<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2350-9-51</ui>
   <ji>1471-2350</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>The NEI/NCBI dbGAP database: Genotypes and haplotypes that may specifically predispose to risk of neovascular age-related macular degeneration</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Zhang</snm>
               <fnm>Hong</fnm>
               <insr iid="I2"/>
               <email>hong.zhang@yale.edu</email>
            </au>
            <au id="A2">
               <snm>Morrison</snm>
               <mi>A</mi>
               <fnm>Margaux</fnm>
               <insr iid="I1"/>
               <email>margaux_morrison@meei.harvard.edu</email>
            </au>
            <au id="A3">
               <snm>DeWan</snm>
               <fnm>Andy</fnm>
               <insr iid="I2"/>
               <email>andrew.dewan@yale.edu</email>
            </au>
            <au id="A4">
               <snm>Adams</snm>
               <fnm>Scott</fnm>
               <insr iid="I1"/>
               <email>scott_adams@meei.harvard.edu</email>
            </au>
            <au id="A5">
               <snm>Andreoli</snm>
               <fnm>Michael</fnm>
               <insr iid="I1"/>
               <email>michael_andreoli@meei.harvard.edu</email>
            </au>
            <au id="A6">
               <snm>Huynh</snm>
               <fnm>Nancy</fnm>
               <insr iid="I1"/>
               <email>nancy_huynh@meei.harvard.edu</email>
            </au>
            <au id="A7">
               <snm>Regan</snm>
               <fnm>Maureen</fnm>
               <insr iid="I3"/>
               <email>MEREGAN@PARTNERS.ORG</email>
            </au>
            <au id="A8">
               <snm>Brown</snm>
               <fnm>Alison</fnm>
               <insr iid="I3"/>
               <email>ABROWN13@PARTNERS.ORG</email>
            </au>
            <au id="A9">
               <snm>Miller</snm>
               <mi>W</mi>
               <fnm>Joan</fnm>
               <insr iid="I1"/>
               <email>joan_miller@meei.harvard.edu</email>
            </au>
            <au id="A10">
               <snm>Kim</snm>
               <mi>K</mi>
               <fnm>Ivana</fnm>
               <insr iid="I1"/>
               <email>ivana_kim@meei.harvard.edu</email>
            </au>
            <au ca="yes" id="A11">
               <snm>Hoh</snm>
               <fnm>Josephine</fnm>
               <insr iid="I2"/>
               <email>josephine.hoh@yale.edu</email>
            </au>
            <au id="A12" ca="yes">
               <snm>DeAngelis</snm>
               <mi>M</mi>
               <fnm>Margaret</fnm>
               <insr iid="I1"/>
               <email>margaret_deangelis@hms.harvard.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Ophthalmology, Harvard Medical School, Massachusetts Eye and Ear Infirmary, Boston, MA, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, CT, USA</p>
            </ins>
            <ins id="I3">
               <p>Partner's Healthcare Center for Genetics and Genomics, Harvard Medical School, Cambridge, MA, USA</p>
            </ins>
         </insg>
         <source>BMC Medical Genetics</source>
         <issn>1471-2350</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>51</fpage>
         <url>http://www.biomedcentral.com/1471-2350/9/51</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18541031</pubid>
               <pubid idtype="doi">10.1186/1471-2350-9-51</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>17</day>
               <month>1</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>09</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>09</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Zhang et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>To examine if the significantly associated SNPs derived from the genome wide allelic association study on the AREDS cohort at the NEI (dbGAP) specifically confer risk for neovascular age-related macular degeneration (AMD). We ascertained 134 unrelated patients with AMD who had one sibling with an AREDS classification 1 or less and was past the age at which the affected sibling was diagnosed (268 subjects). Genotyping was performed by both direct sequencing and Sequenom iPLEX system technology. Single SNP analyses were conducted with McNemar's Test (both 2 &#215; 2 and 3 &#215; 3 tests) and likelihood ratio tests (LRT). Conditional logistic regression was used to determine significant gene-gene interactions. LRT was used to determine the best fit for each genotypic model tested (additive, dominant or recessive).</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Before release of individual data, <it>p</it>-value information was obtained directly from the AREDS dbGAP website. Of the 35 variants with <it>P </it>&lt; 10<sup>-6 </sup>examined, 23 significantly modified risk of neovascular AMD. Many variants located in tandem on 1q32-q22 including those in <it>CFH</it>, <it>CFHR4</it>, <it>CFHR2</it>, <it>CFHR5</it>, <it>F13B</it>, <it>ASPM </it>and <it>ZBTB </it>were significantly associated with AMD risk. Of these variants, single SNP analysis revealed that <it>CFH </it>rs572515 was the most significantly associated with AMD risk (P &lt; 10<sup>-6</sup>). Haplotype analysis supported our findings of single SNP association, demonstrating that the most significant haplotype, GATAGTTCTC, spanning <it>CFH</it>, <it>CFHR4</it>, and <it>CFHR2 </it>was associated with the greatest risk of developing neovascular AMD (<it>P </it>&lt; 10<sup>-6</sup>). Other than variants on 1q32-q22, only two SNPs, rs9288410 (<it>MAP2</it>) on 2q34-q35 and rs2014307 (<it>PLEKHA1</it>/<it>HTRA1</it>) on 10q26 were significantly associated with AMD status (<it>P </it>= .03 and <it>P </it>&lt; 10<sup>-6 </sup>respectively). After controlling for smoking history, gender and age, the most significant gene-gene interaction appears to be between rs10801575 (<it>CFH</it>) and rs2014307 (<it>PLEKHA1</it>/<it>HTRA1</it>) (<it>P </it>&lt; 10<sup>-11</sup>). The best genotypic fit for rs10801575 and rs2014307 was an additive model based on LRT. After applying a Bonferonni correction, no other significant interactions were identified between any other SNPs.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This is the first replication study on the NEI dbGAP SNPs, demonstrating that alleles on 1q, 2q and 10q may predispose an individual to AMD.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="refman"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Advanced age-related macular degeneration (AMD) is the most common cause of legal blindness in developed countries. Clinically two forms of advanced AMD are recognized: geographic atrophy and neovascular. Geographic atrophy is characterized by a slow progressive degeneration of the retinal pigment epithelium (RPE), resulting in the gradual loss of the photoreceptors. The neovascular form is characterized by the growth of new abnormal blood vessels from beneath the retina that can cause severe and rapid vision loss due to hemorrhage and exudation. It is the neovascular form that is responsible for the majority of debilitating vision loss due to AMD, greatly impairing an individual's ability to read, drive and recognize faces. The burden on public health is significant, as in the U.S. alone, it is predicted that about 3 million individuals over the age of 50 years will have advanced AMD in at least one eye by 2020 <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
         <p>Although the newest treatments for neovascular AMD offer some chance of visual improvement, they require invasive delivery methods, cannot prevent disease, and have limited ability to reverse vision loss. Assessments of an individual's risk of developing advanced AMD are based on ocular findings in those who already have the early stages. Methods are needed for determining which members of the population are at highest risk of vision loss due to AMD prior to the development of any signs of the disease. The identification of genetic variants that could be used as biomarkers would help to predict risk for more advanced stages of AMD and possibly provide new targets for therapeutic or behavioral intervention, thereby reducing or preventing the incidence of this disease.</p>
         <p>In an effort to correlate genotypes with advanced AMD clinical phenotypes, the National Eye Institute (NEI) performed a genome wide association study on the Age-related eye disease study (AREDS) cohort consisting of 395 advanced AMD (both neovascular and geographic atrophy) cases and 198 control subjects. Affymetrix and Illumina 100 K arrays were used to test for individual SNP (Single Nucleotide Polymorphism) associations <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>In the study presented here, we sought to validate these findings in samples from unrelated patients with only neovascular AMD who had one sibling with normal maculae and was past the age at which the affected sibling was diagnosed with neovascular AMD. We employed this approach to examine if some or all of the NEI/NCBI dbGAP SNPs specifically predisposed an individual to AMD by studying subjects with and without the neovascular form of AMD. Our phenotypically well-defined cohort of 268 subjects comprised 134 extremely discordant sibpairs; that is, pairs with one member in the upper 10% of disease severity (affected sibling) and the other member in the bottom 10&#8211;30% of disease severity (unaffected sibling). Mathematical analyses indicate that the evaluation of sibpairs who are extremely discordant for a quantitative, multifactorial trait can be informative for identifying the genetic variants that govern the trait <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Many studies have suggested various ways for quantifying AMD but they are not conclusive. However, we know from studies based on prevalence of both early and late AMD that our unaffected siblings likely represent the bottom 10%&#8211;30% of the population and those with the most severe forms of AMD (geographic atrophy or neovascular AMD) represent the top 10% with respect to phenotype <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>Moreover, extremely discordant sibpairs can provide a robust alternative study design for finding an association between a genetic variant and a complex disease to using sibpairs with intermediate phenotypes <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> or case-controls study design <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>We have previously demonstrated that such types of sibpairs can be powerful in identifying the contribution that many genetic variants, even those with a modest effect, along with smoking make simultaneously to AMD susceptibility <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. We employed a combination of the Sequenom iPLEX system technology and direct sequencing to genotype 35 variants in order to identify the contribution that the dbGAP allelic risk factors make independently, and in combination, along with smoking to overall risk of developing neovascular AMD.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>We identified all 34 variants we sought to investigate in our extremely discordant sibpair cohort of 268 Caucasian subjects. In our analysis we also included <it>CFH </it>Y402H which has been previously analyzed in this cohort <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. No significant deviations from Hardy-Weinberg equilibrium for any of the variants studied were observed in the unaffected siblings, indicating unlikely contamination of our dataset. For genotype and allele frequencies for each of these SNPs, please see Additional File <supplr sid="S1">1</supplr>.</p>
         <suppl id="S1">
            <title>
               <p>Additional file 1</p>
            </title>
            <text>
               <p>"Genotype and Allele Frequencies", is a word file containing the genotype and allele frequencies of all the SNPs genotyped.</p>
            </text>
            <file name="1471-2350-9-51-S1.doc">
               <p>Click here for file</p>
            </file>
         </suppl>
         <p>The results of both types of McNemar's tests, likelihood ratio tests and resulting <it>P </it>values for all 35 SNPs after controlling for age, gender and smoking are shown in Table <tblr tid="T1">1</tblr>. The resulting odds ratios, confidence intervals and mode of inheritance resulting from the LRT also appear in Table <tblr tid="T1">1</tblr>. In addition to the Y402H <it>CFH </it>variant, 23 SNPs were significantly associated with neovascular AMD risk (Table <tblr tid="T1">1</tblr>). PHASE produced similar results to SNPHAP for diplotype reconstruction so we focused the remainder of our analysis using SNPHAP. Many variants located in tamdem on 1q32-q22 including those in complement Factor H (<it>CFH</it>), complement factor H-related 4 (<it>CFHR4</it>), complement factor H-related 2 (<it>CFHR2</it>), complement factor H-related 5 (<it>CFHR5</it>), coagulation factor 13 subunit B (<it>F13B</it>), abnormal spindle-like microcephaly associated (<it>ASPM</it>) and zinc finger and BTB domain containing 41 homolog (<it>ZBTB41</it>) were significantly associated with AMD risk (Table <tblr tid="T1">1</tblr>). According to LRT, single SNP analysis showed that <it>CFH </it>rs572515 on 1q25 was the most strongly associated SNP with AMD risk under an additive model. All SNPs analyzed on 1q32-q22 except for <it>F13B </it>rs2990510 were significantly associated with neovascular AMD risk using the LRT (<it>P </it>&lt; .01). SNP rs9288410 (<it>MAP2</it>) on 2q35-q34 and SNP rs2014307 on 10q26 <it>PLEKHA1</it>/<it>HTRA1 </it>were also associated with AMD risk (OR: 1.92; 95% C.I.: 0.89, 4.18; <it>P </it>= 0.03 and OR: 0.240; 95% C.I.: 0.11, .52; <it>P </it>&lt; 10<sup>-4 </sup>respectively). According to ENSEMBL <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, SNP rs2014307 is equidistant between the end of <it>PLEKHA1 </it>and the beginning of <it>HTRA1</it>. Single SNP analysis in the 1q32-q22 region was confirmed by demonstrating that the haplotype GATAGTTCTC for alleles spanning <it>CFH</it>, <it>CFHR4</it>, and <it>CFHR2 </it>were associated with the greatest risk of neovascular AMD (<it>P </it>&lt; 10<sup>-6</sup>). These 9 SNPs, which included the Y402H <it>CFH </it>variant, spanned the 1q31-1q32 region and formed two haplotype blocks (Figure <figr fid="F1">1a</figr> and Figure <figr fid="F1">1b</figr>) that were in linkage disequilibrium (D' = 0.79) (Figure <figr fid="F1">1c</figr>) (see Table <tblr tid="T2">2</tblr>).</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p><b>1a</b>. Linkage disequilibrium (<it>D</it>') between the genotyped SNPs as shown in a heat map</p>
            </caption>
            <text>
               <p><b>1a</b>. <b>Linkage disequilibrium (<it>D</it>') between the genotyped SNPs as shown in a heat map.</b> SNPs encompassing the1q22-q32 region are represented by 3 distinct haplotype blocks. The more red the color, the higher the LD which is indicated by the gradient bar to the right of the LD plot. <b>1b</b>. Linkage disequilibrium (<it>D</it>') between the genotyped SNPs as shown in an LD plot. <b>1c</b>. Haplotypes Haplotypes of SNPs together with estimated frequencies are shown. The values of multi-allelic D' (.79, .76, and .14) reflect the level of recombination between adjacent blocks. <b>Abbreviations:</b> bp, base pairs; SNP, Single Nucleotide Polymorphism; Linkage disequilibrium (<it>D</it><sup>'</sup>).</p>
            </text>
            <graphic file="1471-2350-9-51-1"/>
         </fig>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Single SNP Analysis</p>
            </caption>
            <tblbdy cols="8">
               <r>
                  <c ca="left">
                     <p>
                        <b>SNP</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Gene*</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Location*</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>2 &#215; 2 McNemar's test <it>p</it></b>
                        <b>-value</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>3 &#215; 3 McNemar's test <it>p</it></b>
                        <b>-value</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Likelihood Ratio Test </b>
                        <b>
                           <it>p</it>
                        </b>
                        <b>-value</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Odds Ratio (95% C.I.) of most likely mode of inheritance</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Likelihood Ratio Test Model</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs800292</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0005</p>
                  </c>
                  <c ca="left">
                     <p>1.6766E-05</p>
                  </c>
                  <c ca="left">
                     <p>0.0020</p>
                  </c>
                  <c ca="left">
                     <p>0.295(0.126&#8211;0.693)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs572515</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>1.1422E-06</p>
                  </c>
                  <c ca="left">
                     <p>2.1771E-09</p>
                  </c>
                  <c ca="left">
                     <p>7.0012E-07</p>
                  </c>
                  <c ca="left">
                     <p>4.619(2.288&#8211;9.326)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7529589</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0003</p>
                  </c>
                  <c ca="left">
                     <p>1.6852E-05</p>
                  </c>
                  <c ca="left">
                     <p>1.2034E-05</p>
                  </c>
                  <c ca="left">
                     <p>8.403(2.670&#8211;26.442)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1061170</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0002</p>
                  </c>
                  <c ca="left">
                     <p>3.9821E-05</p>
                  </c>
                  <c ca="left">
                     <p>1.9045E-05</p>
                  </c>
                  <c ca="left">
                     <p>7.382(2.495&#8211;21.838)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs12038333</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0001</p>
                  </c>
                  <c ca="left">
                     <p>1.7989E-06</p>
                  </c>
                  <c ca="left">
                     <p>8.3182E-06</p>
                  </c>
                  <c ca="left">
                     <p>3.151(1.707&#8211;5.819)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs203674</p>
                  </c>
                  <c ca="left">
                     <p>CFH</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>5.7447E-06</p>
                  </c>
                  <c ca="left">
                     <p>5.0608E-08</p>
                  </c>
                  <c ca="left">
                     <p>4.3995E-06</p>
                  </c>
                  <c ca="left">
                     <p>3.914(2.020&#8211;7.585)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10801575</p>
                  </c>
                  <c ca="left">
                     <p>~CFH</p>
                  </c>
                  <c ca="left">
                     <p>~1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0304</p>
                  </c>
                  <c ca="left">
                     <p>0.0315</p>
                  </c>
                  <c ca="left">
                     <p>0.0108</p>
                  </c>
                  <c ca="left">
                     <p>0.370(0.174&#8211;0.785)</p>
                  </c>
                  <c ca="left">
                     <p>Dominant</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1853883</p>
                  </c>
                  <c ca="left">
                     <p>CFHR4</p>
                  </c>
                  <c ca="left">
                     <p>1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0001</p>
                  </c>
                  <c ca="left">
                     <p>6.9750E-06</p>
                  </c>
                  <c ca="left">
                     <p>0.0003</p>
                  </c>
                  <c ca="left">
                     <p>2.687(1.519&#8211;4.751)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3790414</p>
                  </c>
                  <c ca="left">
                     <p>CFHR2</p>
                  </c>
                  <c ca="left">
                     <p>1q31-q32.1</p>
                  </c>
                  <c ca="left">
                     <p>0.0018</p>
                  </c>
                  <c ca="left">
                     <p>0.0002</p>
                  </c>
                  <c ca="left">
                     <p>0.0137</p>
                  </c>
                  <c ca="left">
                     <p>0.424(0.206&#8211;0.876)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1759016</p>
                  </c>
                  <c ca="left">
                     <p>CFHR5</p>
                  </c>
                  <c ca="left">
                     <p>1q22-q23</p>
                  </c>
                  <c ca="left">
                     <p>0.0092</p>
                  </c>
                  <c ca="left">
                     <p>0.0037</p>
                  </c>
                  <c ca="left">
                     <p>0.0092</p>
                  </c>
                  <c ca="left">
                     <p>0.465(0.262&#8211;0.827)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10922152</p>
                  </c>
                  <c ca="left">
                     <p>CFHR5</p>
                  </c>
                  <c ca="left">
                     <p>1q22-q23</p>
                  </c>
                  <c ca="left">
                     <p>0.0007</p>
                  </c>
                  <c ca="left">
                     <p>0.0001</p>
                  </c>
                  <c ca="left">
                     <p>0.0014</p>
                  </c>
                  <c ca="left">
                     <p>0.434(0.258&#8211;0.730)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10922153</p>
                  </c>
                  <c ca="left">
                     <p>CFHR5</p>
                  </c>
                  <c ca="left">
                     <p>1q22-q23</p>
                  </c>
                  <c ca="left">
                     <p>0.0002</p>
                  </c>
                  <c ca="left">
                     <p>1.0290E-05</p>
                  </c>
                  <c ca="left">
                     <p>0.0004</p>
                  </c>
                  <c ca="left">
                     <p>0.389(0.224&#8211;0.677)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6663083</p>
                  </c>
                  <c ca="left">
                     <p>?</p>
                  </c>
                  <c ca="left">
                     <p>1q31-1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0003</p>
                  </c>
                  <c ca="left">
                     <p>1.6704E-05</p>
                  </c>
                  <c ca="left">
                     <p>0.0008</p>
                  </c>
                  <c ca="left">
                     <p>0.419(0.248&#8211;0.707)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2990510</p>
                  </c>
                  <c ca="left">
                     <p>F13B</p>
                  </c>
                  <c ca="left">
                     <p>1q31-q32.1</p>
                  </c>
                  <c ca="left">
                     <p>0.0438</p>
                  </c>
                  <c ca="left">
                     <p>0.0395</p>
                  </c>
                  <c ca="left">
                     <p>0.1003</p>
                  </c>
                  <c ca="left">
                     <p>2.462(0.801&#8211;7.571)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6003</p>
                  </c>
                  <c ca="left">
                     <p>F13B</p>
                  </c>
                  <c ca="left">
                     <p>1q31-q32.1</p>
                  </c>
                  <c ca="left">
                     <p>0.0153</p>
                  </c>
                  <c ca="left">
                     <p>0.0022</p>
                  </c>
                  <c ca="left">
                     <p>0.0025</p>
                  </c>
                  <c ca="left">
                     <p>0.162(0.041&#8211;0.631)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1412632</p>
                  </c>
                  <c ca="left">
                     <p>?</p>
                  </c>
                  <c ca="left">
                     <p>1q31-1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0153</p>
                  </c>
                  <c ca="left">
                     <p>0.0022</p>
                  </c>
                  <c ca="left">
                     <p>0.0030</p>
                  </c>
                  <c ca="left">
                     <p>0.165(0.042&#8211;0.645)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1412631</p>
                  </c>
                  <c ca="left">
                     <p>?</p>
                  </c>
                  <c ca="left">
                     <p>1q31-1q32</p>
                  </c>
                  <c ca="left">
                     <p>0.0098</p>
                  </c>
                  <c ca="left">
                     <p>0.0005</p>
                  </c>
                  <c ca="left">
                     <p>0.0013</p>
                  </c>
                  <c ca="left">
                     <p>0.110(0.022&#8211;0.557)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs12677</p>
                  </c>
                  <c ca="left">
                     <p>ASPM</p>
                  </c>
                  <c ca="left">
                     <p>1q31</p>
                  </c>
                  <c ca="left">
                     <p>0.0098</p>
                  </c>
                  <c ca="left">
                     <p>0.0005</p>
                  </c>
                  <c ca="left">
                     <p>0.0019</p>
                  </c>
                  <c ca="left">
                     <p>0.127(0.026&#8211;0.609)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs4915337</p>
                  </c>
                  <c ca="left">
                     <p>ASPM</p>
                  </c>
                  <c ca="left">
                     <p>1q31</p>
                  </c>
                  <c ca="left">
                     <p>0.0614</p>
                  </c>
                  <c ca="left">
                     <p>0.0233</p>
                  </c>
                  <c ca="left">
                     <p>0.0067</p>
                  </c>
                  <c ca="left">
                     <p>0.182(0.045&#8211;0.740)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1888991</p>
                  </c>
                  <c ca="left">
                     <p>ASPM</p>
                  </c>
                  <c ca="left">
                     <p>1q31</p>
                  </c>
                  <c ca="left">
                     <p>0.0244</p>
                  </c>
                  <c ca="left">
                     <p>0.0051</p>
                  </c>
                  <c ca="left">
                     <p>0.0044</p>
                  </c>
                  <c ca="left">
                     <p>0.175(0.044&#8211;0.696)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6677082</p>
                  </c>
                  <c ca="left">
                     <p>ASPM</p>
                  </c>
                  <c ca="left">
                     <p>1q31</p>
                  </c>
                  <c ca="left">
                     <p>0.0244</p>
                  </c>
                  <c ca="left">
                     <p>0.0051</p>
                  </c>
                  <c ca="left">
                     <p>0.0048</p>
                  </c>
                  <c ca="left">
                     <p>0.175(0.044&#8211;0.695)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6656448</p>
                  </c>
                  <c ca="left">
                     <p>ZBTB41</p>
                  </c>
                  <c ca="left">
                     <p>1q31.3</p>
                  </c>
                  <c ca="left">
                     <p>0.0218</p>
                  </c>
                  <c ca="left">
                     <p>0.0054</p>
                  </c>
                  <c ca="left">
                     <p>0.0042</p>
                  </c>
                  <c ca="left">
                     <p>0.209(0.063&#8211;0.694)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs9288410</p>
                  </c>
                  <c ca="left">
                     <p>MAP2</p>
                  </c>
                  <c ca="left">
                     <p>2q34-q35</p>
                  </c>
                  <c ca="left">
                     <p>0.5563</p>
                  </c>
                  <c ca="left">
                     <p>0.3721</p>
                  </c>
                  <c ca="left">
                     <p>0.0294</p>
                  </c>
                  <c ca="left">
                     <p>1.923(0.885&#8211;4.179)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs304039</p>
                  </c>
                  <c ca="left">
                     <p>ITPR1</p>
                  </c>
                  <c ca="left">
                     <p>3p26-p25</p>
                  </c>
                  <c ca="left">
                     <p>0.6774</p>
                  </c>
                  <c ca="left">
                     <p>0.7070</p>
                  </c>
                  <c ca="left">
                     <p>0.1035</p>
                  </c>
                  <c ca="left">
                     <p>1.943(0.858&#8211;4.396)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs304041</p>
                  </c>
                  <c ca="left">
                     <p>ITPR1</p>
                  </c>
                  <c ca="left">
                     <p>3p26-p25</p>
                  </c>
                  <c ca="left">
                     <p>0.5896</p>
                  </c>
                  <c ca="left">
                     <p>0.4206</p>
                  </c>
                  <c ca="left">
                     <p>0.1035</p>
                  </c>
                  <c ca="left">
                     <p>1.943(0.858&#8211;4.396)</p>
                  </c>
                  <c ca="left">
                     <p>Recessive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1038639</p>
                  </c>
                  <c ca="left">
                     <p>ITPR1</p>
                  </c>
                  <c ca="left">
                     <p>3p26-p25</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.9062</p>
                  </c>
                  <c ca="left">
                     <p>0.4345</p>
                  </c>
                  <c ca="left">
                     <p>0.731(0.332&#8211;1.610)</p>
                  </c>
                  <c ca="left">
                     <p>Dominant</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1447338</p>
                  </c>
                  <c ca="left">
                     <p>?</p>
                  </c>
                  <c ca="left">
                     <p>4q34-4q35</p>
                  </c>
                  <c ca="left">
                     <p>0.5419</p>
                  </c>
                  <c ca="left">
                     <p>0.4856</p>
                  </c>
                  <c ca="left">
                     <p>0.2949</p>
                  </c>
                  <c ca="left">
                     <p>1.350(0.730&#8211;2.497)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7090030</p>
                  </c>
                  <c ca="left">
                     <p>ADD3</p>
                  </c>
                  <c ca="left">
                     <p>10q24.2-q24.3</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.5834</p>
                  </c>
                  <c ca="left">
                     <p>0.485(0.035&#8211;6.710)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11194995</p>
                  </c>
                  <c ca="left">
                     <p>ADD3</p>
                  </c>
                  <c ca="left">
                     <p>10q24.2-q24.3</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.5834</p>
                  </c>
                  <c ca="left">
                     <p>0.485(0.035&#8211;6.710)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11194996</p>
                  </c>
                  <c ca="left">
                     <p>ADD3</p>
                  </c>
                  <c ca="left">
                     <p>10q24.2-q24.3</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.9217</p>
                  </c>
                  <c ca="left">
                     <p>0.881(0.071&#8211;10.862)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11195001</p>
                  </c>
                  <c ca="left">
                     <p>ADD3</p>
                  </c>
                  <c ca="left">
                     <p>10q24.2-q24.3</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.485(0.035&#8211;6.715)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2014307</p>
                  </c>
                  <c ca="left">
                     <p>PLEKHA1/HTRA1</p>
                  </c>
                  <c ca="left">
                     <p>10q26</p>
                  </c>
                  <c ca="left">
                     <p>6.6872E-06</p>
                  </c>
                  <c ca="left">
                     <p>8.1056E-07</p>
                  </c>
                  <c ca="left">
                     <p>3.7092E-05</p>
                  </c>
                  <c ca="left">
                     <p>0.240(0.111&#8211;0.520)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs949252</p>
                  </c>
                  <c ca="left">
                     <p>GPR152</p>
                  </c>
                  <c ca="left">
                     <p>11q13.1</p>
                  </c>
                  <c ca="left">
                     <p>0.4795</p>
                  </c>
                  <c ca="left">
                     <p>0.4795</p>
                  </c>
                  <c ca="left">
                     <p>0.1979</p>
                  </c>
                  <c ca="left">
                     <p>2.006(0.115&#8211;35.135)</p>
                  </c>
                  <c ca="left">
                     <p>Dominant</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7124630</p>
                  </c>
                  <c ca="left">
                     <p>TMEM134</p>
                  </c>
                  <c ca="left">
                     <p>11q13.1</p>
                  </c>
                  <c ca="left">
                     <p>0.4795</p>
                  </c>
                  <c ca="left">
                     <p>0.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.3864</p>
                  </c>
                  <c ca="left">
                     <p>1.004E-07(0.000-Inf)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11575221</p>
                  </c>
                  <c ca="left">
                     <p>STAT2</p>
                  </c>
                  <c ca="left">
                     <p>12q13-12q14</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>1.0000</p>
                  </c>
                  <c ca="left">
                     <p>0.4358</p>
                  </c>
                  <c ca="left">
                     <p>2.740(0.204&#8211;36.835)</p>
                  </c>
                  <c ca="left">
                     <p>Additive</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><b>Abbreviations: </b>SNP, single nucleotide polymorphism; C.I., confidence interval.</p>
               <p>* Gene and location of each SNP determined using ENSEMBL [15].</p>
            </tblfn>
         </tbl>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Legend of Figure 1.</p>
            </caption>
            <tblbdy cols="4">
               <r>
                  <c ca="left">
                     <p>ID</p>
                  </c>
                  <c ca="left">
                     <p>rs number</p>
                  </c>
                  <c ca="center">
                     <p>Chromosome</p>
                  </c>
                  <c ca="right">
                     <p>Position (bp)</p>
                  </c>
               </r>
               <r>
                  <c cspan="4">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1</p>
                  </c>
                  <c ca="left">
                     <p>rs800292</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169751219</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2</p>
                  </c>
                  <c ca="left">
                     <p>rs572515</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169755247</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3</p>
                  </c>
                  <c ca="left">
                     <p>rs7529589</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169767262</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>4</p>
                  </c>
                  <c ca="left">
                     <p>rs1061170</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169768220</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>5</p>
                  </c>
                  <c ca="left">
                     <p>rs12038333</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169781422</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>6</p>
                  </c>
                  <c ca="left">
                     <p>rs203674</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169793601</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>7</p>
                  </c>
                  <c ca="left">
                     <p>rs10801575</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169966624</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>8</p>
                  </c>
                  <c ca="left">
                     <p>rs1853883</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>169995661</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>9</p>
                  </c>
                  <c ca="left">
                     <p>rs3790414</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170045770</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>10</p>
                  </c>
                  <c ca="left">
                     <p>rs1759016</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170077967</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>11</p>
                  </c>
                  <c ca="left">
                     <p>rs10922152</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170088475</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>12</p>
                  </c>
                  <c ca="left">
                     <p>rs10922153</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170104084</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>13</p>
                  </c>
                  <c ca="left">
                     <p>rs6663083</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170106129</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>14</p>
                  </c>
                  <c ca="left">
                     <p>rs2990510</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170146127</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>15</p>
                  </c>
                  <c ca="left">
                     <p>rs6003</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170156490</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>16</p>
                  </c>
                  <c ca="left">
                     <p>rs1412632</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170162337</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>17</p>
                  </c>
                  <c ca="left">
                     <p>rs1412631</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170162706</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>18</p>
                  </c>
                  <c ca="left">
                     <p>rs12677</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170178842</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>19</p>
                  </c>
                  <c ca="left">
                     <p>rs4915337</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170217004</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>20</p>
                  </c>
                  <c ca="left">
                     <p>rs1888991</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170236289</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>21</p>
                  </c>
                  <c ca="left">
                     <p>rs6677082</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170238000</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>22</p>
                  </c>
                  <c ca="left">
                     <p>rs6656448</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="right">
                     <p>170268765</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>23</p>
                  </c>
                  <c ca="left">
                     <p>rs9288410</p>
                  </c>
                  <c ca="center">
                     <p>2</p>
                  </c>
                  <c ca="right">
                     <p>204266059</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>24</p>
                  </c>
                  <c ca="left">
                     <p>rs304039</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="right">
                     <p>4490512</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>25</p>
                  </c>
                  <c ca="left">
                     <p>rs304041</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="right">
                     <p>4491054</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>26</p>
                  </c>
                  <c ca="left">
                     <p>rs1038639</p>
                  </c>
                  <c ca="center">
                     <p>3</p>
                  </c>
                  <c ca="right">
                     <p>4500754</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>27</p>
                  </c>
                  <c ca="left">
                     <p>rs1447338</p>
                  </c>
                  <c ca="center">
                     <p>4</p>
                  </c>
                  <c ca="right">
                     <p>178374405</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>28</p>
                  </c>
                  <c ca="left">
                     <p>rs7090030</p>
                  </c>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="right">
                     <p>105592344</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>29</p>
                  </c>
                  <c ca="left">
                     <p>rs11194995</p>
                  </c>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="right">
                     <p>105619802</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>30</p>
                  </c>
                  <c ca="left">
                     <p>rs11194996</p>
                  </c>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="right">
                     <p>105621397</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>31</p>
                  </c>
                  <c ca="left">
                     <p>rs11195001</p>
                  </c>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="right">
                     <p>105626325</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>32</p>
                  </c>
                  <c ca="left">
                     <p>rs2014307</p>
                  </c>
                  <c ca="center">
                     <p>10</p>
                  </c>
                  <c ca="right">
                     <p>117949887</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>33</p>
                  </c>
                  <c ca="left">
                     <p>rs949252</p>
                  </c>
                  <c ca="center">
                     <p>11</p>
                  </c>
                  <c ca="right">
                     <p>66975485</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>34</p>
                  </c>
                  <c ca="left">
                     <p>rs7124630</p>
                  </c>
                  <c ca="center">
                     <p>11</p>
                  </c>
                  <c ca="right">
                     <p>66997187</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>35</p>
                  </c>
                  <c ca="left">
                     <p>rs11575221</p>
                  </c>
                  <c ca="center">
                     <p>12</p>
                  </c>
                  <c ca="right">
                     <p>56407497</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>Table <tblr tid="T3">3</tblr> shows the results for testing interaction, joint effects and main effects of each significantly associated SNP on chromosome 1 with rs2014307 on chromosome 10. After controlling for smoking, age and gender, the resulting <it>P </it>values, odds ratios and 95% C.I. of each SNP, while controlling for the other SNP, are shown. Almost all of the combinations of SNP pairs tested showed no interaction at 0.05 level of significance, except for rs800292/rs2014307 and rs3790414/rs2014307. However, neither of these SNP pair combinations was significant after applying a Bonferroni correction. Therefore, no interaction is found in the joint effect and main effect analyses.</p>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Pairwise SNP Analysis</p>
            </caption>
            <tblbdy cols="7">
               <r>
                  <c ca="left">
                     <p>
                        <b>SNP</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Interaction</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Joint effect of SNP and rs2014307</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Effect of SNP, controlling for rs2014307</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Odds Ratio (95% C.I.)</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Effect of rs2014307, controlling for SNP</b>
                     </p>
                  </c>
                  <c ca="right">
                     <p>
                        <b>Odds Ratio (95% C.I.)</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="7">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs800292</p>
                  </c>
                  <c ca="right">
                     <p>0.034082688</p>
                  </c>
                  <c ca="right">
                     <p>1.51E-06</p>
                  </c>
                  <c ca="right">
                     <p>0.0005</p>
                  </c>
                  <c ca="right">
                     <p>0.369(0.151&#8211;0.899)</p>
                  </c>
                  <c ca="right">
                     <p>0.0193</p>
                  </c>
                  <c ca="right">
                     <p>0.271(0.122&#8211;0.603)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs572515</p>
                  </c>
                  <c ca="right">
                     <p>0.560883637</p>
                  </c>
                  <c ca="right">
                     <p>2.03E-10</p>
                  </c>
                  <c ca="right">
                     <p>0.0003</p>
                  </c>
                  <c ca="right">
                     <p>4.817(2.236&#8211;10.379)</p>
                  </c>
                  <c ca="right">
                     <p>3.7602E-06</p>
                  </c>
                  <c ca="right">
                     <p>0.233(0.096&#8211;0.562)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7529589</p>
                  </c>
                  <c ca="right">
                     <p>0.454600765</p>
                  </c>
                  <c ca="right">
                     <p>7.27E-09</p>
                  </c>
                  <c ca="right">
                     <p>0.0007</p>
                  </c>
                  <c ca="right">
                     <p>7.861(2.283&#8211;27.066)</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.260(0.112&#8211;0.605)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1061170</p>
                  </c>
                  <c ca="right">
                     <p>0.597380515</p>
                  </c>
                  <c ca="right">
                     <p>2.22E-08</p>
                  </c>
                  <c ca="right">
                     <p>0.0007</p>
                  </c>
                  <c ca="right">
                     <p>6.831(2.113&#8211;22.079)</p>
                  </c>
                  <c ca="right">
                     <p>0.0002</p>
                  </c>
                  <c ca="right">
                     <p>0.258(0.111&#8211;0.600)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs12038333</p>
                  </c>
                  <c ca="right">
                     <p>0.393546389</p>
                  </c>
                  <c ca="right">
                     <p>4.22E-08</p>
                  </c>
                  <c ca="right">
                     <p>0.0006</p>
                  </c>
                  <c ca="right">
                     <p>2.884(1.512&#8211;5.503)</p>
                  </c>
                  <c ca="right">
                     <p>0.0004</p>
                  </c>
                  <c ca="right">
                     <p>0.272(0.121&#8211;0.609)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs203674</p>
                  </c>
                  <c ca="right">
                     <p>0.463309999</p>
                  </c>
                  <c ca="right">
                     <p>2.68E-09</p>
                  </c>
                  <c ca="right">
                     <p>0.0007</p>
                  </c>
                  <c ca="right">
                     <p>3.721(1.847&#8211;7.496)</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.256(0.109&#8211;0.603)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10801575</p>
                  </c>
                  <c ca="right">
                     <p>0.808299262</p>
                  </c>
                  <c ca="right">
                     <p>1.49E-11</p>
                  </c>
                  <c ca="right">
                     <p>4.0182E-05</p>
                  </c>
                  <c ca="right">
                     <p>0.309(0.135&#8211;0.710)</p>
                  </c>
                  <c ca="right">
                     <p>0.0078</p>
                  </c>
                  <c ca="right">
                     <p>0.194(0.079&#8211;0.475)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1853883</p>
                  </c>
                  <c ca="right">
                     <p>0.760773267</p>
                  </c>
                  <c ca="right">
                     <p>9.31E-08</p>
                  </c>
                  <c ca="right">
                     <p>0.0004</p>
                  </c>
                  <c ca="right">
                     <p>2.448(1.355&#8211;4.421)</p>
                  </c>
                  <c ca="right">
                     <p>0.0021</p>
                  </c>
                  <c ca="right">
                     <p>0.263(0.117&#8211;0.589)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3790414</p>
                  </c>
                  <c ca="right">
                     <p>0.088493626</p>
                  </c>
                  <c ca="right">
                     <p>2.96E-06</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.463(0.213&#8211;1.004)</p>
                  </c>
                  <c ca="right">
                     <p>0.0411</p>
                  </c>
                  <c ca="right">
                     <p>0.252(0.115&#8211;0.554)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1759016</p>
                  </c>
                  <c ca="right">
                     <p>0.873846771</p>
                  </c>
                  <c ca="right">
                     <p>9.04E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.490(0.266&#8211;0.902)</p>
                  </c>
                  <c ca="right">
                     <p>0.0244</p>
                  </c>
                  <c ca="right">
                     <p>0.246(0.111&#8211;0.545)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10922152</p>
                  </c>
                  <c ca="right">
                     <p>0.876195836</p>
                  </c>
                  <c ca="right">
                     <p>1.15E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0002</p>
                  </c>
                  <c ca="right">
                     <p>0.484(0.282&#8211;0.831)</p>
                  </c>
                  <c ca="right">
                     <p>0.0056</p>
                  </c>
                  <c ca="right">
                     <p>0.245(0.107&#8211;0.558)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10922153</p>
                  </c>
                  <c ca="right">
                     <p>0.518399094</p>
                  </c>
                  <c ca="right">
                     <p>2.99E-09</p>
                  </c>
                  <c ca="right">
                     <p>0.0006</p>
                  </c>
                  <c ca="right">
                     <p>0.413(0.232&#8211;0.736)</p>
                  </c>
                  <c ca="right">
                     <p>0.0052</p>
                  </c>
                  <c ca="right">
                     <p>0.259(0.110&#8211;0.606)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6663083</p>
                  </c>
                  <c ca="right">
                     <p>0.989583181</p>
                  </c>
                  <c ca="right">
                     <p>6.89E-08</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.443(0.258&#8211;0.761)</p>
                  </c>
                  <c ca="right">
                     <p>0.0015</p>
                  </c>
                  <c ca="right">
                     <p>0.223(0.095&#8211;0.523)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2990510</p>
                  </c>
                  <c ca="right">
                     <p>0.487660055</p>
                  </c>
                  <c ca="right">
                     <p>4.62E-06</p>
                  </c>
                  <c ca="right">
                     <p>3.9350E-05</p>
                  </c>
                  <c ca="right">
                     <p>2.894(0.874&#8211;9.585)</p>
                  </c>
                  <c ca="right">
                     <p>0.0684</p>
                  </c>
                  <c ca="right">
                     <p>0.222(0.099&#8211;0.499)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6003</p>
                  </c>
                  <c ca="right">
                     <p>0.454199074</p>
                  </c>
                  <c ca="right">
                     <p>4.15E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.151(0.035&#8211;0.649)</p>
                  </c>
                  <c ca="right">
                     <p>0.0048</p>
                  </c>
                  <c ca="right">
                     <p>0.222(0.098&#8211;0.501)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1412632</p>
                  </c>
                  <c ca="right">
                     <p>0.396769175</p>
                  </c>
                  <c ca="right">
                     <p>5.61E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.164(0.038&#8211;0.697)</p>
                  </c>
                  <c ca="right">
                     <p>0.0066</p>
                  </c>
                  <c ca="right">
                     <p>0.226(0.100&#8211;0.509)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1412631</p>
                  </c>
                  <c ca="right">
                     <p>0.64561949</p>
                  </c>
                  <c ca="right">
                     <p>2.26E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.113(0.021&#8211;0.592)</p>
                  </c>
                  <c ca="right">
                     <p>0.0025</p>
                  </c>
                  <c ca="right">
                     <p>0.234(0.104&#8211;0.527)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs12677</p>
                  </c>
                  <c ca="right">
                     <p>0.500827762</p>
                  </c>
                  <c ca="right">
                     <p>5.73E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0002</p>
                  </c>
                  <c ca="right">
                     <p>0.132(0.025&#8211;0.707)</p>
                  </c>
                  <c ca="right">
                     <p>0.0068</p>
                  </c>
                  <c ca="right">
                     <p>0.239(0.108&#8211;0.528)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs4915337</p>
                  </c>
                  <c ca="right">
                     <p>0.313727331</p>
                  </c>
                  <c ca="right">
                     <p>1.02E-06</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.176(0.040&#8211;0.782)</p>
                  </c>
                  <c ca="right">
                     <p>0.0127</p>
                  </c>
                  <c ca="right">
                     <p>0.239(0.108&#8211;0.528)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1888991</p>
                  </c>
                  <c ca="right">
                     <p>0.454199074</p>
                  </c>
                  <c ca="right">
                     <p>4.15E-07</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.151(0.035&#8211;0.649)</p>
                  </c>
                  <c ca="right">
                     <p>0.0048</p>
                  </c>
                  <c ca="right">
                     <p>0.222(0.098&#8211;0.501)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6677082</p>
                  </c>
                  <c ca="right">
                     <p>0.454199074</p>
                  </c>
                  <c ca="right">
                     <p>4.15E-07</p>
                  </c>
                  <c ca="right">
                     <p>4.8640E-05</p>
                  </c>
                  <c ca="right">
                     <p>0.151(0.035&#8211;0.649)</p>
                  </c>
                  <c ca="right">
                     <p>0.0048</p>
                  </c>
                  <c ca="right">
                     <p>0.222(0.098&#8211;0.501)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs6656448</p>
                  </c>
                  <c ca="right">
                     <p>0.707806912</p>
                  </c>
                  <c ca="right">
                     <p>1.10E-06</p>
                  </c>
                  <c ca="right">
                     <p>0.0001</p>
                  </c>
                  <c ca="right">
                     <p>0.224(0.062&#8211;0.809)</p>
                  </c>
                  <c ca="right">
                     <p>0.0136</p>
                  </c>
                  <c ca="right">
                     <p>0.236(0.106&#8211;0.525)</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><b>Abbreviations: </b>SNP, Single Nucleotide Polymorphism; C.I., Confidence Interval.</p>
            </tblfn>
         </tbl>
         <p>The most significant joint effect is observed between rs10801575 and rs2014307 (<it>P </it>&lt; 10<sup>-11</sup>). The LRT demonstrated that <it>CFH </it>SNP rs10801575 fits best under a dominant model whereas rs2014307 fits best under an additive model. The main effect for each of these SNPs individually is highly significant (OR: 3.16; 95% C.I.: 3.16, 7.347; <it>P </it>&lt; 10<sup>-4</sup>and OR: 0.26; 95% C.I.: 0.13, .55; <it>P </it>&lt; 10<sup>-6</sup>, respectively).</p>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Inconsistency in replication of findings among studies could possibly be due to population stratification, disease heterogeneity, and/or diagnostic heterogeneity in phenotype among cases <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. In the study presented here, using phenotypically well defined extremely discordant sibpairs, we were able to confirm the NEI/NCBI dbGAP findings for chromosomes 1, 2 and 10 in a Caucasian population (mostly derived from the U.S.) employing a different methodological design <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Moreover, our findings suggest that specific genetic variants may predispose to the neovascular form of AMD, as the dbGAP data included cases with both neovascularization and geographic atrophy. On the other hand, it could be that our use of the Bonferroni correction was overly stringent (given the LD between many of the SNPs) and this could account for the fact that we only observed a portion of the variants as being significantly associated with neovascular AMD risk. However, in both study designs (NEI and the study presented here) these variants were only examined for association with advanced stages of AMD, and it may be that these variants are also associated with the early forms of AMD as well. Further, we were able to demonstrate the risk of AMD conferred by the joint effect of these SNPs while controlling for smoking history, age and gender. The most significant joint effect was between rs10801575 (<it>CFH</it>) and rs2014307 (<it>PLEKHA1/HTRA1</it>) (<it>P </it>&lt; 10<sup>-11</sup>). After controlling for the effect of each SNP with respect to the other, it was evident that this joint effect was due to the significant assocation of SNP rs2014307 with AMD risk, as the <it>p </it>value was greater for the <it>PLEKHA1/HTRA1 </it>SNP (<it>P </it>&lt; 10<sup>-6</sup>) than it was for <it>CFH </it>SNP rs10801575, (<it>P </it>&lt; 10<sup>-4</sup>). While these findings support the contribution of chromosome 1q22-q32, they also demonstrate that the 10q26 region is likely more stongly associated with neovascular AMD risk <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. It may be that the dbGAP variants we analyzed on chromosomes 3p, 4q, 11q and 12q predispose an individual to the geographic atrophic subytpe. Whether or not these variants represent true disease causing variants or are in high LD with the susceptibilily allele remains to be determined. We demonstrated that variants in the complement pathway genes <it>CFH</it>, <it>CFHR2</it>, <it>CFHR4 </it>and <it>CFHR5 </it>are significantly associated with AMD risk, however variants in these genes may not be independent factors in the pathophysiology of AMD due to the high LD throughout the 1q25-1q32 region <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>We also demonstrated that significantly associated variants in <it>F13B</it>, <it>ASPM</it>, <it>MAP2 </it>and <it>ZBTB41 </it>point to other pathways yet to be studied in AMD etiology. <it>F13B </it>is the noncatalytic subunit of coagulation factor 13, which upon activation by thrombin, functions to covalently cross-link fibrin, making a clot mechanically stronger and more resistant to fibrinolysis <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. <it>F13B </it>is composed of 641 amino acids, divided into 10 tandem repeats, which is characteristic of the complement activation system regulatory proteins <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> There is also a structural similarity between <it>F13B </it>and <it>CFH </it><abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Both <it>ASPM </it>and <it>MAP2 </it>play a critical role during neurogenesis. <it>ASPM </it>regulates brain growth and mutations in this gene were shown to be associated with microcephaly <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. Further ASPM has been implicated in tumor cell proliferation and growth <abbrgrp><abbr bid="B33">33</abbr></abbrgrp><it> MAP2 </it>stabilizes and interacts with microtubules during the growth, differentiation, and development of neurons <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. Further, <it>ZBTB41 </it>proteins are transcription regulators, functioning in a wide range of processes, including development, differentiation, and oncogenesis <abbrgrp><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp>. <it>ZBTB41 </it>proteins also play an important role in the hematopoietic system, particularly in T cell development and function <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>In summary, this is the first report to confirm association of neovascular AMD risk variants obtained from the NEI/NCBI dbGAP database. Moreover, we show that specific variants may predispose to only the neovascular form of AMD, and in agreement with others, show that the 10q26 region is more strongly associated with neovascular AMD risk than 1q.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Patient population</p>
            </st>
            <p>The protocol was reviewed and approved by the Institutional Review Boards at the Massachusetts Eye &amp; Ear Infirmary (MEEI), Boston, Massachusetts and the William Beaumont Hospital, Royal Oak, Michigan and conforms to the tenets of the Declaration of Helsinki. Eligible patients were enrolled in this study after they gave informed consent either in person, over the phone, or through the mail, before answering questions to a standardized questionnaire and donating 10 to 50 ml of venous blood.</p>
            <p>Details of the recruitment of patients and their siblings are described elsewhere <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B39">39</abbr></abbrgrp>. In brief, all index patients were aged 50 years or older and had the neovascular form of AMD in at least one eye, defined by subretinal hemorrhage, fibrosis, or fluorescein angiographic presence of neovascularization documented at the time of, or prior to, enrollment in the study. Patients whose only exudative finding was a retinal pigment epithelium detachment were excluded because this finding may not represent definite neovascular AMD and, therefore, the severe phenotype we sought. Patients with signs of pathologic myopia, presumed ocular histoplasmosis syndrome, angioid streaks, choroidal rupture, any hereditary retinal diseases other than AMD, and previous laser treatment due to retinal conditions other than AMD were also excluded.</p>
            <p>The unaffected siblings had normal maculae at an age older than that at which the index patient was first diagnosed with neovascular AMD. Normal maculae (defined as the zone centered at the foveola and extending 2 disc diameters, or 3000 microns, in radius) fulfilled the following criteria: 0&#8211;5 small drusen (all less than 63 microns in diameter), no pigment abnormalities, no geographic atrophy, and no neovascularization (as defined previously <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B39">39</abbr></abbrgrp>; AMD "category 1" or less on the AREDS scale). Disease status of every participant was confirmed by at least two of the investigators by evaluation of fundus photographs or fluorescein angiograms except when one of the investigators directly examined an unaffected sibling during a home visit (n = 4 cases). Subject characteristics of our extremely discordant sibpair population are presented in Table <tblr tid="T4">4</tblr>.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Subject Characteristics</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Population</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Mean Age (years)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Range</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Standard Deviation</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>% Male (n/134)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Affected Siblings</p>
                     </c>
                     <c ca="left">
                        <p>71.28</p>
                     </c>
                     <c ca="left">
                        <p>48.97&#8211;86.38</p>
                     </c>
                     <c ca="left">
                        <p>8.26</p>
                     </c>
                     <c ca="left">
                        <p>45.5% (61/134)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Unaffected Siblings</p>
                     </c>
                     <c ca="left">
                        <p>72.77</p>
                     </c>
                     <c ca="left">
                        <p>41.32&#8211;90.86</p>
                     </c>
                     <c ca="left">
                        <p>8.97</p>
                     </c>
                     <c ca="left">
                        <p>39.6% (53/134)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Additionally, we administered a standardized questionnaire to all eligible participants in person or over the phone to ascertain smoking exposure, with the age of the index patient at the time of the fundus photographs as our cutoff reference age for smoking exposure for both members in a sibship. In most cases, the diagnosis of AMD was made simultaneously with the diagnosis of neovascular AMD. If a participant ever smoked, we recorded the age when they started smoking, the age when they quit smoking (if they did quit), and the number of packs of cigarettes smoked per day, on average. Based on the responses, the number of pack-years of cigarettes smoked was calculated for each smoker. Participants who smoked less than 100 cigarettes during their lifetime (i.e., less than 1/73 of a pack-year) were categorized as having never smoked. A pack-year was defined as one pack of cigarettes per day for one year, with one pack defined as twenty cigarettes.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping Analysis</p>
            </st>
            <p>For both the Sequenom iPLEX system technology and direct sequencing protocols, leukocyte DNA was either purified by using standard phenol-chloroform or DNAzol (Invitrogen Corporation, Carlsbad, California) extraction protocols.</p>
            <p>Multiplex PCR assays were designed using Sequenom SpectroDESIGNER software (version 3.0.0.3) by inputting sequence containing the SNP site and 100 bp of flanking sequence on either side of the SNP. Briefly, 10 ng genomic DNA was amplified in a 5 ul reaction containing 1 &#215; HotStar Taq PCR buffer (Qiagen), 1.625 mM MgCl<sub>2</sub>, 500 uM each dNTP, 100 nM each PCR primer, 0.5 U HotStar Taq (Qiagen). The reaction was incubated at 94&#176;C for 15 minutes followed by 45 cycles of 94&#176;C for 20 seconds, 56&#176;C for 30 seconds, 72&#176;C for 1 minute, followed by 3 minutes at 72&#176;C. Excess dNTPs were then removed from the reaction by incubation with 0.3 U shrimp alkaline phosphatase (USB) at 37&#176;C for 40 minutes followed by 5 minutes at 85&#176;C to deactivate the enzyme. Single primer extension over the SNP was carried out in a final concentration of between 0.625 uM and 1.5 uM for each extension primer (depending on the mass of the probe), iPLEX termination mix (Sequenom) and 1.35 U iPLEX enzyme (Sequenom) and cycled using a two-step 200 short cycles program; 94&#176;C for 30 seconds followed by 40 cycles of 94&#176;C for 5 seconds, 5 cycles of 52&#176;C for 5 seconds, and 80&#176;C for 5 seconds, then 72&#176;C for 3 minutes. The reaction was then desalted by addition of 6 mg cation exchange resin followed by mixing and centrifugation to settle the contents of the tube. The extension product was then spotted onto a 384 well spectroCHIP before being flown in the MALDI-TOF mass spectrometer. Data was collected, real time, using SpectroTYPER Analyzer 3.3.0.15, SpectraAQUIRE 3.3.1.1 and SpectroCALLER 3.3.0.14 (Sequenom). Additionally, to ensure data quality, genotypes for each subject were also checked manually.</p>
            <p>Six of the dbGAP SNPs (rs11575221, rs949252, rs11194995, rs6656448, rs12677, rs6003) were not amenable to genotyping by the Sequenom iPLEX system technology and thus were directly sequenced. Oligonucleotide primers were selected using the Primer3 program <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> to encompass the entire coding region and flanking intronic sequences except in the case of an intronic SNP (rs6656448) where at least 100 base pairs on either side of the variant was sequenced and analyzed (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>PCR Conditions</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <ul>SNPs</ul>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ul>Gene</ul>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ul>Location</ul>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ul>Variant</ul>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ul>Forward primer</ul>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ul>Reverse Primer</ul>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs11575221</p>
                     </c>
                     <c ca="left">
                        <p>?</p>
                     </c>
                     <c ca="left">
                        <p>?</p>
                     </c>
                     <c ca="left">
                        <p>A/C</p>
                     </c>
                     <c ca="left">
                        <p>TCTCCAGGCTCCTCAAGCTA</p>
                     </c>
                     <c ca="left">
                        <p>CGCCTACAACTTCGGCTAAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs949252</p>
                     </c>
                     <c ca="left">
                        <p>GPR152</p>
                     </c>
                     <c ca="left">
                        <p>Exon 01</p>
                     </c>
                     <c ca="left">
                        <p>T/C</p>
                     </c>
                     <c ca="left">
                        <p>CAGCCACAGCTGAACCCTAC</p>
                     </c>
                     <c ca="left">
                        <p>TCTGACTGGCTGGTTCCTCT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs11194995</p>
                     </c>
                     <c ca="left">
                        <p>ADD3</p>
                     </c>
                     <c ca="left">
                        <p>Intron 12</p>
                     </c>
                     <c ca="left">
                        <p>C/T</p>
                     </c>
                     <c ca="left">
                        <p>TCAAGAGTGTTTTCTTCCCATTT</p>
                     </c>
                     <c ca="left">
                        <p>ATTAGTCGGGCACGGTGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs6656448</p>
                     </c>
                     <c ca="left">
                        <p>ZBTB41</p>
                     </c>
                     <c ca="left">
                        <p>Intron 02</p>
                     </c>
                     <c ca="left">
                        <p>G/A</p>
                     </c>
                     <c ca="left">
                        <p>ATTAACACGCCTCCAACCAC</p>
                     </c>
                     <c ca="left">
                        <p>CAACAGTGTTTGGGCTGAGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs12677</p>
                     </c>
                     <c ca="left">
                        <p>ASPM</p>
                     </c>
                     <c ca="left">
                        <p>3' UTR</p>
                     </c>
                     <c ca="left">
                        <p>C/T</p>
                     </c>
                     <c ca="left">
                        <p>GGGAAATGATGTGTTCAGGAG</p>
                     </c>
                     <c ca="left">
                        <p>AGGTGTAATCAGCTATTATTTCCTTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>rs6003</p>
                     </c>
                     <c ca="left">
                        <p>F13B</p>
                     </c>
                     <c ca="left">
                        <p>Exon 10</p>
                     </c>
                     <c ca="left">
                        <p>G/A</p>
                     </c>
                     <c ca="left">
                        <p>TCCAAAATGAAATCGCCAAT</p>
                     </c>
                     <c ca="left">
                        <p>GGTGGGTTGTAGGGATTGAG</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>Abbreviations: </b>PCR, Polymerase Chain Reaction; SNP, Single Nucleotide Polymorphism.</p>
               </tblfn>
            </tbl>
            <p>For all amplicons, the polymerase chain reaction (PCR) was used to amplify genomic DNA fragments from 20 ng of leukocyte DNA in a solution of 10&#215; PCR buffer containing 25 mM of MgCl<sub>2</sub>, 0.2 mM each of dATP, dTTP, dGTP, and dCTP, and 0.5 units of Taq DNA polymerase (USB Corporation, Cleveland, OH). 5 M Betaine was added to each PCR (Sigma-Aldrich, St. Louis, MO), except for the reactions containing primers used to analyze rs12677 and rs6003. The temperatures used during the polymerase chain reaction were as follows: 95&#176;C for 5 minutes followed by 35 cycles of 58&#176;C for 30 seconds, 72&#176;C for 30 seconds and 95&#176;C for 30 seconds, with a final annealing at 58&#176;C for 1.5 minutes and extension of 72&#176;C for 5 minutes. For sequencing reactions, PCR products were digested according to manufacturer's protocol with ExoSAP-IT (USB Corporation, Cleveland, OH) then were subjected to a cycle sequencing reaction using the Big Dye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) according to manufacturer's protocol. Products were purified with Performa DTR Ultra 96-well plates (Edge Biosystems, Gaithersburg, MD) in order to remove excess dye terminators. Samples were sequenced on an ABI Prism 3100 DNA sequencer (Applied Biosystems, Foster City, CA). Electropherograms generated from the ABI Prism 3100 were analyzed using the Lasergene DNA and protein analysis software (DNASTAR, Inc., Madison, WI). Electropherograms were read by two independent evaluators without knowledge of the subject's disease status. All patients were sequenced in the forward direction (5' to 3'), unless variants or polymorphisms were identified, in which case confirmation was obtained in some cases by sequencing in the reverse direction.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical Analyses</p>
            </st>
            <p>Statistical analysis was performed using the R and STATA (v8) packages. The McNemar's test was used to evaluate the effect of each SNP individually on risk of AMD. First the standard 2 &#215; 2 table was constructed, and then a modification of the McNemar's test using a 3 &#215; 3 table, <inline-formula><m:math name="1471-2350-9-51-i1" xmlns:m="http://www.w3.org/1998/Math/MathML"><m:semantics><m:mrow><m:msub><m:mi>T</m:mi><m:mn>1</m:mn></m:msub><m:mo>=</m:mo><m:mfrac><m:mrow><m:msup><m:mrow><m:mo stretchy="false">(</m:mo><m:mo>|</m:mo><m:mi>b</m:mi><m:mo>&#8722;</m:mo><m:mi>c</m:mi><m:mo>|</m:mo><m:mo>+</m:mo><m:mn>1</m:mn><m:mo stretchy="false">)</m:mo></m:mrow><m:mn>2</m:mn></m:msup></m:mrow><m:mrow><m:mi>b</m:mi><m:mo>+</m:mo><m:mi>c</m:mi></m:mrow></m:mfrac></m:mrow><m:annotation encoding="MathType-MTEF">
 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGaemivaq1aaSbaaSqaaiabigdaXaqabaGccqGH9aqpjuaGdaWcaaqaaiabcIcaOiabcYha8jabdkgaIjabgkHiTiabdogaJjabcYha8jabgUcaRiabigdaXiabcMcaPmaaCaaabeqaaiabikdaYaaaaeaacqWGIbGycqGHRaWkcqWGJbWyaaaaaa@3E6F@</m:annotation></m:semantics></m:math></inline-formula> was also employed to compare the effect of the three genotypes for each variant simultaneously. A Bonferroni correction was applied to all resulting <it>P </it>values that were calculated for each allele of the 35 SNPs that met these criteria. Linkage disequilibrium (<it>r</it><sup>2</sup>) between adjacent SNPs on the same chromosome was evaluated. Both SNPHAP and Phase were used separately in cases and controls to reconstruct the diplotype (haplotype pair) for each sample in each SNP group. The posterior probability for any of the resulting diplotypes was calculated. The diplotype with the largest probability (> 0.80 for all of the samples) was picked up as the designated diplotype. For haplotype analysis, SNPs that fit the following criteria were analyzed: selected SNPs on the same chromosome, adjacent SNPs in statistically significant LD, and minor allele frequencies were similar. Both types of McNemar's tests were then used to determine significant haplotypes. Conditional logistic regression (CLR) was performed to identify factors associated with neovascular AMD. Potential risk factors, SNPs, were evaluated initially one at a time. Any significant allelic factors were then tested for significance while controlling for age, gender and smoking history. For each significant SNP, the minor allele (in unaffected siblings) in both the homozygous and heterozygous states versus the common allele in the homozygous state was examined in the model. Gene-gene interaction was tested first by assuming each locus had two alleles, with three possible genotypes and 9 possible two-locus genotypes. The likelihood ratio test (LRT) was used to test the null hypothesis of no gene-gene interaction (logarithm of odds ratio = 0). Three genotypic models were examined (Additive, Dominant, and Recessive) using the likelihood ratio test.</p>
            <p>Genotype and allele frequencies for all SNPs identified as significant were calculated in the affected and separately in unaffected siblings [see Additional File <supplr sid="S1">1</supplr>]. Deviation from Hardy-Weinberg Equilibrium (HWE) was tested on each SNP in unaffected (control) individuals using the chi square test.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>HZ participated in the design of the study, performed the statistical analysis and helped to draft the manuscript. AD participated in the design of the study and performed the statistical analysis. MAM carried out the molecular genetic studies, participated in the sequence alignment, Sequenom analysis and helped to draft the manuscript. SA, MA, NH, MR, AB carried out the molecular genetic studies, participated in the sequence alignment and Sequenom analysis. JWM, IKK participated in the design of the study, recruited and characterized patients. JH conceived of the study, participated in its design and coordination, performed the statistical analysis and helped to draft the manuscript. MMD conceived of the study, participated in its design and coordination, recruited and characterized patents, carried out the molecular genetic studies, participated in the sequence alignment, Sequenom analysis and helped to draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This study was supported by grants from the Ruth and Milton Steinbach Fund, the Lincy Foundation, the Massachusetts Lions, Friends of the Massachusetts Eye and Ear Infirmary, Genetics of Age-related Macular Degeneration Fund, MEEI, Research to Prevent Blindness, Marion W. and Edward F. Knight AMD Fund, Fight for Sight and NIH grants EY014458 and EY14104.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Prevalence of Age-Related Macular Degeneration</p>
            </title>
            <aug>
               <au>
                  <cnm>The Eye Diseases Prevalence Research Group</cnm>
               </au>
            </aug>
            <source>Archives of Ophthalmology</source>
            <pubdate>2004</pubdate>
            <volume>122</volume>
            <fpage>564</fpage>
            <lpage>574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archopht.122.4.564</pubid>
                  <pubid idtype="pmpid">15078675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>National Eye Institute (NEI) Age-Related Eye Disease Study (AREDS)</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/study.cgi?id=phs000001</url>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The NCBI dbGaP database of genotypes and phenotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Mailman</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Feolo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kimura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tryka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bagoutdinov</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hao</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kiang</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Paschall</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Phan</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Popova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Pretel</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ziyabari</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>ZY</fnm>
               </au>
               <au>
                  <snm>Sirotkin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kholodov</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zbicz</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kimelman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shevelev</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Preuss</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Yaschenko</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Graeff</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ostell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sherry</snm>
                  <fnm>ST</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2007</pubdate>
            <volume>39</volume>
            <fpage>1181</fpage>
            <lpage>1186</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2031016</pubid>
                  <pubid idtype="pmpid" link="fulltext">17898773</pubid>
                  <pubid idtype="doi">10.1038/ng1007-1181</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Extreme discordant sib pairs for mapping quantitative trait loci in humans</p>
            </title>
            <aug>
               <au>
                  <snm>Risch</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1995</pubdate>
            <volume>268</volume>
            <fpage>1584</fpage>
            <lpage>1589</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.7777857</pubid>
                  <pubid idtype="pmpid" link="fulltext">7777857</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>An international classification system and grading system for age-related maculopathy and age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Bird</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Bressler</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Bressler</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Chisholm</snm>
                  <fnm>IH</fnm>
               </au>
               <au>
                  <snm>Coscas</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>De Jong</snm>
                  <fnm>PTVM</fnm>
               </au>
               <au>
                  <snm>Klaver</snm>
                  <fnm>CCW</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>BEK</fnm>
               </au>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sarks</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Sarks</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Soubrane</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Vingerling</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Surv Ophthalmol</source>
            <pubdate>1995</pubdate>
            <volume>39</volume>
            <fpage>367</fpage>
            <lpage>374</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0039-6257(05)80092-X</pubid>
                  <pubid idtype="pmpid">7604360</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Prevalence of age-related maculopathy. The Beaver Dam Eye Study</p>
            </title>
            <aug>
               <au>
                  <snm>Klein</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>BE</fnm>
               </au>
               <au>
                  <snm>Linton</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>1992</pubdate>
            <volume>99</volume>
            <fpage>933</fpage>
            <lpage>943</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1630784</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Prevalence of age-related macular degeneration in 4 racial/ethnic groups in the multi-ethnic study of atherosclerosis</p>
            </title>
            <aug>
               <au>
                  <snm>Klein</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>BE</fnm>
               </au>
               <au>
                  <snm>Knudtson</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>TY</fnm>
               </au>
               <au>
                  <snm>Cotch</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Burke</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Saad</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>DR</fnm>
                  <suf>Jr.</suf>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>2006</pubdate>
            <volume>113</volume>
            <fpage>373</fpage>
            <lpage>380</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ophtha.2005.12.013</pubid>
                  <pubid idtype="pmpid" link="fulltext">16513455</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Prevalence of age-related macular degeneration in the United States</p>
            </title>
            <aug>
               <au>
                  <snm>Friedman</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>O'Colmain</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Munoz</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Tomany</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>McCarty</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>de Jong</snm>
                  <fnm>PT</fnm>
               </au>
               <au>
                  <snm>Nemesure</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kempen</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Arch Ophthalmol</source>
            <pubdate>2004</pubdate>
            <volume>122</volume>
            <fpage>564</fpage>
            <lpage>572</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archopht.122.7.1019</pubid>
                  <pubid idtype="pmpid">15078675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>The Prevalence of Age-related Maculopathy in the Rotterdam Study</p>
            </title>
            <aug>
               <au>
                  <snm>Vingerling</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Dielemans</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Hofman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grobbee</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Hijmering</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kramer</snm>
                  <fnm>CFL</fnm>
               </au>
               <au>
                  <snm>De Jong</snm>
                  <fnm>PTVM</fnm>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>1995</pubdate>
            <volume>102</volume>
            <fpage>205</fpage>
            <lpage>210</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7862408</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Prevalence of age-related maculopathy in Australia. The Blue Mountains Eye Study</p>
            </title>
            <aug>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Attebo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>1995</pubdate>
            <volume>102</volume>
            <fpage>1450</fpage>
            <lpage>1460</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9097791</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Mapping quantitative trait loci with extreme discordant sib pairs: sampling considerations</p>
            </title>
            <aug>
               <au>
                  <snm>Risch</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1996</pubdate>
            <volume>58</volume>
            <fpage>836</fpage>
            <lpage>843</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1914664</pubid>
                  <pubid idtype="pmpid">8644748</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Genetic association mapping based on discordant sib pairs: the discordant-alleles test</p>
            </title>
            <aug>
               <au>
                  <snm>Boehnke</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Langefeld</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1998</pubdate>
            <volume>62</volume>
            <fpage>950</fpage>
            <lpage>961</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1377027</pubid>
                  <pubid idtype="pmpid" link="fulltext">9529345</pubid>
                  <pubid idtype="doi">10.1086/301787</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Cigarette smoking, CFH, APOE, ELOVL4, and risk of neovascular age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>DeAngelis</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Ji</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>IK</fnm>
               </au>
               <au>
                  <snm>Adams</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Capone</snm>
                  <fnm>A</fnm>
                  <suf>Jr.</suf>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Dryja</snm>
                  <fnm>TP</fnm>
               </au>
            </aug>
            <source>Arch Ophthalmol</source>
            <pubdate>2007</pubdate>
            <volume>125</volume>
            <fpage>49</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archopht.125.1.49</pubid>
                  <pubid idtype="pmpid" link="fulltext">17210851</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Alleles in the HtrA Serine Peptidase 1 Gene Alter the Risk of Neovascular Age-Related Macular Degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>DeAngelis</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Ji</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Adams</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Morrison</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Harring</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Sweeney</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Capone</snm>
                  <fnm>A</fnm>
                  <suf>Jr.</suf>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Dryja</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>IK</fnm>
               </au>
            </aug>
            <source>Ophthalmology</source>
            <pubdate>2007</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18164066</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>ENSEMBL Genome Browser</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://www.ensembl.org/Homo_sapiens/geneview?gene</url>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Neovascular age-related macular degeneration and its association with LOC387715 and complement factor H polymorphism</p>
            </title>
            <aug>
               <au>
                  <snm>Shuler</snm>
                  <fnm>RK</fnm>
                  <suf>Jr.</suf>
               </au>
               <au>
                  <snm>Hauser</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Caldwell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gallins</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Agarwal</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Haines</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Pericak-Vance</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Postel</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Arch Ophthalmol</source>
            <pubdate>2007</pubdate>
            <volume>125</volume>
            <fpage>63</fpage>
            <lpage>67</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archopht.125.1.63</pubid>
                  <pubid idtype="pmpid" link="fulltext">17210853</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>HTRA1 promoter polymorphism in wet age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Dewan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hartman</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>DT</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tam</snm>
                  <fnm>PO</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Snyder</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barnstable</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pang</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Hoh</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2006</pubdate>
            <volume>314</volume>
            <fpage>989</fpage>
            <lpage>992</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1133807</pubid>
                  <pubid idtype="pmpid" link="fulltext">17053108</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Camp</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tong</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Gibbs</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cameron</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Pearson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Chien</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dewan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Harmon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bernstein</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Shridhar</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zabriskie</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Hoh</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Howes</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2006</pubdate>
            <volume>314</volume>
            <fpage>992</fpage>
            <lpage>993</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1133811</pubid>
                  <pubid idtype="pmpid" link="fulltext">17053109</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Complement factor H polymorphism in age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Klein</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Zeiss</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chew</snm>
                  <fnm>EY</fnm>
               </au>
               <au>
                  <snm>Tsai</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Sackler</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Haynes</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Henning</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>SanGiovanni</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Mane</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Mayne</snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Bracken</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Ferris</snm>
                  <fnm>FL</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Barnstable</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hoh</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>308</volume>
            <fpage>385</fpage>
            <lpage>389</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1512523</pubid>
                  <pubid idtype="pmpid" link="fulltext">15761122</pubid>
                  <pubid idtype="doi">10.1126/science.1109557</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Complement factor H variant increases the risk of age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Haines</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Hauser</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Gallins</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Spencer</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Kwan</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Noureddine</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gilbert</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Schnetz-Boutaud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Agarwal</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Postel</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Pericak-Vance</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>308</volume>
            <fpage>419</fpage>
            <lpage>421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1110359</pubid>
                  <pubid idtype="pmpid" link="fulltext">15761120</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Complement factor H polymorphism and age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Edwards</snm>
                  <fnm>AO</fnm>
               </au>
               <au>
                  <snm>Ritter</snm>
                  <fnm>R</fnm>
                  <suf>III</suf>
               </au>
               <au>
                  <snm>Abel</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Manning</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Panhuysen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Farrer</snm>
                  <fnm>LA</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>308</volume>
            <fpage>421</fpage>
            <lpage>424</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1110189</pubid>
                  <pubid idtype="pmpid" link="fulltext">15761121</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Strong association of the Y402H variant in complement factor H at 1q32 with susceptibility to age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Zareparsi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Branham</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shah</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hoh</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Abecasis</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Swaroop</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>77</volume>
            <fpage>149</fpage>
            <lpage>153</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1226187</pubid>
                  <pubid idtype="pmpid" link="fulltext">15895326</pubid>
                  <pubid idtype="doi">10.1086/431426</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Hageman</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>LV</fnm>
               </au>
               <au>
                  <snm>Hancox</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Taiber</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Hardisty</snm>
                  <fnm>LI</fnm>
               </au>
               <au>
                  <snm>Hageman</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Stockman</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Borchardt</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gehrs</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Silvestri</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Klaver</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Barbazetto</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yannuzzi</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Barile</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Merriam</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Olsh</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Bergeron</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zernant</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Merriam</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Gold</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Dean</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Allikmets</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <fpage>7227</fpage>
            <lpage>7232</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1088171</pubid>
                  <pubid idtype="pmpid" link="fulltext">15870199</pubid>
                  <pubid idtype="doi">10.1073/pnas.0501536102</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Common variation in three genes, including a noncoding variant in CFH, strongly influences risk of age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Maller</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>George</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Purcell</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fagerness</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Altshuler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Seddon</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2006</pubdate>
            <volume>38</volume>
            <fpage>1055</fpage>
            <lpage>1059</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1873</pubid>
                  <pubid idtype="pmpid" link="fulltext">16936732</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A common CFH haplotype, with deletion of CFHR1 and CFHR3, is associated with lower risk of age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Hughes</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Orr</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Esfandiary</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>az-Torres</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Goodship</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Chakravarthy</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2006</pubdate>
            <volume>38</volume>
            <fpage>1173</fpage>
            <lpage>1177</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng1890</pubid>
                  <pubid idtype="pmpid" link="fulltext">16998489</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A novel polymorphism in the factor XIII B-subunit (His95Arg): relationship to subunit dissociation and venous thrombosis</p>
            </title>
            <aug>
               <au>
                  <snm>Komanasin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Catto</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Futers</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>van</snm>
                  <fnm>H</fnm>
                  <suf>V</suf>
               </au>
               <au>
                  <snm>Rosendaal</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>Ariens</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>J Thromb Haemost</source>
            <pubdate>2005</pubdate>
            <volume>3</volume>
            <fpage>2487</fpage>
            <lpage>2496</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1538-7836.2005.01624.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16241947</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Coagulation factor XIII B subunit is encoded by a gene linked to the regulator of complement activation (RCA) gene cluster in man</p>
            </title>
            <aug>
               <au>
                  <snm>Rodriguez de</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Rey-Campos</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dykes</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>McAlpine</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rubinstein</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Immunogenetics</source>
            <pubdate>1988</pubdate>
            <volume>28</volume>
            <fpage>452</fpage>
            <lpage>454</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00355378</pubid>
                  <pubid idtype="pmpid">3182017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Molecular cloning of the b subunit of mouse coagulation factor XIII and assignment of the gene to chromosome 1: close evolutionary relationship to complement factor H</p>
            </title>
            <aug>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shiroishi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Moriwaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Natsuume-Sakai</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>1993</pubdate>
            <volume>15</volume>
            <fpage>535</fpage>
            <lpage>542</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.1993.1106</pubid>
                  <pubid idtype="pmpid" link="fulltext">8468048</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>A physical map of the human regulator of complement activation gene cluster linking the complement genes CR1, CR2, DAF, and C4BP</p>
            </title>
            <aug>
               <au>
                  <snm>Rey-Campos</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rubinstein</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rodriguez de</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>1988</pubdate>
            <volume>167</volume>
            <fpage>664</fpage>
            <lpage>669</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2188826</pubid>
                  <pubid idtype="pmpid">2450163</pubid>
                  <pubid idtype="doi">10.1084/jem.167.2.664</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>ASPM is a major determinant of cerebral cortical size</p>
            </title>
            <aug>
               <au>
                  <snm>Bond</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Roberts</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mochida</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Hampshire</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Askham</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Springell</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mahadevan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Crow</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Markham</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Walsh</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Woods</snm>
                  <fnm>CG</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2002</pubdate>
            <volume>32</volume>
            <fpage>316</fpage>
            <lpage>320</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng995</pubid>
                  <pubid idtype="pmpid" link="fulltext">12355089</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Genetic analysis of primary microcephaly in Indian families: novel ASPM mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Blanton</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Babu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Markandaya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Girimaji</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Clin Genet</source>
            <pubdate>2004</pubdate>
            <volume>66</volume>
            <fpage>341</fpage>
            <lpage>348</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1399-0004.2004.00304.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15355437</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Novel protein-truncating mutations in the ASPM gene in families with autosomal recessive primary microcephaly</p>
            </title>
            <aug>
               <au>
                  <snm>Gul</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tariq</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khan</snm>
                  <fnm>MN</fnm>
               </au>
               <au>
                  <snm>Hassan</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Ali</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ahmad</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>J Neurogenet</source>
            <pubdate>2007</pubdate>
            <volume>21</volume>
            <fpage>153</fpage>
            <lpage>163</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/01677060701508594</pubid>
                  <pubid idtype="pmpid" link="fulltext">17849285</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Analysis of oncogenic signaling networks in glioblastoma identifies ASPM as a molecular target</p>
            </title>
            <aug>
               <au>
                  <snm>Horvath</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Carlson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>KV</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Felciano</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Laurance</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Qi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Scheck</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Liau</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Geschwind</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Febbo</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Kornblum</snm>
                  <fnm>HI</fnm>
               </au>
               <au>
                  <snm>Cloughesy</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Mischel</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2006</pubdate>
            <volume>103</volume>
            <fpage>17402</fpage>
            <lpage>17407</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1635024</pubid>
                  <pubid idtype="pmpid" link="fulltext">17090670</pubid>
                  <pubid idtype="doi">10.1073/pnas.0608396103</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Suppression of MAP2 in cultured cerebellar macroneurons inhibits minor neurite formation</p>
            </title>
            <aug>
               <au>
                  <snm>Caceres</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mautino</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kosik</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>Neuron</source>
            <pubdate>1992</pubdate>
            <volume>9</volume>
            <fpage>607</fpage>
            <lpage>618</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0896-6273(92)90025-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">1389180</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The role of microtubule-associated protein 2 (MAP-2) in neuronal growth, plasticity, and degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Johnson</snm>
                  <fnm>GV</fnm>
               </au>
               <au>
                  <snm>Jope</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>J Neurosci Res</source>
            <pubdate>1992</pubdate>
            <volume>33</volume>
            <fpage>505</fpage>
            <lpage>512</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jnr.490330402</pubid>
                  <pubid idtype="pmpid">1484385</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>MAMO, a maternal BTB/POZ-Zn-finger protein enriched in germline progenitors is required for the production of functional eggs in Drosophila</p>
            </title>
            <aug>
               <au>
                  <snm>Mukai</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hayashi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kitadate</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shigenobu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Arita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mech Dev</source>
            <pubdate>2007</pubdate>
            <volume>124</volume>
            <fpage>570</fpage>
            <lpage>583</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.mod.2007.05.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">17600690</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Genomewide identification of prednisolone-responsive genes in acute lymphoblastic leukemia cells</p>
            </title>
            <aug>
               <au>
                  <snm>Tissing</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>den Boer</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Meijerink</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Menezes</snm>
                  <fnm>RX</fnm>
               </au>
               <au>
                  <snm>Swagemakers</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>van der Spek</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Sallan</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Armstrong</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Pieters</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2007</pubdate>
            <volume>109</volume>
            <fpage>3929</fpage>
            <lpage>3935</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2006-11-056366</pubid>
                  <pubid idtype="pmpid" link="fulltext">17218380</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>The role of BTB domain-containing zinc finger proteins in T cell development and function</p>
            </title>
            <aug>
               <au>
                  <snm>Bilic</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Ellmeier</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Immunol Lett</source>
            <pubdate>2007</pubdate>
            <volume>108</volume>
            <fpage>1</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.imlet.2006.09.007</pubid>
                  <pubid idtype="pmpid" link="fulltext">17084908</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Extremely discordant sib-pair study design to determine risk factors for neovascular age-related macular degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>DeAngelis</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Shah</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Ott</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dryja</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Arch Ophthalmol</source>
            <pubdate>2004</pubdate>
            <volume>122</volume>
            <fpage>575</fpage>
            <lpage>580</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archopht.122.4.575</pubid>
                  <pubid idtype="pmpid">15078676</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Primer3</p>
            </title>
            <pubdate>2007</pubdate>
            <url>http://primer3.sourceforge.net/</url>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2350/9/51/prepub</url>
         </p>
      </sec>
   </bm>
</art>
