<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2350-8-77</ui>
   <ji>1471-2350</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>No evidence for association between <it>tau </it>gene haplotypic variants and susceptibility to Creutzfeldt-Jakob disease</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>S&#225;nchez-Juan</snm>
               <fnm>Pascual</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>psanchez@humv.es</email>
            </au>
            <au id="A2">
               <snm>Bishop</snm>
               <mi>T</mi>
               <fnm>Matthew</fnm>
               <insr iid="I4"/>
               <email>m.bishop@ed.ac.uk</email>
            </au>
            <au id="A3">
               <snm>Green</snm>
               <fnm>Alison</fnm>
               <insr iid="I4"/>
               <email>alison.green@ed.ac.uk</email>
            </au>
            <au id="A4">
               <snm>Giannattasio</snm>
               <fnm>Claudia</fnm>
               <insr iid="I5"/>
               <email>claudia.giannattasio@iss.it</email>
            </au>
            <au id="A5">
               <snm>Arias-Vasquez</snm>
               <fnm>Alejandro</fnm>
               <insr iid="I2"/>
               <email>a.ariasvasquez@erasmusmc.nl</email>
            </au>
            <au id="A6">
               <snm>Poleggi</snm>
               <fnm>Anna</fnm>
               <insr iid="I5"/>
               <email>anna.poleggi@iss.it</email>
            </au>
            <au id="A7">
               <snm>Knight</snm>
               <mi>SG</mi>
               <fnm>Richard</fnm>
               <insr iid="I4"/>
               <email>r.knight@ed.ac.uk</email>
            </au>
            <au id="A8">
               <snm>van Duijn</snm>
               <mi>M</mi>
               <fnm>Cornelia</fnm>
               <insr iid="I2"/>
               <email>c.vanduijn@erasmusmc.nl</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Institute for Formation and Research of the Fundaci&#243;n "Marqu&#233;s de Valdecilla" (IFIMAV), Santander, Spain</p>
            </ins>
            <ins id="I2">
               <p>Genetic Epidemiology Unit, Epidemiology &amp; Biostatistics department, Erasmus MC, Rotterdam, The Netherlands</p>
            </ins>
            <ins id="I3">
               <p>Centro de Investigaci&#243;n Biom&#233;dica en Red sobre Enfermedades Neurodegenerativas (CIBERNED)</p>
            </ins>
            <ins id="I4">
               <p>National CJD Surveillance Unit, The University of Edinburgh, EH4 2XU Edinburgh, UK</p>
            </ins>
            <ins id="I5">
               <p>Istituto Superiore di Sanit&#224;, Laboratory of Virology, Viale Regina Elena 299, 00161 Rome, Italy</p>
            </ins>
         </insg>
         <source>BMC Medical Genetics</source>
         <issn>1471-2350</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>77</fpage>
         <url>http://www.biomedcentral.com/1471-2350/8/77</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18072964</pubid>
               <pubid idtype="doi">10.1186/1471-2350-8-77</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>02</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>11</day>
               <month>12</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>11</day>
               <month>12</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>S&#225;nchez-Juan et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>A polymorphism at codon 129 of the prion protein gene (<it>PRNP</it>) is the only well-known genetic risk factor for Creutzfeldt-Jakob disease (CJD). However, there is increasing evidence that other loci outside the <it>PRNP </it>open reading frame might play a role in CJD aetiology as well.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>We studied tau protein gene (<it>MAPT</it>) haplotypic variations in a population of sporadic and variant CJD patients. We tested 6 <it>MAPT </it>haplotype tagging SNPs (htSNPs) in a Dutch population-based sample of sporadic CJD (sCJD) patients and a cognitively normal control group of similar age distribution. We genotyped the same polymorphisms in two other sample groups of sCJD cases from Italy and the UK. In addition, we compared <it>MAPT </it>haplotypes between sCJD and variant CJD (vCJD) patients.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Single locus and haplotype analyses did not detect any significant difference between sCJD cases and controls. When we compared <it>MAPT </it>haplotypes between sCJD and variant CJD (vCJD) patients, we found that two of them were represented differently (H1f: 8% in sCJD versus 2% in vCJD; H1j:1% in sCJD versus 7% in vCJD). However, these two haplotypes were rare in both groups of patients, and taking the small sample sizes into account, we cannot exclude that the differences are due to chance. None of the p-values remained statistically significant after applying a multiple testing correction.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our study shows no evidence for an association between <it>MAPT </it>gene variations and sCJD, and some weak evidence for an association to vCJD.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Tau protein plays a key role in the pathogenesis of several neurodegenerative disorders. Neurofibrillary tangles (NFTs) consisting of accumulation of truncated and hyperphosphorylated tau are one of the hallmarks of Alzheimer's disease (AD) <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. NFTs are also present in other neurodegenerative diseases, including progressive supranuclear palsy (PSP), cortico basal degeneration (CBD), Pick's disease, and argyrophilic grain disease and Parkinson's disease (PD) <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. In patients with sporadic CJD, the tau protein is profusely released to the CSF <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. This process is most likely related to the rapid neuronal damage. Tau quantification with Enzyme Linked Immunosorbent Assay (ELISA) is a very valuable aid for sCJD diagnosis <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. In contrast to sCJD, in vCJD there is an increase of phosphorylated-tau forms in CSF <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. The pathogenic implications of this finding are unknown, but it suggests that tau phosphorylation may differ between sCJD and vCJD.</p>
         <p>The tau protein is encoded by <it>MAPT </it>gene, located in chromosome 17. Mutations in <it>MAPT </it>have been identified in frontotemporal dementia (FTD) and pallidopontonigral degeneration <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. There are two common <it>MAPT </it>extended haplotypes in Caucasians, H1 and H2. The H1 haplotype has been linked to several sporadic neurodegenerative disorders like PSP <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>, CBD <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, FTD <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, Parkinson's <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> and some studies suggest to Alzheimer's disease <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>A recent study using data from the HapMap project <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> identified 6 htSNPs capturing 95% of <it>MAPT </it>genetic variability in Caucasians <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The same group showed that H1c, one of the H1 subhaplotypes, was linked to late onset AD <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In the present study we examined the association between <it>MAPT </it>haplotypic variants and risk of sCJD and vCJD.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <p>Cases were derived from population-based surveys of CJD carried out by national CJD registries from 1991 to 2005 in Italy (n = 194 sCJD), the United Kingdom (UK) (n = 48 sCJD and 52 vCJD) and the Netherlands (n = 79 sCJD). All three countries are part of the European CJD surveillance network EuroCJD <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Only patients of Caucasian origin who fulfilled the WHO diagnostic criteria for definite or probable CJD were included <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Definite CJD diagnosis was based on neuropathological examination. Probable cases required an appropriate clinical profile, supported by characteristic findings on MRI, EEG or CSF 14-3-3-protein detection. Whenever possible, all EEGs and MRIs were reviewed by a member of the surveillance system and scored for the presence or absence of typical or characteristic diagnostic features <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. The CSF 14-3-3 immunoassays were performed using Western-blotting <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Healthy controls (n = 309) were participants of the Rotterdam Study, which is a population-based study of 7385 subjects aged 55 years or older <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Controls are all cognitively normal and from Caucasian origin. Signed informed consent to participate in genetic research, approved by the Medical Ethics Committee of the Erasmus Medical Center, was obtained from all controls and patients relatives.</p>
         <p>For all patients and controls, DNA has been extracted from peripheral leucocytes according to a standard protocol. We genotyped five polymorphisms, which had been previously shown to tag the haplotype diversity of <it>MAPT </it>in Caucasians (Figure <figr fid="F1">1</figr>) <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Additionally, the H1/H2 clade was defined by typing the SNP g.8117G>A [numbering according to GenBank accession number <ext-link ext-link-type="gen" ext-link-id="AC091628.2">AC091628.2</ext-link>], with the allele G tagging H1, and the allele A tagging H2 <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. DNA samples were genotyped with a TaqMan allelic discrimination assay by using the primers shown in Table <tblr tid="T1">1</tblr>.</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>SNP sequence</p>
            </caption>
            <tblbdy cols="2">
               <r>
                  <c ca="left">
                     <p>
                        <b>SNP</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>Primer sequence</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rs242559</p>
                  </c>
                  <c ca="left">
                     <p>AGAAAGTTCTCCCAGGAAACAAGAG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>ATTCCTTAGCTGTTACCAGTCACTG</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rs242557</p>
                  </c>
                  <c ca="left">
                     <p>CGTTTCTTCTTCCTTACAAAGCAGTT</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>TGTCACGGGACCAGGG</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rs3785883</p>
                  </c>
                  <c ca="left">
                     <p>GCTCAGCGATATTGTCACATGAC</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>AGTGTCGGCTGGATGGAC</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rs2471738</p>
                  </c>
                  <c ca="left">
                     <p>AGTGGCCTGGTTAGAGACCTT</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>TCTGTCCTGTACCGCAGC</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>H1/H2</p>
                  </c>
                  <c ca="left">
                     <p>GCCGTCCGCCTCTGT</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>CATCGGTCGGGGCCA</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rs7521</p>
                  </c>
                  <c ca="left">
                     <p>CCTGCGTGTCCCATCTACAG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>TCTTCAGCTTTGAAAAGGGTTACCC</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Scheme of <it>MAPT </it>genomic structure showing the position of the 6 SNPs genotyped</p>
            </caption>
            <text>
               <p>Scheme of <it>MAPT </it>genomic structure showing the position of the 6 SNPs genotyped.</p>
            </text>
            <graphic file="1471-2350-8-77-1"/>
         </fig>
         <p>Hardy-Weinberg equilibrium (HWE) was calculated for the 6 htSNPs genotypes in the control population using &#967;<sup>2 </sup>statistics. We set a significance level of 0.01 in order to take into account the number of tests performed. We assessed pairwise linkage disequilibrium (LD) between the 6 htSNPs using D' and r<sup>2 </sup>calculated from the expectation-maximization estimated haplotypes (Figure <figr fid="F2">2</figr>). We used the program SNPStats <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> for the LD analysis. Single locus analyses were performed using SPSS software version 13. Allelic and genotypic frequencies were compared using &#967;<sup>2 </sup>statistics. Adjusted analyses were performed using multiple logistic regression analysis. Age, gender and <it>PRNP </it>M129V genotype were included in the model as covariates. We first compared Dutch sCJD cases and controls using the Italian and UK sCJD populations as replication samples. In a separate analysis we compared UK sCJD with vCJD. Haplotype analyses were performed using the program hplus <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. We performed haplotype analysis comparing controls versus all sCJD patients and UK sCJD patients with vCJD patients.</p>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Linkage disequilibrium (LD) plot showing pairwise correlation between SNPs</p>
            </caption>
            <text>
               <p>Linkage disequilibrium (LD) plot showing pairwise correlation between SNPs.</p>
            </text>
            <graphic file="1471-2350-8-77-2"/>
         </fig>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>Table <tblr tid="T2">2</tblr> shows the basic characteristics of our patients and controls. All htSNPs were in HWE (p > 0.01). Allele frequencies in our control samples were comparable to previous published data <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Descriptive statistics</p>
            </caption>
            <tblbdy cols="9">
               <r>
                  <c ca="center">
                     <p>
                        <b>Origin</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Series</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>n</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>% Females</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>% Definite diagnosis</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Median age (range)</b>
                     </p>
                  </c>
                  <c cspan="3" ca="center">
                     <p>
                        <b>PRNP M129V genotype</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>
                        <b>MM n (%)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>MV n (%)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>VV n (%)</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>NL</p>
                  </c>
                  <c ca="center">
                     <p>sCJD</p>
                  </c>
                  <c ca="center">
                     <p>79</p>
                  </c>
                  <c ca="center">
                     <p>59</p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>67 (34&#8211;87)</p>
                  </c>
                  <c ca="center">
                     <p>48 (67)</p>
                  </c>
                  <c ca="center">
                     <p>16 (22)</p>
                  </c>
                  <c ca="center">
                     <p>8 (11)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>controls</p>
                  </c>
                  <c ca="center">
                     <p>309</p>
                  </c>
                  <c ca="center">
                     <p>56</p>
                  </c>
                  <c ca="center">
                     <p>N/A</p>
                  </c>
                  <c ca="center">
                     <p>71 (55&#8211;93)</p>
                  </c>
                  <c ca="center">
                     <p>135 (45)</p>
                  </c>
                  <c ca="center">
                     <p>145 (48)</p>
                  </c>
                  <c ca="center">
                     <p>23 (8)</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>UK</p>
                  </c>
                  <c ca="center">
                     <p>sCJD</p>
                  </c>
                  <c ca="center">
                     <p>48</p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>50</p>
                  </c>
                  <c ca="center">
                     <p>67 (49&#8211;81)</p>
                  </c>
                  <c ca="center">
                     <p>22 (46)</p>
                  </c>
                  <c ca="center">
                     <p>13 (27)</p>
                  </c>
                  <c ca="center">
                     <p>13 (27)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>vCJD</p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>31</p>
                  </c>
                  <c ca="center">
                     <p>74</p>
                  </c>
                  <c ca="center">
                     <p>25 (12&#8211;62)</p>
                  </c>
                  <c ca="center">
                     <p>52 (100)</p>
                  </c>
                  <c ca="center">
                     <p>0 (0)</p>
                  </c>
                  <c ca="center">
                     <p>0 (0)</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Italy</p>
                  </c>
                  <c ca="center">
                     <p>sCJD</p>
                  </c>
                  <c ca="center">
                     <p>194</p>
                  </c>
                  <c ca="center">
                     <p>57</p>
                  </c>
                  <c ca="center">
                     <p>73</p>
                  </c>
                  <c ca="center">
                     <p>67 (35&#8211;87)</p>
                  </c>
                  <c ca="center">
                     <p>141 (73)</p>
                  </c>
                  <c ca="center">
                     <p>31 (16)</p>
                  </c>
                  <c ca="center">
                     <p>22 (11)</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>In the first analysis we tested whether <it>MAPT </it>genetic variations were associated with risk of sCJD. None of the htSNPs genotypes showed a statistically significant association with the disease when comparing the Dutch cases to the matched controls nor when comparing the other non-Dutch patients. Also the pooled analysis was not significant. Adjustment for age, gender and <it>PRNP </it>M129V genotype did not alter this conclusion. When we compared in a separate analysis <it>MAPT </it>genetic variants between UK sCJD and vCJD, we also failed to find any statistically significant association (Table <tblr tid="T3">3</tblr>).</p>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Single locus analysis of the association between <it>MAPT </it>and Creutzfeldt-Jakob disease</p>
            </caption>
            <tblbdy cols="8">
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="6" ca="center">
                     <p>
                        <b>SNP (alleles)</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>rs242559 (A/c)</p>
                  </c>
                  <c ca="center">
                     <p>rs242557 (G/a)</p>
                  </c>
                  <c ca="center">
                     <p>rs3785883 (G/a)</p>
                  </c>
                  <c ca="center">
                     <p>rs2471738 (C/t)</p>
                  </c>
                  <c ca="center">
                     <p>H1/H2 (G/a)</p>
                  </c>
                  <c ca="center">
                     <p>rs7521 (G/a)</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>Controls</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>467 (0.76)</p>
                  </c>
                  <c ca="center">
                     <p>382 (0.63)</p>
                  </c>
                  <c ca="center">
                     <p>501 (0.82)</p>
                  </c>
                  <c ca="center">
                     <p>495 (0.81)</p>
                  </c>
                  <c ca="center">
                     <p>469 (0.77)</p>
                  </c>
                  <c ca="center">
                     <p>330 (0.54)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>180 (0.60)</p>
                  </c>
                  <c ca="center">
                     <p>123 (0.40)</p>
                  </c>
                  <c ca="center">
                     <p>205 (0.67)</p>
                  </c>
                  <c ca="center">
                     <p>208 (0.68)</p>
                  </c>
                  <c ca="center">
                     <p>183 (0.60)</p>
                  </c>
                  <c ca="center">
                     <p>91 (0.30)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>107 (0.29)</p>
                  </c>
                  <c ca="center">
                     <p>136 (0.45)</p>
                  </c>
                  <c ca="center">
                     <p>91 0.30)</p>
                  </c>
                  <c ca="center">
                     <p>79 (0.26)</p>
                  </c>
                  <c ca="center">
                     <p>103 (0.34)</p>
                  </c>
                  <c ca="center">
                     <p>148 (0.48)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.11)</p>
                  </c>
                  <c ca="center">
                     <p>46 (0.15)</p>
                  </c>
                  <c ca="center">
                     <p>10 (0.03)</p>
                  </c>
                  <c ca="center">
                     <p>18 (0.06)</p>
                  </c>
                  <c ca="center">
                     <p>18 (0.06)</p>
                  </c>
                  <c ca="center">
                     <p>67 (0.22)</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>NL sCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>116 (0.73)</p>
                  </c>
                  <c ca="center">
                     <p>95 (0.60)</p>
                  </c>
                  <c ca="center">
                     <p>134 (0.85)</p>
                  </c>
                  <c ca="center">
                     <p>124 (0.78)</p>
                  </c>
                  <c ca="center">
                     <p>115 (0.73)</p>
                  </c>
                  <c ca="center">
                     <p>88 (0.56)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>47 (0.60)</p>
                  </c>
                  <c ca="center">
                     <p>29 (0.37)</p>
                  </c>
                  <c ca="center">
                     <p>56 (0.71)</p>
                  </c>
                  <c ca="center">
                     <p>50 (0.64)</p>
                  </c>
                  <c ca="center">
                     <p>47 (0.62)</p>
                  </c>
                  <c ca="center">
                     <p>27 (0.35)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>22 (0.28)</p>
                  </c>
                  <c ca="center">
                     <p>37 (0.48)</p>
                  </c>
                  <c ca="center">
                     <p>22 (0.28)</p>
                  </c>
                  <c ca="center">
                     <p>24 (0.31)</p>
                  </c>
                  <c ca="center">
                     <p>21 (0.28)</p>
                  </c>
                  <c ca="center">
                     <p>34 (0.43)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>9 (0.12)</p>
                  </c>
                  <c ca="center">
                     <p>12 (0.15)</p>
                  </c>
                  <c ca="center">
                     <p>1 (0.01)</p>
                  </c>
                  <c ca="center">
                     <p>4 0.05)</p>
                  </c>
                  <c ca="center">
                     <p>8 (0.10)</p>
                  </c>
                  <c ca="center">
                     <p>17 (0.22)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>P-values</p>
                  </c>
                  <c ca="left">
                     <p>Allelic</p>
                  </c>
                  <c ca="center">
                     <p>0.6</p>
                  </c>
                  <c ca="center">
                     <p>0.71</p>
                  </c>
                  <c ca="center">
                     <p>0.41</p>
                  </c>
                  <c ca="center">
                     <p>0.65</p>
                  </c>
                  <c ca="center">
                     <p>0.75</p>
                  </c>
                  <c ca="center">
                     <p>0.59</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Genotypic</p>
                  </c>
                  <c ca="center">
                     <p>0.19 [0.32]</p>
                  </c>
                  <c ca="center">
                     <p>0.87 [0.70]</p>
                  </c>
                  <c ca="center">
                     <p>0.58 [0.76]</p>
                  </c>
                  <c ca="center">
                     <p>0.68 [0.66]</p>
                  </c>
                  <c ca="center">
                     <p>0.27 [0.45]</p>
                  </c>
                  <c ca="center">
                     <p>0.68 [0.71]</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>Italy sCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>297 (0.76)</p>
                  </c>
                  <c ca="center">
                     <p>248 (0.64)</p>
                  </c>
                  <c ca="center">
                     <p>319 (0.82)</p>
                  </c>
                  <c ca="center">
                     <p>301 (0.78)</p>
                  </c>
                  <c ca="center">
                     <p>300 (0.77)</p>
                  </c>
                  <c ca="center">
                     <p>205 (0.53)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>111 (0.58)</p>
                  </c>
                  <c ca="center">
                     <p>84 (0.44)</p>
                  </c>
                  <c ca="center">
                     <p>133 (0.70)</p>
                  </c>
                  <c ca="center">
                     <p>122 (0.64)</p>
                  </c>
                  <c ca="center">
                     <p>116 (0.62)</p>
                  </c>
                  <c ca="center">
                     <p>54 (0.28)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>75 (0.39)</p>
                  </c>
                  <c ca="center">
                     <p>80 (0.42)</p>
                  </c>
                  <c ca="center">
                     <p>51 (0.28)</p>
                  </c>
                  <c ca="center">
                     <p>57 (0.30)</p>
                  </c>
                  <c ca="center">
                     <p>68 (0.36)</p>
                  </c>
                  <c ca="center">
                     <p>97 (0.51)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>6 (0.03)</p>
                  </c>
                  <c ca="center">
                     <p>28 (0.14)</p>
                  </c>
                  <c ca="center">
                     <p>5 (0.02)</p>
                  </c>
                  <c ca="center">
                     <p>12 (0.06)</p>
                  </c>
                  <c ca="center">
                     <p>4 (0.02)</p>
                  </c>
                  <c ca="center">
                     <p>40 (0.21)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>P-values</p>
                  </c>
                  <c ca="left">
                     <p>Allelic</p>
                  </c>
                  <c ca="center">
                     <p>0.76</p>
                  </c>
                  <c ca="center">
                     <p>0.54</p>
                  </c>
                  <c ca="center">
                     <p>0.55</p>
                  </c>
                  <c ca="center">
                     <p>0.37</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
                  <c ca="center">
                     <p>0.95</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Genotypic</p>
                  </c>
                  <c ca="center">
                     <p>0.25 [0.43]</p>
                  </c>
                  <c ca="center">
                     <p>0.75 [0.73]</p>
                  </c>
                  <c ca="center">
                     <p>0.80 [0.20]</p>
                  </c>
                  <c ca="center">
                     <p>0.60 [0.77]</p>
                  </c>
                  <c ca="center">
                     <p>0.14 [0.54]</p>
                  </c>
                  <c ca="center">
                     <p>0.87 [0.78]</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>UK sCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>69 (0.72)</p>
                  </c>
                  <c ca="center">
                     <p>65 (0.68)</p>
                  </c>
                  <c ca="center">
                     <p>82 (0.85)</p>
                  </c>
                  <c ca="center">
                     <p>71 (0.74)</p>
                  </c>
                  <c ca="center">
                     <p>69 (0.72)</p>
                  </c>
                  <c ca="center">
                     <p>59 (0.61)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>25 (0.52)</p>
                  </c>
                  <c ca="center">
                     <p>22 (0.46)</p>
                  </c>
                  <c ca="center">
                     <p>36 (0.75)</p>
                  </c>
                  <c ca="center">
                     <p>28 (0.58)</p>
                  </c>
                  <c ca="center">
                     <p>25 (0.52)</p>
                  </c>
                  <c ca="center">
                     <p>20 (0.42)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.40)</p>
                  </c>
                  <c ca="center">
                     <p>21 0.44)</p>
                  </c>
                  <c ca="center">
                     <p>10 (0.21)</p>
                  </c>
                  <c ca="center">
                     <p>15 (0.31)</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.40)</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.39)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>4 (0.08)</p>
                  </c>
                  <c ca="center">
                     <p>5 (0.10)</p>
                  </c>
                  <c ca="center">
                     <p>2 (0.04)</p>
                  </c>
                  <c ca="center">
                     <p>5 (0.11)</p>
                  </c>
                  <c ca="center">
                     <p>4 (0.08)</p>
                  </c>
                  <c ca="center">
                     <p>9 (0.19)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>P-values</p>
                  </c>
                  <c ca="left">
                     <p>Allelic</p>
                  </c>
                  <c ca="center">
                     <p>0.37</p>
                  </c>
                  <c ca="center">
                     <p>0.36</p>
                  </c>
                  <c ca="center">
                     <p>0.47</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
                  <c ca="center">
                     <p>0.3</p>
                  </c>
                  <c ca="center">
                     <p>0.19</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Genotypic</p>
                  </c>
                  <c ca="center">
                     <p>0.65 [0.42]</p>
                  </c>
                  <c ca="center">
                     <p>0.63 [0.47]</p>
                  </c>
                  <c ca="center">
                     <p>0.44 [0.17]</p>
                  </c>
                  <c ca="center">
                     <p>0.31 [0.62]</p>
                  </c>
                  <c ca="center">
                     <p>0.54 [0.31]</p>
                  </c>
                  <c ca="center">
                     <p>0.25 [0.15]</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>Overall sCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>482 (0.76)</p>
                  </c>
                  <c ca="center">
                     <p>408 (0.64)</p>
                  </c>
                  <c ca="center">
                     <p>535 (0.84)</p>
                  </c>
                  <c ca="center">
                     <p>496 (0.78)</p>
                  </c>
                  <c ca="center">
                     <p>484 (0.78)</p>
                  </c>
                  <c ca="center">
                     <p>352 (0.56)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>183 (0.58)</p>
                  </c>
                  <c ca="center">
                     <p>135 (0.43)</p>
                  </c>
                  <c ca="center">
                     <p>225 (0.71)</p>
                  </c>
                  <c ca="center">
                     <p>200 (0.63)</p>
                  </c>
                  <c ca="center">
                     <p>188 (0.60)</p>
                  </c>
                  <c ca="center">
                     <p>101 (0.32)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>116 (0.36)</p>
                  </c>
                  <c ca="center">
                     <p>138 (0.43)</p>
                  </c>
                  <c ca="center">
                     <p>85 (0.27)</p>
                  </c>
                  <c ca="center">
                     <p>96 (0.30)</p>
                  </c>
                  <c ca="center">
                     <p>108 (0.35)</p>
                  </c>
                  <c ca="center">
                     <p>150 (0.47)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.06)</p>
                  </c>
                  <c ca="center">
                     <p>45 (0.14)</p>
                  </c>
                  <c ca="center">
                     <p>8 (0.02)</p>
                  </c>
                  <c ca="center">
                     <p>21 (0.07)</p>
                  </c>
                  <c ca="center">
                     <p>16 (0.05)</p>
                  </c>
                  <c ca="center">
                     <p>66 (0.21)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>P-values</p>
                  </c>
                  <c ca="left">
                     <p>Allelic</p>
                  </c>
                  <c ca="center">
                     <p>0.84</p>
                  </c>
                  <c ca="center">
                     <p>0.6</p>
                  </c>
                  <c ca="center">
                     <p>0.29</p>
                  </c>
                  <c ca="center">
                     <p>0.2</p>
                  </c>
                  <c ca="center">
                     <p>0.89</p>
                  </c>
                  <c ca="center">
                     <p>0.61</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Genotypic</p>
                  </c>
                  <c ca="center">
                     <p>0.92 [0.73]</p>
                  </c>
                  <c ca="center">
                     <p>0.85 [0.66]</p>
                  </c>
                  <c ca="center">
                     <p>0.57 [0.36]</p>
                  </c>
                  <c ca="center">
                     <p>0.46 [0.58]</p>
                  </c>
                  <c ca="center">
                     <p>0.90 [0.87]</p>
                  </c>
                  <c ca="center">
                     <p>0.84 [0.77]</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>
                        <b>UK vCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Major allele count (frequences)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>67 (0.66)</p>
                  </c>
                  <c ca="center">
                     <p>64 (0.63)</p>
                  </c>
                  <c ca="center">
                     <p>90 (0.87)</p>
                  </c>
                  <c ca="center">
                     <p>80 (0.78)</p>
                  </c>
                  <c ca="center">
                     <p>67 (0.67)</p>
                  </c>
                  <c ca="center">
                     <p>61 (0.60)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>wt</p>
                  </c>
                  <c ca="center">
                     <p>21 (0.41)</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.37)</p>
                  </c>
                  <c ca="center">
                     <p>39 (0.75)</p>
                  </c>
                  <c ca="center">
                     <p>31 (0.61)</p>
                  </c>
                  <c ca="center">
                     <p>23 (0.46)</p>
                  </c>
                  <c ca="center">
                     <p>19 (0.37)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Genotype distribution (frequences)</p>
                  </c>
                  <c ca="left">
                     <p>wt-v</p>
                  </c>
                  <c ca="center">
                     <p>25 (0.49)</p>
                  </c>
                  <c ca="center">
                     <p>26 (0.51)</p>
                  </c>
                  <c ca="center">
                     <p>12 (0.23)</p>
                  </c>
                  <c ca="center">
                     <p>18 (0.35)</p>
                  </c>
                  <c ca="center">
                     <p>21 (0.42)</p>
                  </c>
                  <c ca="center">
                     <p>23 (0.45)</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>v-v</p>
                  </c>
                  <c ca="center">
                     <p>5 (0.10)</p>
                  </c>
                  <c ca="center">
                     <p>6 (0.12)</p>
                  </c>
                  <c ca="center">
                     <p>1 (0.02)</p>
                  </c>
                  <c ca="center">
                     <p>2 (0.04)</p>
                  </c>
                  <c ca="center">
                     <p>6 (0.12)</p>
                  </c>
                  <c ca="center">
                     <p>9 (0.18)</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>P-values</p>
                  </c>
                  <c ca="left">
                     <p>Allelic</p>
                  </c>
                  <c ca="center">
                     <p>0.36</p>
                  </c>
                  <c ca="center">
                     <p>0.55</p>
                  </c>
                  <c ca="center">
                     <p>0.84</p>
                  </c>
                  <c ca="center">
                     <p>0.51</p>
                  </c>
                  <c ca="center">
                     <p>0.54</p>
                  </c>
                  <c ca="center">
                     <p>0.88</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Genotypic</p>
                  </c>
                  <c ca="center">
                     <p>0.28 [0.26]</p>
                  </c>
                  <c ca="center">
                     <p>0.39 [0.79]</p>
                  </c>
                  <c ca="center">
                     <p>0.99 [0.96]</p>
                  </c>
                  <c ca="center">
                     <p>0.80 [0.60]</p>
                  </c>
                  <c ca="center">
                     <p>0.55 [0.27]</p>
                  </c>
                  <c ca="center">
                     <p>0.65 [0.99]</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>P-values are not corrected for multiple testing</p>
               <p>In brackets p-values adjusted by PRNP M129V genotype, age at onset and gender</p>
               <p>wt: wild type</p>
               <p>v: variant</p>
               <p>sCJD: sporadic Creutzfeldt Jakob disease</p>
               <p>vCJD:variant Creutzfeldt Jakob disease</p>
            </tblfn>
         </tbl>
         <p>The htSNPs genotyped allowed us to define the two major clades, H1 and H2, which have been described in Caucasians in several previous studies <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. In order to facilitate comparisons we have adopted the same terminology for H1 sub-haplotypes as that used by Pittman <it>et al.</it><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. We did not find any evidence of association between any of the <it>MAPT </it>haplotypes and sCJD. We specifically did not find association with the subhaplotype H1c, which has been previously reported to be related to several neurodegenerative diseases. We also compared <it>MAPT </it>haplotypes between sCJD and vCJD from the UK. We found that the frequency of two rare haplotypes, H1f and H1j, were significantly different in sCJD (p = 0.04) and vCJD patients (p = 0.01) (Table <tblr tid="T4">4</tblr>). However, these two variants were present in a small proportion of patients, and after adjusting by the number of test performed (14 pairwise haplotypic comparisons were made) the results were not statistically significant (p = 0.56 for H1f) and (p = 0.14 for H1j). When we compared the frequency of these haplotypes in vCJD versus the Dutch control population, only the difference in H1j (3% in controls versus 7% in vCJD) was of borderline significance (p = 0.06).</p>
         <tbl id="T4">
            <title>
               <p>Table 4</p>
            </title>
            <caption>
               <p>Haplotype analysis of the association between <it>MAPT </it>and Creutzfeldt-Jakob disease</p>
            </caption>
            <tblbdy cols="13">
               <r>
                  <c ca="center">
                     <p>
                        <b>Haplotype</b>
                     </p>
                  </c>
                  <c cspan="6" ca="center">
                     <p>
                        <b>Alleles</b>
                     </p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>
                        <b>Frequency</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b><it>P</it>-value</b>
                     </p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>
                        <b>Frequency</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b><it>P</it>-value</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c cspan="6">
                     <hr/>
                  </c>
                  <c cspan="2">
                     <hr/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="2">
                     <hr/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>
                        <b>rs242559</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>rs242557</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>rs3785883</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>rs2471738</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>H1/H2</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>rs7521</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Controls</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>sCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>
                        <b>UK sCJD</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>UK vCJD</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="13">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1e</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>0.25</p>
                  </c>
                  <c ca="center">
                     <p>0.26</p>
                  </c>
                  <c ca="center">
                     <p>ref</p>
                  </c>
                  <c ca="center">
                     <p>0.24</p>
                  </c>
                  <c ca="center">
                     <p>0.2</p>
                  </c>
                  <c ca="center">
                     <p>0.51</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H2a</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.23</p>
                  </c>
                  <c ca="center">
                     <p>0.22</p>
                  </c>
                  <c ca="center">
                     <p>0.64</p>
                  </c>
                  <c ca="center">
                     <p>0.28</p>
                  </c>
                  <c ca="center">
                     <p>0.31</p>
                  </c>
                  <c ca="center">
                     <p>ref</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1c</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>T</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.12</p>
                  </c>
                  <c ca="center">
                     <p>0.15</p>
                  </c>
                  <c ca="center">
                     <p>0.46</p>
                  </c>
                  <c ca="center">
                     <p>0.16</p>
                  </c>
                  <c ca="center">
                     <p>0.1</p>
                  </c>
                  <c ca="center">
                     <p>0.4</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1d</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
                  <c ca="center">
                     <p>0.1</p>
                  </c>
                  <c ca="center">
                     <p>0.08</p>
                  </c>
                  <c ca="center">
                     <p>0.07</p>
                  </c>
                  <c ca="center">
                     <p>0.16</p>
                  </c>
                  <c ca="center">
                     <p>0.18</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1f</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.05</p>
                  </c>
                  <c ca="center">
                     <p>0.05</p>
                  </c>
                  <c ca="center">
                     <p>0.88</p>
                  </c>
                  <c ca="center">
                     <p>0.08</p>
                  </c>
                  <c ca="center">
                     <p>0.02</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1g</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.05</p>
                  </c>
                  <c ca="center">
                     <p>0.05</p>
                  </c>
                  <c ca="center">
                     <p>0.91</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1h</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
                  <c ca="center">
                     <p>0.64</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1i</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>0.68</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1j</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>T</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>0.02</p>
                  </c>
                  <c ca="center">
                     <p>0.45</p>
                  </c>
                  <c ca="center">
                     <p>0.01</p>
                  </c>
                  <c ca="center">
                     <p>0.07</p>
                  </c>
                  <c ca="center">
                     <p>0.01</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>H1b</p>
                  </c>
                  <c ca="center">
                     <p>A</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>C</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>G</p>
                  </c>
                  <c ca="center">
                     <p>0.02</p>
                  </c>
                  <c ca="center">
                     <p>0.02</p>
                  </c>
                  <c ca="center">
                     <p>0.55</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
                  <c ca="center">
                     <p>_</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>P-values are not corrected for multiple testing</p>
               <p>Included all haplotypes present in both sCJD and vCJD</p>
               <p>sCJD: sporadic Creutzfeldt Jakob disease</p>
               <p>vCJD:variant Creutzfeldt Jakob disease</p>
            </tblfn>
         </tbl>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Our study assesses the relationship between <it>MAPT </it>haplotypic variations and CJD for the first time. To the best of our knowledge, there has only been one published article studying the role of <it>MAPT </it>in sCJD aetiology <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. S&#225;nchez-Valle et al. found no association between a polymorphism in exon 1 of <it>MAPT </it>in a group of 29 sCJD cases and 29 controls. We examined 6 htSNPs, which are part of an extended <it>MAPT </it>haplotype, in a Dutch population-based sample of sCJD patients and a cognitively normal control group of similar age distribution. Statistical analysis revealed no significant differences between cases and controls, with all p-values higher than 0.05 before correcting for multiple testing. Haplotype analysis still failed to detect any significant difference. We genotyped the same polymorphisms in two other sample groups of sCJD cases from Italy and the UK. All three populations of cases showed similar demographical characteristics. Due to selection bias in the low number of UK sCJD cases tested (n = 48), valine carriers were overrepresented in this subgroup. The frequencies of codon 129 genotypes in UK sCJD cases are similar to those found in other European countries. Our data do not show association between <it>PRNP </it>codon 129 and any of the <it>MAPT </it>SNPs. Therefore our conclusion of no association between <it>MAPT </it>and sCJD is not affected by the differences in <it>PRNP </it>genotypic distribution in the sample sets.</p>
         <p>In our single locus analysis we did not find any significant difference between UK sCJD and vCJD patients. We found some <it>MAPT </it>haplotype frequencies unequally distributed, but none of the differences remained statistically significant after applying a multiple testing correction.</p>
         <p>One possible caveat of our study is the fact that we included a proportion of clinically diagnosed cases (26% vCJD and 36% sCJD). However, it has been shown that "probable" cases fulfilling the clinical diagnostic criteria have a very high positive predictive value (98.5%) <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>.</p>
         <p>Lack of statistical power could be another explanation for our results. We think that this is unlikely. As a proof of principle, the association of sCJD with <it>PRNP </it>M129V genotypes in the overall sample yielded a very low p-value (&lt;10<sup>-11</sup>). The sCJD risk of <it>PRNP </it>129 M homozygotes versus <it>PRNP </it>129 heterozygotes was 3.8 folds higher (95%CI from 2.6 to 5.5). Without multiple testing corrections we estimated that the statistical power of our genotypic analysis would be of 85% to detect an odds ratio as low as 1.6. In order to increase the power of the study, we pooled all sCJD cases. Therefore, although they were all Caucasians, in the second stage of the analysis not all sCJD cases and controls came from the same country. Another caveat of the study is the fact that the comparison between UK sporadic versus variant CJD was not age-matched. However, to the best of our knowledge, there are not <it>MAPT </it>age-related variations and, therefore, this should not be a major issue for our analysis.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Our study shows no evidence for an association between <it>MAPT </it>gene variations and sCJD, and some weak evidence for an association to vCJD.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>PSJ performed the statistical analyses and drafted the manuscript. MB, AG &amp; RK provided patient's samples and some genotypes from the UK, and reviewed critically the manuscript. GC &amp; AP provided patient's samples and some genotypes from Italy, and reviewed critically the manuscript. AA performed most laboratory analyses. CvD reviewed critically the manuscript and contributed to its final version. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors would like to thank all the families of the patients. The CJD surveillance in the Netherlands, Italy and the UK National CJD Surveillance Unit are part of the European Creutzfeldt-Jakob disease Surveillance network (EuroCJD) which is funded by DG SANCO &#8211; 2003201 and NeuroPrion (Network of Excellence) &#8211; FOOD CT 2004 506579. Italy: Thanks to Maurizio Pocchiari and Anna Ladogana for their support to the project. This work was funded by 'Istituto Superiore di Sanita'. United Kingdom: Thanks to Bob Will for his support and advice. The authors would like to thank the staff of the National CJD Surveillance Unit, UK, neurologists and neuropathologists throughout the UK and the families of patients. The Netherlands CJD surveillance is funded by the Dutch Ministry of Health, Welfare and Sports. We acknowledge the help of our colleagues Marie Josee van Rijn, Mark Houben, Mark Sie, and Maaike Schuur at the Erasmus University, Casper Jansen and Annemieke Rozemuller from the Department of Pathology at the University Medical Centre in Utrecht, and Dr. van Gool at the Academic Medical Centre, University of Amsterdam. Pascual S&#225;nchez-Juan was supported by the post-MIR grant Wenceslao Lopez Albo from the IFIMAV Institute of the Fundaci&#243;n P&#250;blica Marqu&#233;s de Valdecilla.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Tau protein and neurodegeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Goedert</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Semin Cell Dev Biol</source>
            <pubdate>2004</pubdate>
            <volume>15</volume>
            <fpage>45</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.semcdb.2003.12.015</pubid>
                  <pubid idtype="pmpid" link="fulltext">15036206</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Interface between tauopathies and synucleinopathies: a tale of two proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Galpern</snm>
                  <fnm>WR</fnm>
               </au>
               <au>
                  <snm>Lang</snm>
                  <fnm>AE</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>2006</pubdate>
            <volume>59</volume>
            <fpage>449</fpage>
            <lpage>58</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.20819</pubid>
                  <pubid idtype="pmpid" link="fulltext">16489609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The role of tau (<it>MAPT</it>) in frontotemporal dementia and related tauopathies</p>
            </title>
            <aug>
               <au>
                  <snm>Rademakers</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cruts</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>van Broeckhoven</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <fpage>277</fpage>
            <lpage>95</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.20086</pubid>
                  <pubid idtype="pmpid" link="fulltext">15365985</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Colocalization of tau and alpha-synuclein epitopes in Lewy bodies</p>
            </title>
            <aug>
               <au>
                  <snm>Ishizawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Mattila</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>J Neuropathol Exp Neurol</source>
            <pubdate>2003</pubdate>
            <volume>62</volume>
            <fpage>389</fpage>
            <lpage>97</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12722831</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Elevated levels of tau-protein in cerebrospinal fluid of patients with Creutzfeldt-Jakob disease</p>
            </title>
            <aug>
               <au>
                  <snm>Otto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wiltfang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tumani</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zerr</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lantsch</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kornhuber</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Weber</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kretzschmar</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Poser</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Neurosci Lett</source>
            <pubdate>1997</pubdate>
            <volume>225</volume>
            <fpage>210</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0304-3940(97)00215-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">9147407</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>CSF tests in the differential diagnosis of Creutzfeldt-Jakob disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sanchez-Juan</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ladogana</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cuadrado-Corrales</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mitrov&#225;</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Stoeck</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sklaviadis</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kulczycki</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hess</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Krasnianski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ecuestre</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Slivarichov&#225;</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Saiz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Calero</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pocchiari</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Knight</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>van Duijn</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Zerr</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Neurology</source>
            <pubdate>2006</pubdate>
            <volume>67</volume>
            <fpage>637</fpage>
            <lpage>43</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1212/01.wnl.0000230159.67128.00</pubid>
                  <pubid idtype="pmpid" link="fulltext">16924018</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Raised CSF phospho-tau concentrations in variant Creutzfeldt-Jakob disease: diagnostic and pathological implications</p>
            </title>
            <aug>
               <au>
                  <snm>Goodall</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Head</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Everington</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ironside</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Knight</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>J Neurol Neurosurg Psychiatry</source>
            <pubdate>2006</pubdate>
            <volume>77</volume>
            <fpage>89</fpage>
            <lpage>91</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jnnp.2005.065755</pubid>
                  <pubid idtype="pmpid" link="fulltext">16361602</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Hereditary frontotemporal dementia is linked to chromosome 17q21&#8211;q22: a genetic and clinicopathological study of three Dutch families</p>
            </title>
            <aug>
               <au>
                  <snm>Heutink</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Stevens</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rizzu</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bakker</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kros</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Tibben</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Niermeijer</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>van Duijn</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Oostra</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>van Swieten</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>1997</pubdate>
            <volume>41</volume>
            <fpage>150</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.410410205</pubid>
                  <pubid idtype="pmpid">9029063</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Association of missense and 5'-splice-site mutations in <it>tau </it>with the inherited dementia FTDP-17</p>
            </title>
            <aug>
               <au>
                  <snm>Hutton</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lendon</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Rizzu</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Froelich</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Houlden</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pickering-Brown</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chakraverty</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Isaacs</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grover</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hackett</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Adamson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lincoln</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Petersen</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Stevens</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>de Graaff</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wauters</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>van Baren</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hillebrand</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Joosse</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kwon</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Nowotny</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Che</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Norton</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Reed</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Trojanowski</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Basun</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lannfelt</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Neystat</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fahn</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dark</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Tannenberg</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Dodd</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Hayward</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kwok</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Schofield</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Andreadis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Snowden</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Craufurd</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Neary</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Owen</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Oostra</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Goate</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>van Swieten</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mann</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Heutink</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1998</pubdate>
            <volume>393</volume>
            <fpage>702</fpage>
            <lpage>5</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/31508</pubid>
                  <pubid idtype="pmpid" link="fulltext">9641683</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Mutation-specific functional impairments in distinct tau isoforms of hereditary FTDP-17</p>
            </title>
            <aug>
               <au>
                  <snm>Hong</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zhukareva</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Vogelsberg-Ragaglia</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Wszolek</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Reed</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>BI</fnm>
               </au>
               <au>
                  <snm>Geschwind</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Bird</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>McKeel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Goate</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Wilhelmsen</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Schellenberg</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Trojanowski</snm>
                  <fnm>JQ</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>VM</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1998</pubdate>
            <volume>282</volume>
            <fpage>1914</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.282.5395.1914</pubid>
                  <pubid idtype="pmpid" link="fulltext">9836646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Tau gene mutation G389R causes a tauopathy with abundant pick body-like inclusions and axonal deposits</p>
            </title>
            <aug>
               <au>
                  <snm>Murrell</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Spillantini</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Zolo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Guazzelli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Redi</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Crowther</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Pietrini</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ghetti</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Goedert</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Neuropathol Exp Neurol</source>
            <pubdate>1999</pubdate>
            <volume>58</volume>
            <fpage>1207</fpage>
            <lpage>26</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10604746</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Pick's disease is associated with mutations in the tau gene</p>
            </title>
            <aug>
               <au>
                  <snm>Pickering-Brown</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yen</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cairns</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lantos</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Rossor</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwatsubo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Allsop</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Furlong</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Owen</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mann</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hutton</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>2000</pubdate>
            <volume>48</volume>
            <fpage>859</fpage>
            <lpage>67</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/1531-8249(200012)48:6&lt;859::AID-ANA6>3.0.CO;2-1</pubid>
                  <pubid idtype="pmpid">11117542</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Pathogenic implications of mutations in the tau gene in pallido-ponto-nigral degeneration and related neurodegenerative disorders linked to chromosome 17</p>
            </title>
            <aug>
               <au>
                  <snm>Clark</snm>
                  <fnm>LN</fnm>
               </au>
               <au>
                  <snm>Poorkaj</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wszolek</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Geschwind</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Nasreddine</snm>
                  <fnm>ZS</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Payami</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Awert</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Markopoulou</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Andreadis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>D'Souza</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Reed</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Trojanowski</snm>
                  <fnm>JQ</fnm>
               </au>
               <au>
                  <snm>Zhukareva</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bird</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Schellenberg</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wilhelmsen</snm>
                  <fnm>KC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>13103</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">23724</pubid>
                  <pubid idtype="pmpid" link="fulltext">9789048</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.22.13103</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Association of an extended haplotype in the tau gene with progressive supranuclear palsy</p>
            </title>
            <aug>
               <au>
                  <snm>Baker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Litvan</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Houlden</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Adamson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Perez-Tur</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lynch</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bigio</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hutton</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1999</pubdate>
            <volume>8</volume>
            <fpage>711</fpage>
            <lpage>5</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/8.4.711</pubid>
                  <pubid idtype="pmpid" link="fulltext">10072441</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Genetic evidence for the involvement of tau in progressive supranuclear palsy</p>
            </title>
            <aug>
               <au>
                  <snm>Conrad</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Andreadis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Trojanowski</snm>
                  <fnm>JQ</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Kang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Wiederholt</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Hansen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Masliah</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Thal</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Katzman</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Xia</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Saitoh</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>1997</pubdate>
            <volume>41</volume>
            <fpage>277</fpage>
            <lpage>81</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.410410222</pubid>
                  <pubid idtype="pmpid">9029080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>An extended 5'-tau susceptibility haplotype in progressive supranuclear palsy</p>
            </title>
            <aug>
               <au>
                  <snm>Higgins</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Golbe</snm>
                  <fnm>LI</fnm>
               </au>
               <au>
                  <snm>De Biase</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jankovic</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Factor</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Adler</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Neurology</source>
            <pubdate>2000</pubdate>
            <volume>55</volume>
            <fpage>1364</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11087782</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Corticobasal degeneration and progressive supranuclear palsy share a common tau haplotype</p>
            </title>
            <aug>
               <au>
                  <snm>Houlden</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>MacDonald</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Pickering-Brown</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Adamson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lees</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Rossor</snm>
                  <fnm>MN</fnm>
               </au>
               <au>
                  <snm>Quinn</snm>
                  <fnm>NP</fnm>
               </au>
               <au>
                  <snm>Kertesz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Khan</snm>
                  <fnm>MN</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lantos</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>St George-Hyslop</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Munoz</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Mann</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lang</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Bergeron</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bigio</snm>
                  <fnm>EH</fnm>
               </au>
               <au>
                  <snm>Litvan</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bhatia</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>NW</fnm>
               </au>
               <au>
                  <snm>Hutton</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Neurology</source>
            <pubdate>2001</pubdate>
            <volume>56</volume>
            <fpage>1702</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11425937</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Association between the extended tau haplotype and frontotemporal dementia</p>
            </title>
            <aug>
               <au>
                  <snm>Verpillat</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Camuzat</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hannequin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Thomas-Anterion</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Puel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Belliard</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dubois</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Didic</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Michel</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>Lacomblez</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Moreaud</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Sellal</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Golfier</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Campion</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Clerget-Darpoux</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Brice</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Arch Neurol</source>
            <pubdate>2002</pubdate>
            <volume>59</volume>
            <fpage>935</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/archneur.59.6.935</pubid>
                  <pubid idtype="pmpid" link="fulltext">12056929</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease</p>
            </title>
            <aug>
               <au>
                  <snm>Martin</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Nance</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Watts</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Hubble</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Koller</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Lyons</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pahwa</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Stern</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Colcher</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hiner</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Jankovic</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ondo</snm>
                  <fnm>WG</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>FH</fnm>
               </au>
               <au>
                  <snm>Goetz</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Small</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Masterman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mastaglia</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Laing</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Stajich</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Ribble</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Booze</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Rogala</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hauser</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Middleton</snm>
                  <fnm>LT</fnm>
               </au>
               <au>
                  <snm>Roses</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Haines</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Pericak-Vance</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Vance</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>JAMA</source>
            <pubdate>2001</pubdate>
            <volume>286</volume>
            <fpage>2245</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/jama.286.18.2245</pubid>
                  <pubid idtype="pmpid" link="fulltext">11710889</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The H1c haplotype at the <it>MAPT </it>locus is associated with Alzheimer's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Myers</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Kaleem</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marlowe</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pittman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Lees</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Duckworth</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leung</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>de Silva</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>2399</fpage>
            <lpage>404</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi241</pubid>
                  <pubid idtype="pmpid" link="fulltext">16000317</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>HapMap project</p>
            </title>
            <url>http://www.hapmap.org</url>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Linkage disequilibrium fine mapping and haplotype association analysis of the tau gene in progressive supranuclear palsy and corticobasal degeneration</p>
            </title>
            <aug>
               <au>
                  <snm>Pittman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Abou-Sleiman</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Kaleem</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Marlowe</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Duckworth</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leung</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kilford</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>NW</fnm>
               </au>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lees</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>de Silva</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Med Genet</source>
            <pubdate>2005</pubdate>
            <volume>42</volume>
            <fpage>837</fpage>
            <lpage>46</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/jmg.2005.031377</pubid>
                  <pubid idtype="pmpid" link="fulltext">15792962</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>EuroCJD</p>
            </title>
            <url>http://www.eurocjd.ed.ac.uk</url>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Human transmissible spongiform encephalopathies</p>
            </title>
            <aug>
               <au>
                  <cnm>WHO</cnm>
               </au>
            </aug>
            <source>Weekly Epidemiological record</source>
            <pubdate>1998</pubdate>
            <volume>47</volume>
            <fpage>361</fpage>
            <lpage>365</lpage>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Diagnostic value of periodic complexes in Creutzfeldt-Jakob disease</p>
            </title>
            <aug>
               <au>
                  <snm>Steinhoff</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Zerr</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Glatting</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schulz-Schaeffer</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Poser</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kretzschmar</snm>
                  <fnm>HA</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>2004</pubdate>
            <volume>56</volume>
            <fpage>702</fpage>
            <lpage>708</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.20261</pubid>
                  <pubid idtype="pmpid" link="fulltext">15449324</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The role of MRI in the diagnosis of sporadic and variant Creutzfeldt-Jakob disease</p>
            </title>
            <aug>
               <au>
                  <snm>Collie</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Jbr-Btr</source>
            <pubdate>2001</pubdate>
            <volume>84</volume>
            <fpage>143</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11688725</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Detection of 14-3-3 protein in the cerebrospinal fluid supports the diagnosis of Creutzfeldt-Jakob disease</p>
            </title>
            <aug>
               <au>
                  <snm>Zerr</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bodemer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gefeller</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Otto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Poser</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wiltfang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Windl</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Kretzschmar</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Weber</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>1998</pubdate>
            <volume>43</volume>
            <fpage>32</fpage>
            <lpage>40</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.410430109</pubid>
                  <pubid idtype="pmpid">9450766</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Determinants of disease and disability in the elderly: the Rotterdam Elderly Study</p>
            </title>
            <aug>
               <au>
                  <snm>Hofman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grobbee</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>de Jong</snm>
                  <fnm>PT</fnm>
               </au>
               <au>
                  <snm>van den Ouweland</snm>
                  <fnm>FA</fnm>
               </au>
            </aug>
            <source>Eur J Epidemiol</source>
            <pubdate>1991</pubdate>
            <volume>7</volume>
            <fpage>403</fpage>
            <lpage>22</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00145007</pubid>
                  <pubid idtype="pmpid">1833235</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>High-density SNP haplotyping suggests altered regulation of tau gene expression in progressive supranuclear palsy</p>
            </title>
            <aug>
               <au>
                  <snm>Rademakers</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Melquist</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cruts</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Theuns</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Del-Favero</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Poorkaj</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sleegers</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Crook</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>De Pooter</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bel Kacem</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Adamson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Van den Bossche</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Van den Broeck</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gass</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Corsmit</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>De Rijk</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Engelborghs</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Heckman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Litvan</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Crook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Deyn</snm>
                  <fnm>PP</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schellenberg</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Van Broeckhoven</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hutton</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>3281</fpage>
            <lpage>92</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi361</pubid>
                  <pubid idtype="pmpid" link="fulltext">16195395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>SNPStats</p>
            </title>
            <url>http://bioinfo.iconcologia.net/SNPstats</url>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Hplus</p>
            </title>
            <url>http://qge.fhcrc.org/hplus/</url>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Untangling the <it>tau </it>gene association with neurodegenerative disorders</p>
            </title>
            <aug>
               <au>
                  <snm>Pittman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Fung</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>de Silva</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2006</pubdate>
            <volume>15</volume>
            <issue>Spec No 2</issue>
            <fpage>R188</fpage>
            <lpage>95</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddl190</pubid>
                  <pubid idtype="pmpid" link="fulltext">16987883</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Analysis of the exon 1 polymorphism in the Tau gene in transmisible spongiform encephalopathies</p>
            </title>
            <aug>
               <au>
                  <snm>S&#225;nchez-Valle</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pastor</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Yag&#252;e</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ribalta</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Graus</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Tolosa</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Saiz</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Neurol</source>
            <pubdate>2001</pubdate>
            <volume>249</volume>
            <fpage>938</fpage>
            <lpage>939</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s00415-002-0717-1</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Diagnosis of Creutzfeldt-Jakob disease Effect of clinical criteria on incidence estimates</p>
            </title>
            <aug>
               <au>
                  <snm>Brandel</snm>
                  <fnm>J-P</fnm>
               </au>
               <au>
                  <snm>Delasnerie-Laupr&#234;tre</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Laplanche</snm>
                  <fnm>J-L</fnm>
               </au>
               <au>
                  <snm>Hauw</snm>
                  <fnm>J-J</fnm>
               </au>
               <au>
                  <snm>Alp&#233;rovitch</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Neurology</source>
            <pubdate>2000</pubdate>
            <volume>54</volume>
            <fpage>1095</fpage>
            <lpage>1099</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10720280</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2350/8/77/prepub</url>
         </p>
      </sec>
   </bm>
</art>
