (37.3%)

48 (47.1%)

16(15.7%)

Negative Family History

Cancers (n = 370)

123 (33.2%)

189 (51.1%)

58 (15.7%)

X2 = 1.22; p = 0.64

Controls (n = 388)

130 (33.5%)

187 (48.2%)

71 (18.3%)

Young cancers vs. controls

Cancers (n = 85)

36 (42.4%)

31 (36.5%)

18 (21.2%)

X2 = 0.31; p = 0.58

Controls (n = 490)

168 (34.3%)

235 (48%)

87 (17.8%)

IL10 -1082 G>A

Overall

Cancers (n = 497)

121 (24.3%)

253 (50.9%)

123 (24.7%)

X2 = 0.01; p = 0.93

Controls (n = 498)

117 (23.5%)

260 (52.2%)

121 (24.3%)

Positive Family History

Cancers (n = 126)

31 (24.6%)

69 (54.8%)

26 (20.6%)

X2 = 0.39; p = 0.54

Controls (n = 104)

31 (29.8%)

52 (50%)

21 (20.2%)

Negative Family History

Cancers (n = 371)

90 (24.3%)

184 (49.6%)

97 (26.1%)

X2 = 0.11; p = 0.74

Controls (n = 394)

86 (21.8%)

208 (52.8%)

100 (25.4%)

Young cancers vs. controls

Cancers (n = 84)

17 (20.2%)

44 (52.4%)

23 (27.4%)

X2 = 0.60; p = 0.44

Controls (n = 498)

117 (23.5%)

260 (52.2%)

121 (24.3%)

Note: Family history: either first or second degree relative with breast cancer. Young cancer patients: </=50 years of age

 <p>Table 6</p>

Genotype frequencies of the seven polymorphisms in subgroups of invasive breast cancer.

Tumour Severity

Subgroups

Genotype frequencies (%)

Chi square test for trend (P value)

1:1

1:2

2:2

IL1A +4845 G>T

Tumour Grade

Grade 1 (n = 122)

62 (50.8%)

50 (41%)

10 (8.2%)

X2 = 0.037; p = 0.85

Grade 2 (n = 283)

151 (53.4%)

109 (38.5%)

23 (8.1%)

Grade 3 (n = 216)

115 (53.2%)

82 (38%)

19 (8.8%)

Nodal Involvement

Absent (n = 430)

204 (47.4%)

118 (43.7%)

38 (8.8%)

X2 = 4.75; p = 0.03*

Present (n = 117)

117 (59.4%)

63 (32%)

17 (8.6%)

Vascular Invasion

Absent (n = 467)

243 (52%)

185 (39.6%)

39 (8.4%)

X2 = 0.058; p = 0.81

Present (n = 117)

64 (54.7%)

42 (35.9%)

11 (9.4%)

IL1B -511 C>T

Tumour Grade

Grade 1 (n = 126)

51 (40.5%)

59 (46.8%)

16 (12.7%)

X2 = 0.12; p = 0.73

Grade 2 (n = 284)

150 (52.8%)

111 (39.1%)

23 (8.1%)

Grade 3 (n = 216)

98 (45.4%)

93 (43.1%)

25 (11.6%)

Nodal Involvement

Absent (n = 434)

214 (49.3%)

179 (41.2%)

41 (9.4%)

X2 = 0.79; p = 0.37

Present (n = 198)

90 (45.5%)

87 (43.9%)

21 (10.6%)

Vascular Invasion

Absent (n = 473)

224 (47.4%)

201 (42.5%)

48 (10.1%)

X2 = 0.38; p = 0.54

Present (n = 116)

57 (49.1%)

50 (43.1%)

9 (7.8%)

IL1B +3954 C>T

Tumour Grade

Grade 1 (n = 121)

68 (56.2%)

48 (39.7%)

5 (4.1%)

X2 = 0.053; p = 0.82

Grade 2 (n = 279)

173 (62%)

90 (32.3%)

16 (5.7%)

Grade 3 (n = 215)

131 (60.9%)

70 (32.6%)

14 (6.5%)

Nodal Involvement

Absent (n = 427)

244 (57.1%)

161 (37.7%)

22 (5.2%)

X2 = 0.37; p = 0.54

Present (n = 194)

120 (61.9%)

61 (31.4%)

13 (6.7%)

Vascular Invasion

Absent (n = 464)

283 (61%)

157 (33.8%)

24 (5.2%)

X2 = 0.43; p = 0.51

Present (n = 114)

66 (57.9%)

41 (36%)

7 (6.1%)

IL1RN +2018 T>C

Tumour Grade

Grade 1 (n = 125)

55 (44%)

55 (44%)

15 (12%)

X2 = 0.73; p = 0.40

Grade 2 (n = 280)

150 (53.6%)

107 (38.2%)

23 (8.2%)

Grade 3 (n = 215)

108 (50.2%)

86 (40%)

21 (9.8%)

Nodal Involvement

Absent (n = 429)

216 (50.3%)

180 (42%)

33 (7.7%)

X2 = 0.11; p = 0.74

Present (n = 196)

102 (52%)

72 (36.7%)

22 (11.2%)

Vascular Invasion

Absent (n = 463)

232 (50.1%)

191 (41.3%)

40 (8.6%)

X2 = 1.34; p = 0.25

Present (n = 118)

67 (56.8%)

42 (35.6%)

9 (7.6%)

IL4R +1902 A>G

Tumour Grade

Grade 1 (n = 137)

87 (63.5%)

44 (32.1%)

6 (4.4%)

X2 = 0.14; p = 0.71

Grade 2 (n = 308)

195 (63.3%)

97 (31.5%)

16 (5.2%)

Grade 3 (n = 228)

146 (64%)

75 (32.9%)

7 (3.1%)

Nodal Involvement

Absent (n = 477)

313 (65.6%)

144 (30.2%)

20 (4.2%)

X2 = 0.11; p = 0.75

Present (n = 212)

135 (63.7%)

69 (32.5%)

8 (3.8%)

Vascular Invasion

Absent (n = 508)

316 (62.2%)

170 (33.5%)

22 (4.3%)

X2 = 0.002; p = 0.96

Present (n = 129)

82 (63.6%)

40 (31%)

7 (5.4%)

IL6 -174 G>C

Tumour Grade

Grade 1 (n = 80)

26 (32.5%)

38 (47.5%)

16 (20%)

X2 = 0.04; p = 0.84

Grade 2 (n = 204)

78 (38.2%)

95 (46.6%)

31 (15.2%)

Grade 3 (n = 159)

49 (30.8%)

83 (52.2%)

27 (17%)

Nodal Involvement

Absent (n = 293)

100 (34.1%)

141 (48.1%)

52 (17.7%)

X2 = 0.20; p = 0.66

Present (n = 143)

52 (36.4%)

67 (46.9%)

24 (16.8%)

Vascular Invasion

Absent (n = 325)

112 (34.5%)

159 (48.9%)

54 (16.6%)

X2 = 0.001; p = 0.98

Present (n = 85)

29 (34.1%)

42 (49.4%)

14 (16.5%)

IL10 -1082 G>A

Tumour Grade

Grade 1 (n = 80)

23 (28.8%)

37 (46.3%)

20 (25%)

X2 = 0.37; p = 0.54

Grade 2 (n = 205)

39 (19%)

113 (55.1%)

53 (25.9%)

Grade 3 (n = 158)

44 (27.8%)

79 (50%)

35 (22.2%)

Nodal Involvement

Absent (n = 293)

69 (23.5%)

148 (50.5%)

76 (25.9%)

X2 = 0.84; p = 0.36

Present (n = 143)

38 (26.6%)

73 (51%)

32 (22.4%)

Vascular Invasion

Absent (n = 325)

87 (26.8%)

156 (48%)

82 (25.2%)

X2 = 3.3; p = 0.07

Present (n = 85)

12 (14.1%)

49 (57.6%)

24 (28.2%)

<p>Figure 1</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1A +4845 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1A +4845 polymorphism. Log Rank test statistic = 1.52; df = 2; p = 0.47 (n = 482).

 <p>Figure 2</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1B -511 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1B -511 polymorphism. Log Rank test statistic = 5.07; df = 2; p = 0.08 (n = 484).

 <p>Figure 3</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1B +3954 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1B +3954 polymorphism. Log Rank test statistic = 2.71; df = 2; p = 0.26 (n = 479).

 <p>Figure 4</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1RN +2018 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL1RN +2018 polymorphism. Log Rank test statistic = 4.32; df = 2; p = 0.12 (n = 481).

 <p>Figure 5</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL4R +1902 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL4R +1902 polymorphism. Log Rank test statistic = 2.07; df = 2; p = 0.35 (n = 528).

 <p>Figure 6</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL6 -174 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL6 -174 polymorphism. Log Rank test statistic = 0.16; df = 2; p = 0.92 (n = 333).

 <p>Figure 7</p>

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL10 -1082 polymorphism

shows the time to death or metastases in invasive breast cancer for the genotypes of the IL10 -1082 polymorphism. Log Rank test statistic = 1.34; df = 2; p = 0.51 (n = 332).

 <p>Figure 8</p>

shows the linkage disequilibrium plot (obtained using Haploview) showing pairwise D' values (in percentage) between the four polymorphisms on chromosome 2q13

shows the linkage disequilibrium plot (obtained using Haploview) showing pairwise D' values (in percentage) between the four polymorphisms on chromosome 2q13. The markers 1, 2, 3 and 4 are IL1A +4845G>T, IL1B +3954C>T, IL1B -511 C>T and IL1RN +2018T>C respectively.

Further analyses of the four polymorphisms in the Interleukin-1 gene cluster (IL1A +4845G>T, IL1B +3954C>T, IL1B -511C>T and IL1RN +2018T>C) were done using Haploview. These four polymorphisms are situated a region of size 360 kb. The LD (linkage disequilibrium) values for the four pairs of SNPs (Figure 8) and the probable haplotypes with their frequencies (Table 7) have been calculated. None of the estimated haplotypes was associated with breast cancer in this cohort.

<p>Table 7</p>

Probable frequencies of the common haplotypes in the interleukin-1 gene cluster in breast cancer and screening control cohorts.

Haplotype*

Frequency

Case, Control Ratios

Chi-square

P value

GCCT

0.330

471.5 : 938.5, 321.5 : 674.5

0.352

0.5529

TTCT

0.165

220.7 : 1189.3, 176.8 : 819.2

1.865

0.1720

GCTC

0.133

182.1 : 1227.9, 138.3 : 857.7

0.469

0.4934

GCTT

0.112

169.0 : 1241.0, 99.9 : 896.1

2.239

0.1346

GCCC

0.099

145.8 : 1264.2, 91.3 : 904.7

0.913

0.3392

TCCT

0.032

42.1 : 1367.9, 35.4 : 960.6

0.602

0.4376

TCTT

0.026

32.4 : 1377.6, 30.1 : 965.9

1.202

0.2729

GTCT

0.024

36.1 : 1373.9, 22.6 : 973.4

0.214

0.6440

TTCC

0.022

33.5 : 1376.5, 19.9 : 976.1

0.377

0.5394

TTTT

0.017

21.2 : 1388.8, 19.8 : 976.2

0.817

0.3661

TCCC

0.016

24.6 : 1385.4, 14.1 : 981.9

0.4

0.5271

TCTC

0.013

16.7 : 1393.3, 14.3 : 981.7

0.295

0.5873

* The haplotypes represent the four polymorphisms (IL1A +4845G>T, IL1B +3954C>T, IL1B -511C>T and IL1RN +2018T>C) in that order.

The literature search demonstrated two previous studies on the IL1B -511C>T polymorphism 5758, one on the IL1B +3954C>T polymorphism 58, six on the IL6 -174G>C polymorphism Smith, 2004 #877} 5859606162 and four on the IL10 -1082G>A polymorphism 57596364. The results of the previously published studies are discussed in the context of the results from the current study in the next section.

Discussion

Cytokines play varied roles in cancer pathogenesis with increasing evidence suggesting their involvement in tumour initiation, growth and metastasis 1. Cytokine gene polymorphisms have been studied for associations with many inflammatory and neoplastic diseases. Numerous reports have evaluated the association of individual candidate SNPs in cytokine genes in breast cancer, some of which are included in this study.

IL1A polymorphisms and breast cancer

IL1A is thought to contribute to breast cancer expression by up-regulating pro-metastatic genes in breast cancer cells and stromal cells 65. IL1A levels in breast tissue homogenates correlates inversely with ER levels 66, which is an established prognostic marker in breast cancer. The IL1A gene is mapped to chromosome 2q13 and includes several polymorphisms, of which one in the 5'UTR regulatory region (-889C>T) and one in exon 5 of the gene (+4845G>T) have been commonly studied. The IL1A -889 polymorphism has been studied in two different cohorts and not shown to be associated with breast cancer 5867. However, to date, there are no published studies on the role of the IL1A +4845 polymorphism in breast cancer. The current study has shown that there is a trend for the rare allele to confer a protective effect against cancer (p = 0.05) and for the common allele to be significantly associated with lymph node positive cancers (p = 0.03). This effect is more apparent when the rare allele carriage rates (carriers of rare alleles) are assessed instead of genotype frequencies (p = 0.005 and p = 0.007 respectively). The positive finding however has not been subject to corrections for multiple testing in view of the exploratory nature of these studies. In addition, given that the genotype frequencies of this polymorphism were not in Hardy Weinberg equilibrium, this may be an artefactual association which would need confirmation in other populations. There was no association of this polymorphism with tumour grade, vessel invasion or survival.

IL1B polymorphisms and breast cancer

IL1β levels are high in breast cancer tissue and correlate with invasiveness and an aggressive phenotype 68. They seem to regulate cancer cell proliferation through oestrogen production by steroid-catalyzing enzymes in the tissue 69. The IL1B gene is mapped to 2q13 70 and the commonly described genetic variants include the -511C>T and the -31C>T in the 5'UTR and the +3954C>T polymorphism in exon 5 of the gene. Our data for the -511 and the +3954 SNPs show that overall; neither of these SNPs is associated with breast cancer susceptibility, severity or survival. As table 4c shows, in women with a positive family history of breast cancer, the IL1B +3954T allele was associated with a reduced risk of breast cancer. The significance of this association on exploratory subgroup analysis is however limited. Tables 8 and 9 show data from two other studies confirming our findings that these polymorphisms do play a significant role in breast cancer susceptibility or severity.

<p>Table 8</p>

Studies of the IL1B -511C>T polymorphism in breast cancer.

Reference

Numbers studied

Type of controls

Susceptibility

Severity

Ethnicity

Cancer

Controls

Smith KC et al, 2004 [57]

141

261

Bone marrow and solid organ donors – male and female

No association

No association

mixed

Hefler LA et al, 2005 [58]

269

227

Women visiting outpatient dept for various reasons

No association

No association

Caucasian

Our study

703

489

Women with normal mammograms from screening population

No association

No association

British Caucasian

 <p>Table 9</p>

Studies of the IL1B +3954C>T polymorphism in breast cancer.

Reference

Numbers studied

Type of controls

Susceptibility

Severity

Ethnicity

Cancer

Controls

Hefler LA et al, 2005 [58]

269

227

Women visiting outpatient dept for various reasons

No association

No association

Caucasian

Our study

691

420

Women with normal mammograms from screening population

No association

No association

British Caucasian

IL1RN polymorphisms and breast cancer

It has been shown that IL1RA levels are increased in breast cancer tissue and that IL1RA levels correlate with ER levels 66. At least 18 sequence variants exist around the IL1RN gene 71 located in chromosome 2q13 70. Of these, the penta-allelic variant in intron 2 and the +2018T>C have been commonly studied. There are no prior reports of the IL1RN +2018 polymorphism in breast cancer. The intronic polymorphism described however has however been studied in breast cancer without any significant association with susceptibility or prognosis 58. Our data shows no association of the +2018T>C polymorphism with breast cancer risk, severity or survival from the disease.

In addition to the analysis of the individual polymorphisms in the IL1A, IL1B and IL1RN genes, comparison of the probable haplotype frequencies in the breast cancer and control cohorts did not show any significant differences between the two groups.

IL4R polymorphisms and breast cancer

IL4 receptor is significantly expressed in breast cancer 72 and it has been shown that IL4R is required for actions of IL4 on breast cancer cells 12 including the inhibition of growth and induction of apoptosis. The IL4R gene has been localised to 16p12. Several coding and regulatory region polymorphisms exist in the IL4R gene and are thought to influence signal transduction on the IL4 signalling pathway 73. Our data on the IL4R polymorphism +1902A>G has shown no overall association with breast cancer susceptibility, severity or survival. In the subgroup of young cancer patients (those </=50 years at diagnosis), we found that the G allele was significantly associated with breast cancer. There are no other studies of this polymorphism in breast cancer.

IL6 polymorphisms and breast cancer

The circulating level of interleukin 6 is thought to be elevated in the development and progression of many tumours including breast cancer and its up-regulation is associated with invasiveness and increased metastatic potential of ER negative tumours 74. The IL6 gene has been localised to chromosome 7p21. Although several polymorphisms exist in the promoter region of IL-6 and are thought to have a complex interactive effect on IL6 expression 75, the polymorphism at -174 has been most extensively studied and shown to have significant ethnic variation 74. Table 10 shows the various studies of this polymorphism in breast cancer to date. Only one study demonstrated an association with breast cancer susceptibility 58, which showed a significant Odds ratio of 1.5 and 2.0 for the heterozygotes (GC) and the rare homozygotes (CC) when compared to the common homozygotes (GG). The study however included a non-healthy control population (women attending outpatient departments for various reasons) and a lack of correction for multiple testing. Our data shows that the IL6 -174G>C polymorphism was not associated with either breast cancer risk or severity and prognosis as assessed by tumour grade, lymph nodal status, vascular invasion or survival.

<p>Table 10</p>

Studies of the IL6 -174G>C polymorphism in breast cancer.

Reference

Numbers studied

Type of controls

Susceptibility

Severity

Ethnicity

Cancer

Controls

Smith KC et al, 2004 [57]

144

224

Bone marrow and solid organ donors – male and female

No association

No association

mixed

Hefler LA et al, 2005 [58]

269

227

Women visiting outpatient dept for various reasons

OR = 1.5 (1.04–2.3)* for GC vs. GG OR = 2 (1.1–3.6)* for CC vs. GG

No association

Caucasian

Skerrett DL et al, 2005 [59]

88

102

Maternal cord blood samples

No association

No association

mixed

Saha A et al, 2003 [60]

26

95

Unknown

No association

Not studied

Asian Indian

DeMichelle A et al, 2003 [61]

80

0

-

Not studied

C allele associated with 4 year disease free survival (p = 0.02) and overall survival (p = 0.01) in node positive patients

mixed

Iacopetta B et al, 2004 [62]

256

0

-

Not studied

C allele associated with high grade (p = 0.04) and CC genotype associated with poor survival (p = 0.03)

mixed

Our study

497

490

Women with normal mammograms from screening population

No association

No association

British Caucasian

OR: Odds Ratio

IL10 polymorphisms and breast cancer

IL10 has been shown to have anti-metastatic and anti-tumour effects in murine breast cancer models 17. Mononuclear cells from breast cancer patients exhibit increased IL10 production 76 and IL10 serum levels correlate with stage of the disease 77. Several single nucleotide polymorphisms exist in the promoter region of the IL10 gene (localised to chromosome 1q31-q32) including -1082, -819 and -592 78. Table 11 shows the studies of the IL10 -1082G>A polymorphism in breast cancer. Of the three studies reported, only one suggests a role for the G allele in reducing breast cancer risk 63. Our data, which includes larger numbers of individuals, however shows no association with breast cancer susceptibility, severity or survival for this polymorphism. A study on the related polymorphism (-592C>A) in the promoter region was associated with a reduced breast cancer risk, although in breast cancer patients, there was no association with severity of the disease 79.

<p>Table 11</p>

Studies of the IL10 -1082G>A polymorphism in breast cancer.

Reference

Numbers studied

Type of controls

Susceptibility

Severity

Ethnicity

Cancer

Controls

Smith KC et al, 2004 [57]

129

223

Bone marrow and solid organ donors – male and female

No association

No association

Mixed

Giordani L et al, 2003 [63]

125

100

Female outpatients without breast cancer

OR = 0.58 (0.32–1.07) for AG vs. AA OR = 0.38 (0.14–0.99) for GG vs. AA

Not studied

unknown

Skerrett DL et al, 2005 [59]

88

102

Maternal cord blood samples

No association

No association

mixed

Wu JM et al, 2005 [64]

87

0

-

Not studied

No association

mixed

Our study

497

498

Women with normal mammograms from screening population

No association

No association

British Caucasian

OR: Odds Ratio

Limitations

Although our study had more than twice the number of subjects than the similar studies on cytokine polymorphisms in breast cancer, it could still be argued that associations of a minor degree (Odds Ratio < 1.5) of the genetic markers studied or other related markers may have been missed. For example, to detect a rare marker (of frequency 10%) associated with a 1.3 times increased risk of breast cancer (Odds Ratio = 1.3) with a power of 80% and type I error of 0.5%, we would need a sample size of 2400 patients and controls. The second limitation is that a small proportion of our control population would develop breast cancer in their lifetime. However, it is generally considered difficult to obtain an ideal control cohort for genetic epidemiologic studies in solid cancers mainly due to the delayed onset of the disease. The prognostic markers used for assessing breast cancer severity in this study were limited to grade, lymph nodal status and vascular invasion due to limited information available on other indices such as hormone receptor status and tumour size.

Conclusion

The results from our study do not support the hypothesis that the cytokine polymorphisms studied [IL1A +4845G>T, IL1B -511C>T, IL1B +3954C>T, IL1RN +2018T>C, IL4R -1902A>G, IL6-174G>C and IL10-1082G>A] are associated with breast cancer susceptibility and severity. Minor influences and associations with subgroups of phenotypes may exist, but are unlikely to be of any major clinical significance.

Abbreviations

IL: interleukin; ER: oestrogen receptor; SNP: single nucleotide polymorphism; UTR: untranslated region; PCR: polymerase chain reaction; DNA: deoxyribonucleic acid.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

SPB, IAFA and SEH carried out patient recruitment, the molecular genetic studies and drafted the manuscript. SSC reviewed the pathology and drafted the manuscript. SPB and AC participated in the design of the study and performed the statistical analysis. AGW, NJB and MWR conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We would like to thank Helen Cramp, Jane McDaid and Claire Greaves for help with recruitment and genotyping, Dan Connley for data management, and all the people who took part in the study. AC is funded by the Yorkshire Cancer Research. We would also like to thank the Royal College of Surgeons of Edinburgh who provided financial assistance towards consumables for this study.

 <p>Cytokines in cancer immunity and immunotherapy</p> Smyth MJ Cretney E Kershaw MH Hayakawa Y Immunol Rev 2004 202 275 293 10.1111/j.0105-2896.2004.00199.x 15546400 <p>Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility</p> de Jong MM Nolte IM te Meerman GJ van der Graaf WT Oosterwijk JC Kleibeuker JH Schaapveld M de Vries EG J Med Genet 2002 39 4 225 242 10.1136/jmg.39.4.225 11950848 <p>Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms</p> El-Omar EM Rabkin CS Gammon MD Vaughan TL Risch HA Schoenberg JB Stanford JL Mayne ST Goedert J Blot WJ Fraumeni JFJ Chow WH Gastroenterology 2003 124 5 1193 1201 10.1016/S0016-5085(03)00157-4 12730860 <p>Genetic polymorphisms of interleukin (IL)-1B, IL-1RN, IL-8, IL-10 and tumor necrosis factor {alpha} and risk of gastric cancer in a Chinese population</p> Lu W Pan K Zhang L Lin D Miao X You W Carcinogenesis 2005 26 3 631 636 10.1093/carcin/bgh349 15579481 <p>Pro- and anti-inflammatory cytokines gene polymorphisms and Helicobacter pylori infection: interactions influence outcome</p> Zambon CF Basso D Navaglia F Belluco C Falda A Fogar P Greco E Gallo N Rugge M Di Mario F Plebani M Cytokine 2005 29 4 141 152 10.1016/j.cyto.2004.10.013 15652446 <p>Effect of cytokine genotypes on the hepatitis B virus-hepatocellular carcinoma association</p> Nieters A Yuan JM Sun CL Zhang ZQ Stoehlmacher J Govindarajan S Yu MC Cancer 2005 103 4 740 748 10.1002/cncr.20842 15643599 <p>Frequency and nature of cytokine gene polymorphisms in hepatocellular carcinoma in Hong Kong Chinese</p> Heneghan MA Johnson PJ Clare M Ho S Harrison PM Donaldson PT Int J Gastrointest Cancer 2003 34 1 19 26 10.1385/IJGC:34:1:19 15235132 <p>Lack of association between polymorphisms in inflammatory genes and lung cancer risk</p> Campa D Hung RJ Mates D Zaridze D Szeszenia-Dabrowska N Rudnai P Lissowska J Fabianova E Bencko V Foretova L Janout V Boffetta P Brennan P Canzian F Cancer Epidemiol Biomarkers Prev 2005 14 2 538 539 10.1158/1055-9965.EPI-04-0513 15734985 <p>Analysis of candidate genes for prostate cancer</p> Burmester JK Suarez BK Lin JH Jin CH Miller RD Zhang KQ Salzman SA Reding DJ Catalona WJ Hum Hered 2004 57 4 172 178 10.1159/000081443 15583422 <p>Polymorphisms of the interleukin-1 gene cluster and ovarian cancer</p> Hefler LA Ludwig E Lebrecht A Zeillinger R Tong-Cacsire D Koelbl H Leodolter S Tempfer CB J Soc Gynecol Investig 2002 9 6 386 390 10.1016/S1071-5576(02)00177-6 12445604 <p>The interleukin-1 family of cytokines and receptors in human breast cancer: implications for tumor progression</p> Pantschenko AG Pushkar I Anderson KH Wang Y Miller LJ Kurtzman SH Barrows G Kreutzer DL Int J Oncol 2003 23 2 269 284 12851675 <p>Interleukin 4 inhibits growth and induces apoptosis in human breast cancer cells</p> Gooch JL Lee AV Yee D Cancer Res 1998 58 18 4199 4205 9751635 <p>Expression of high-affinity IL-4 receptors on human melanoma, ovarian and breast carcinoma cells</p> Obiri NI Siegel JP Varricchio F Puri RK Clin Exp Immunol 1994 95 1 148 155 8287600 <p>Serum interleukin 6, plasma VEGF, serum VEGF, and VEGF platelet load in breast cancer patients</p> Benoy I Salgado R Colpaert C Weytjens R Vermeulen PB Dirix LY Clin Breast Cancer 2002 2 4 311 315 11899364 <p>Circulating interleukin-6 predicts survival in patients with metastatic breast cancer</p> Salgado R Junius S Benoy I Van Dam P Vermeulen P Van Marck E Huget P Dirix LY Int J Cancer 2003 103 5 642 646 10.1002/ijc.10833 12494472 <p>High incidence of interleukin 10 mRNA but not interleukin 2 mRNA detected in human breast tumours</p> Venetsanakos E Beckman I Bradley J Skinner JM Br J Cancer 1997 75 12 1826 1830 9192989 <p>Antimetastatic and antitumor activities of interleukin 10 in a murine model of breast cancer</p> Kundu N Beaty TL Jackson MJ Fulton AM J Natl Cancer Inst 1996 88 8 536 541 8606382 <p>Interleukin-1 alpha promotes tumor growth and cachexia in MCF-7 xenograft model of breast cancer</p> Kumar S Kishimoto H Chua HL Badve S Miller KD Bigsby RM Nakshatri H Am J Pathol 2003 163 6 2531 2541 14633625 <p>Evidence for transcriptional activation of ERalpha by IL-1beta in breast cancer cells</p> Speirs V Kerin MJ Newton CJ Walton DS Green AR Desai SB Atkin SL Int J Oncol 1999 15 6 1251 1254 10568836 <p>IL-1beta induces stabilization of IL-8 mRNA in malignant breast cancer cells via the 3' untranslated region: Involvement of divergent RNA-binding factors HuR, KSRP and TIAR</p> Suswam EA Nabors LB Huang Y Yang X King PH Int J Cancer 2005 113 6 911 919 10.1002/ijc.20675 15514971 <p>Inhibition of angiogenesis by interleukin 4</p> Volpert OV Fong T Koch AE Peterson JD Waltenbaugh C Tepper RI Bouck NP J Exp Med 1998 188 6 1039 1046 10.1084/jem.188.6.1039 9743522 <p>Amino acid dimorphism in IL1A is detectable by PCR amplification</p> van den Velden PA Reitsma PH Hum Mol Genet 1993 2 10 1753 8268952 <p>Association of IL1A gene polymorphisms with susceptibility to and severity of systemic sclerosis in the Japanese population</p> Kawaguchi Y Tochimoto A Ichikawa N Harigai M Hara M Kotake S Kitamura Y Kamatani N Arthritis Rheum 2003 48 1 186 192 10.1002/art.10736 12528118 <p>C-reactive protein levels are influenced by common IL-1 gene variations</p> Berger P McConnell JP Nunn M Kornman KS Sorrell J Stephenson K Duff GW Cytokine 2002 17 4 171 174 10.1006/cyto.2001.0974 11991668 <p>Association analysis between interleukin-1 family polymorphisms and generalized aggressive periodontitis in a Chinese population</p> Li QY Zhao HS Meng HX Zhang L Xu L Chen ZB Shi D Feng XH Zhu XL J Periodontol 2004 75 12 1627 1635 10.1902/jop.2004.75.12.1627 15732864 <p>Interleukin 1B gene polymorphism is associated with baseline C-reactive protein levels in healthy individuals</p> Eklund C Jahan F Pessi T Lehtimaki T Hurme M Eur Cytokine Netw 2003 14 3 168 171 14656692 <p>A TaqI polymorphism in the human interleukin-1 beta (IL-1 beta) gene correlates with IL-1 beta secretion in vitro</p> Pociot F Molvig J Wogensen L Worsaae H Nerup J Eur J Clin Invest 1992 22 6 396 402 1353022 <p>Interleukin 1 Beta Polymorphism (-511) and Risk of Stroke due to Small Vessel Disease</p> Dziedzic T Slowik A Pera J Szczudlik A Cerebrovasc Dis 2005 20 5 299 303 10.1159/000087928 16131798 <p>Cytokine gene polymorphisms in gastric cancer patients from two Italian areas at high and low cancer prevalence</p> Perri F Piepoli A Bonvicini C Gentile A Quitadamo M Di Candia M Cotugno R Cattaneo F Zagari MR Ricciardiello L Gennarelli M Bazzoli F Ranzani GN Andriulli A Cytokine 2005 30 5 293 302 10.1016/j.cyto.2005.01.011 15927855 <p>Association of interleukin-1B (IL-1B) gene polymorphisms with risk of gastric cancer in Chinese population</p> Zhang WH Wang XL Zhou J An LZ Xie XD Cytokine 2005 30 6 378 381 10.1016/j.cyto.2005.02.002 15878285 <p>Interleukin 1B gene (IL-1B) and interleukin 1 receptor antagonist gene (IL-1RN) polymorphisms in Helicobacter pylori-negative gastric cancer of intestinal and diffuse histotype</p> Ruzzo A Graziano F Pizzagalli F Santini D Battistelli V Panunzi S Canestrari E Catalano V Humar B Ficarelli R Bearzi I Cascinu S Naldi N Testa E Magnani M Ann Oncol 2005 16 6 887 892 10.1093/annonc/mdi184 15851404 <p>IL-1 receptor antagonist (IL-1Ra) plasma levels are co-ordinately regulated by both IL-1Ra and IL-1beta genes</p> Hurme M Santtila S Eur J Immunol 1998 28 8 2598 2602 10.1002/(SICI)1521-4141(199808)28:08<2598::AID-IMMU2598>3.0.CO;2-K 9710237 <p>Presence of the IL-1RA allele 2 (IL1RN*2) is associated with enhanced IL-1beta production in vitro</p> Santtila S Savinainen K Hurme M Scand J Immunol 1998 47 3 195 198 10.1046/j.1365-3083.1998.00300.x 9519856 <p>Allele 2 of the interleukin-1 receptor antagonist gene (IL1RN*2) is associated with a decreased risk of primary lung cancer</p> Hu Z Shao M Chen Y Zhou J Qian J Xu L Ma H Wang X Xu Y Lu D Shen H Cancer Lett 2005 <p>Interleukin-1 receptor antagonist gene polymorphism in epithelial ovarian cancer</p> Sehouli J Mustea A Koensgen D Lichtenegger W Cancer Epidemiol Biomarkers Prev 2003 12 11 Pt 1 1205 1208 14652282 <p>Interleukin 1 receptor antagonist (IL-1RA) polymorphism in women with cervical cancer</p> Mustea A Sehouli J Konsgen D Stengel D Sofroni D Lichtenegger W Anticancer Res 2003 23 2A 1099 1102 12820354 <p>Prediction of malignant potential in reflux disease: are cytokine polymorphisms important?</p> Gough MD Ackroyd R Majeed AW Bird NC Am J Gastroenterol 2005 100 5 1012 1018 10.1111/j.1572-0241.2005.40904.x 15842572 <p>The association of atopy with a gain-of-function mutation in the alpha subunit of the interleukin-4 receptor</p> Hershey GK Friedrich MF Esswein LA Thomas ML Chatila TA N Engl J Med 1997 337 24 1720 1725 10.1056/NEJM199712113372403 9392697 <p>Association of single nucleotide polymorphisms in the interleukin-4 gene and interleukin-4 receptor gene with Crohn's disease in a British population</p> Aithal GP Day CP Leathart J Daly AK Hudson M Genes Immun 2001 2 1 44 47 10.1038/sj.gene.6363730 11294568 <p>Polymorphisms of IL-4, IL-4R alpha, and AICDA genes in adult allergic asthma</p> Cui T Wang L Wu J Hu L Xie J J Huazhong Univ Sci Technolog Med Sci 2003 23 2 134 137 12973929 <p>Genetic polymorphisms of the interleukin-4 receptor alpha gene are associated with an increasing risk and a poor prognosis of sporadic renal cell carcinoma in a Japanese population</p> Nakamura E Megumi Y Kobayashi T Kamoto T Ishitoya S Terachi T Tachibana M Matsushiro H Habuchi T Kakehi Y Ogawa O Clin Cancer Res 2002 8 8 2620 2625 12171893 <p>The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis</p> Fishman D Faulds G Jeffery R Mohamed-Ali V Yudkin JS Humphries S Woo P J Clin Invest 1998 102 7 1369 1376 508984 9769329 <p>The -174G allele of the interleukin-6 gene confers susceptibility to systemic arthritis in children: a multicenter study using simplex and multiplex juvenile idiopathic arthritis families</p> Ogilvie EM Fife MS Thompson SD Twine N Tsoras M Moroldo M Fisher SA Lewis CM Prieur AM Glass DN Woo P Arthritis Rheum 2003 48 11 3202 3206 10.1002/art.11300 14613283 <p>Interleukin-6 gene polymorphisms and susceptibility to myocardial infarction: the ECTIM study. Etude Cas-Temoin de l'Infarctus du Myocarde</p> Georges JL Loukaci V Poirier O Evans A Luc G Arveiler D Ruidavets JB Cambien F Tiret L J Mol Med 2001 79 5-6 300 305 10.1007/s001090100209 11485024 <p>The interleukin-6 -174 G/C promoter polymorphism is associated with risk of coronary heart disease and systolic blood pressure in healthy men</p> Humphries SE Luong LA Ogg MS Hawe E Miller GJ Eur Heart J 2001 22 24 2243 2252 10.1053/euhj.2001.2678 11728144 <p>Polymorphisms in inflammation genes and bladder cancer: from initiation to recurrence, progression, and survival</p> Leibovici D Grossman HB Dinney CP Millikan RE Lerner S Wang Y Gu J Dong Q Wu X J Clin Oncol 2005 23 24 5746 5756 10.1200/JCO.2005.01.598 16110031 <p>Association of common polymorphisms in inflammatory genes interleukin (IL)6, IL8, tumor necrosis factor alpha, NFKB1, and peroxisome proliferator-activated receptor gamma with colorectal cancer</p> Landi S Moreno V Gioia-Patricola L Guino E Navarro M de Oca J Capella G Canzian F Cancer Res 2003 63 13 3560 3566 12839942 <p>An IL6 promoter polymorphism is associated with a lifetime risk of development of Kaposi sarcoma in men infected with human immunodeficiency virus</p> Foster CB Lehrnbecher T Samuels S Stein S Mol F Metcalf JA Wyvill K Steinberg SM Kovacs J Blauvelt A Yarchoan R Chanock SJ Blood 2000 96 7 2562 2567 11001912 <p>An investigation of polymorphism in the interleukin-10 gene promoter</p> Turner DM Williams DM Sankaran D Lazarus M Sinnott PJ Hutchinson IV Eur J Immunogenet 1997 24 1 1 8 9043871 <p>Interleukin-10 polymorphisms in Spanish patients with IBD</p> Fernandez L Martinez A Mendoza JL Urcelay E Fernandez-Arquero M Garcia-Paredes J Diaz-Rubio M de la Concha EG Inflamm Bowel Dis 2005 11 8 739 743 10.1097/01.MIB.0000173457.64868.20 16043989 <p>Interleukin 10 haplotype associated with increased risk of hepatocellular carcinoma</p> Shin HD Park BL Kim LH Jung JH Kim JY Yoon JH Kim YJ Lee HS Hum Mol Genet 2003 12 8 901 906 10.1093/hmg/ddg104 12668613 <p>Influence of interleukin-10 genetic polymorphism on survival rates in melanoma patients with advanced disease</p> Alonso R Suarez A Castro P Lacave AJ Gutierrez C Melanoma Res 2005 15 1 53 60 10.1097/00008390-200502000-00009 15714121 <p>A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer</p> Rafii S O'Regan P Xinarianos G Azmy I Stephenson T Reed M Meuth M Thacker J Cox A Hum Mol Genet 2002 11 12 1433 1438 10.1093/hmg/11.12.1433 12023985 <p>Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity</p> Azmy IA Balasubramanian SP Wilson AG Stephenson TJ Cox A Brown NJ Reed MW Breast Cancer Res 2004 6 4 R395 400 468647 15217507 10.1186/bcr802 <p>Detection and population analysis of IL-1 and TNF gene polymorphisms.</p> di Giovine F. S. CNJCACAGSJACADGW Cytokine Molecular Biology - A practical approach Oxford , Oxford University Press Balkwill F 2000 21 46 <p>Haploview: analysis and visualization of LD and haplotype maps</p> Barrett JC Fry B Maller J Daly MJ Bioinformatics 2005 21 2 263 265 10.1093/bioinformatics/bth457 15297300 <p>Cytokine gene polymorphisms and breast cancer susceptibility and prognosis</p> Smith KC Bateman AC Fussell HM Howell WM Eur J Immunogenet 2004 31 4 167 173 10.1111/j.1365-2370.2004.00462.x 15265021 <p>Interleukin-1 and interleukin-6 gene polymorphisms and the risk of breast cancer in caucasian women</p> Hefler LA Grimm C Lantzsch T Lampe D Leodolter S Koelbl H Heinze G Reinthaller A Tong-Cacsire D Tempfer C Zeillinger R Clin Cancer Res 2005 11 16 5718 5721 10.1158/1078-0432.CCR-05-0001 16115908 <p>Cytokine genotype polymorphisms in breast carcinoma: associations of TGF-beta1 with relapse</p> Skerrett DL Moore EM Bernstein DS Vahdat L Cancer Invest 2005 23 3 208 214 15945506 <p>Two novel somatic mutations in the human interleukin 6 promoter region in a patient with sporadic breast cancer</p> Saha A Bairwa NK Ranjan A Gupta V Bamezai R Eur J Immunogenet 2003 30 6 397 400 10.1111/j.1365-2370.2003.00423.x 14675392 <p>Interleukin-6 -174G-->C polymorphism is associated with improved outcome in high-risk breast cancer</p> DeMichele A Martin AM Mick R Gor P Wray L Klein-Cabral M Athanasiadis G Colligan T Stadtmauer E Weber B Cancer Res 2003 63 22 8051 8056 14633738 <p>The -174 G/C gene polymorphism in interleukin-6 is associated with an aggressive breast cancer phenotype</p> Iacopetta B Grieu F Joseph D Br J Cancer 2004 90 2 419 422 10.1038/sj.bjc.6601545 14735187 <p>Association of breast cancer and polymorphisms of interleukin-10 and tumor necrosis factor-alpha genes</p> Giordani L Bruzzi P Lasalandra C Quaranta M Schittulli F Della Ragione F Iolascon A Clin Chem 2003 49 10 1664 1667 10.1373/49.10.1664 14500594 <p>The effects of interleukin 10 and interferon gamma cytokine gene polymorphisms on survival after autologous bone marrow transplantation for patients with breast cancer</p> Wu JM Bensen-Kennedy D Miura Y Thoburn CJ Armstrong D Vogelsang GB Hess AD Biol Blood Marrow Transplant 2005 11 6 455 464 10.1016/j.bbmt.2005.03.008 15931634 <p>Cancer cell-derived interleukin 1alpha contributes to autocrine and paracrine induction of pro-metastatic genes in breast cancer</p> Nozaki S Sledge GWJ Nakshatri H Biochem Biophys Res Commun 2000 275 1 60 62 10.1006/bbrc.2000.3241 10944441 <p>Interleukin-1 family expression in human breast cancer: interleukin-1 receptor antagonist</p> Miller LJ Kurtzman SH Anderson K Wang Y Stankus M Renna M Lindquist R Barrows G Kreutzer DL Cancer Invest 2000 18 4 293 302 10808364 <p>Significant reduction in breast cancer risk for Japanese women with interleukin 1B -31 CT/TT relative to CC genotype</p> Ito LS Iwata H Hamajima N Saito T Matsuo K Mizutani M Iwase T Miura S Okuma K Inoue M Hirose K Tajima K Jpn J Clin Oncol 2002 32 10 398 402 10.1093/jjco/hyf081 12451035 <p>Expression of interleukin-1beta in human breast carcinoma</p> Jin L Yuan RQ Fuchs A Yao Y Joseph A Schwall R Schnitt SJ Guida A Hastings HM Andres J Turkel G Polverini PJ Goldberg ID Rosen EM Cancer 1997 80 3 421 434 10.1002/(SICI)1097-0142(19970801)80:3<421::AID-CNCR10>3.0.CO;2-Z 9241076 <p>The influence of inflammatory cytokines on estrogen production and cell proliferation in human breast cancer cells</p> Honma S Shimodaira K Shimizu Y Tsuchiya N Saito H Yanaihara T Okai T Endocr J 2002 49 3 371 377 12201223 <p>A sequence-based map of the nine genes of the human interleukin-1 cluster</p> Nicklin MJ Barton JL Nguyen M FitzGerald MG Duff GW Kornman K Genomics 2002 79 5 718 725 10.1006/geno.2002.6751 11991722 <p>Interleukin-1 receptor antagonist haplotype associated with prostate cancer risk</p> Lindmark F Zheng SL Wiklund F Balter KA Sun J Chang B Hedelin M Clark J Johansson JE Meyers DA Adami HO Isaacs W Gronberg H Xu J Br J Cancer 2005 93 4 493 497 10.1038/sj.bjc.6602729 16106254 <p>Effect of interleukin (IL)-4 cytotoxin on breast tumor growth after in vivo gene transfer of IL-4 receptor alpha chain</p> Kawakami K Kawakami M Husain SR Puri RK Clin Cancer Res 2003 9 5 1826 1836 12738741 <p>Association and interaction of the IL4R, IL4, and IL13 loci with type 1 diabetes among Filipinos</p> Bugawan TL Mirel DB Valdes AM Panelo A Pozzilli P Erlich HA Am J Hum Genet 2003 72 6 1505 1514 1180310 12748907 10.1086/375655 <p>The interleukin-6 gene: a susceptibility factor that may contribute to racial and ethnic disparities in breast cancer mortality</p> Berger FG Breast Cancer Res Treat 2004 88 3 281 285 10.1007/s10549-004-0726-0 15609131 <p>Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation</p> Terry CF Loukaci V Green FR J Biol Chem 2000 275 24 18138 18144 10.1074/jbc.M000379200 10747905 <p>Interleukin-12 and interleukin-10 production by mononuclear phagocytic cells from breast cancer patients</p> Merendino RA Gangemi S Misefari A Arena A Capozza AB Chillemi S D'Ambrosio FP Immunol Lett 1999 68 2-3 355 358 10.1016/S0165-2478(99)00067-X 10424443 <p>Concentration of interleukin-6 (IL-6), interleukin-8 (IL-8) and interleukin-10 (IL-10) in blood serum of breast cancer patients</p> Kozlowski L Zakrzewska I Tokajuk P Wojtukiewicz MZ Rocz Akad Med Bialymst 2003 48 82 84 14737948 <p>Interleukin-10 promoter polymorphisms and susceptibility to skin squamous cell carcinoma after renal transplantation</p> Alamartine E Berthoux P Mariat C Cambazard F Berthoux F J Invest Dermatol 2003 120 1 99 103 10.1046/j.1523-1747.2003.12016.x 12535204 <p>Interleukin-10 promoter polymorphism is associated with decreased breast cancer risk</p> Langsenlehner U Krippl P Renner W Yazdani-Biuki B Eder T Koppel H Wascher TC Paulweber B Samonigg H Breast Cancer Res Treat 2005 90 2 113 115 10.1007/s10549-004-3607-7 15803357

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2407/6/188/prepub