<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1471-2350-8-40</ui>
	<ji>1471-2350</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>Multiplex SNaPshot for detection of <it>BRCA1/2 </it>common mutations in Spanish and Spanish related breast/ovarian cancer families</p>
			</title>
			<aug>
				<au id="A1">
					<snm>Filippini</snm>
					<fnm>Sandra</fnm>
					<insr iid="I1"/>
					<email>sandraefilip@yahoo.com.ar</email>
				</au>
				<au id="A2">
					<snm>Blanco</snm>
					<fnm>Ana</fnm>
					<insr iid="I2"/>
					<email>anablancop@hotmail.com</email>
				</au>
				<au id="A3">
					<snm>Fern&#225;ndez-Marmiesse</snm>
					<fnm>Ana</fnm>
					<insr iid="I2"/>
					<email>ana.fernandez.marmiesse@sergas.es</email>
				</au>
				<au id="A4">
					<snm>&#193;lvarez-Iglesias</snm>
					<fnm>Vanesa</fnm>
					<insr iid="I1"/>
					<email>vaneiml@usc.es</email>
				</au>
				<au id="A5">
					<snm>Ru&#237;z-Ponte</snm>
					<fnm>Clara</fnm>
					<insr iid="I2"/>
					<email>crponte@usc.es</email>
				</au>
				<au id="A6">
					<snm>Carracedo</snm>
					<fnm>&#193;ngel</fnm>
					<insr iid="I1"/>
					<insr iid="I2"/>
					<email>apimlang@usc.es</email>
				</au>
				<au id="A7" ca="yes">
					<snm>Vega</snm>
					<fnm>Ana</fnm>
					<insr iid="I2"/>
					<email>apimlapv@usc.es</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Unidade de Xen&#233;tica, Instituto de Medicina Legal &amp; Grupo de Medicina Xen&#243;mica, Facultad de Medicina, Santiago de Compostela, Galicia, Spain</p>
				</ins>
				<ins id="I2">
					<p>Unidad de Medicina Molecular, Fundaci&#243;n P&#250;blica Galega de Medicina Xen&#243;mica_SERGAS, Hospital Cl&#237;nico de Santiago de Compostela, Galicia, Spain</p>
				</ins>
			</insg>
			<source>BMC Medical Genetics</source>
			<issn>1471-2350</issn>
			<pubdate>2007</pubdate>
			<volume>8</volume>
			<issue>1</issue>
			<fpage>40</fpage>
			<url>http://www.biomedcentral.com/1471-2350/8/40</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">17603881</pubid><pubid idtype="doi">10.1186/1471-2350-8-40</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>01</day>
					<month>3</month>
					<year>2007</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>29</day>
					<month>6</month>
					<year>2007</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>29</day>
					<month>6</month>
					<year>2007</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2007</year>
			<collab>Filippini et al; licensee BioMed Central Ltd.</collab>
			<note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st>
					<p>It is estimated that 5&#8211;10% of all breast cancer are hereditary and attributable to mutations in the highly penetrance susceptibility genes <it>BRCA1 </it>and <it>BRCA2</it>. The genetic analysis of these genes is complex and expensive essentially because their length. Nevertheless, the presence of recurrent and founder mutations allows a pre-screening for the identification of the most frequent mutations found in each geographical region. In Spain, five mutations in <it>BRCA1 </it>and other five in <it>BRCA2 </it>account for approximately 50% of the mutations detected in Spanish families.</p>
				</sec>
				<sec>
					<st>
						<p>Methods</p>
					</st>
					<p>We have developed a novel PCR multiplex SNaPshot reaction that targets all ten recurrent and founder mutations identified in <it>BRCA1 </it>and <it>BRCA2 </it>in Spain to date.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>The SNaPshot reaction was performed on samples previously analyzed by direct sequencing and all mutations were concordant. This strategy permits the analysis of approximately 50% of all mutations observed to be responsible for breast/ovarian cancer in Spanish families using a single reaction per patient sample.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusion</p>
					</st>
					<p>The SNaPshot assay developed is sensitive, rapid, with minimum cost per sample and additionally can be automated for high-throughput genotyping. The SNaPshot assay outlined here is not only useful for analysis of Spanish breast/ovarian cancer families, but also e.g. for populations with Spanish ancestry, such as those in Latin America.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>Germline mutations in <it>BRCA1 </it>(OMIM 113705) and <it>BRCA2 </it>(OMIM 600185) account for familial clustering in the majority of families with both breast and ovarian cancer and in approximately one-half of families with site-specific breast cancer <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. <it>BRCA1 </it>and <it>BRCA2 </it>are both large genes containing 5,592 and 11,385 nucleotides spread over ~100,000 bases of genomic DNA each. There are more than 1,000 BRCA mutations reported to the Breast Cancer Information Core (BIC) database <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>; many of them are unique but there are also numerous examples of recurrent and founder mutations. Founder mutations have been reported in genetic isolate populations such as Ashkenazi Jewish <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>, Icelandic <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>, Finnish <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, Dutch <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp> and French Canadian <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>, as well as in Slavic countries, including Poland <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>.</p>
			<p>In Spain, a compilation of BRCA test results from different laboratories shows that five mutations in the <it>BRCA1 </it>gene (c.187-188delAG [p.Q23fs], c.330A &gt; G, [p.64-71del], c.5236G &gt; A [p.G1706A], c.5242C &gt; A [p.A1708E], c.589-590delCT [p.S157X]; numbered GeneBank <ext-link ext-link-type="gen" ext-link-id="U14680">U14680</ext-link>) account for 46.6 % of <it>BRCA1 </it>mutations and four in <it>BRCA2 </it>(c.3036-3039delACAA [p.K936fs], c.6857-6858delAA [p.E2210fs], c.9254-9258del5 [p.Y3009fs], c.9538-3539delAA [p.K3104fs]; numbered GenBank <ext-link ext-link-type="gen" ext-link-id="U43746">U43746</ext-link>) account for 56.6 % of the <it>BRCA2 </it>mutations <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Moreover, an additional founder mutation in the Spanish population, located in <it>BRCA2 </it>has recently been observed: c.5374-5377delTATG [p.Y1716fs] (Comunicated by Infante M, et al. at the XXIII Congreso Nacional de Gen&#233;tica Humana, Valladolid, Spain, 2006).</p>
			<p>Automated sequencing using standardized procedures represents the "gold standard" system of analysis (complemented by an assay that can detect copy number changes as well). However this procedure is time-consuming and expensive. The identification of fully characterized, recurrent mutations could reduce the time and cost of the analysis. Thus, for instance, Revillion et al. <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> developed a multiplex single-nucleotide primer extension analysis to simultaneous detects 36% of French mutations and 32 % of international ones.</p>
			<p>In the present work we describe a rapid, sensitive and low cost assay based on a multiplexed single nucleotide primer extension reaction using SNaPshot dye labeled terminators and capillary electrophoresis to allow rapid detection of approximately 50% of the mutations detected in <it>BRCA1 </it>and <it>BRCA2 </it>in Spanish families.</p>
		</sec>
		<sec>
			<st>
				<p>Methods</p>
			</st>
			<sec>
				<st>
					<p>Samples and Extraction method</p>
				</st>
				<p>The 48 DNA patient samples included in this study were sent to our laboratory for <it>BRCA1 </it>and <it>BRCA2 </it>diagnosis. Written informed consent was obtained from each patient. Twenty-four of the 48 DNA samples carried one of the ten recurring germline mutations in the <it>BRCA1 </it>and <it>BRCA2 </it>genes identified in Spain (<it>BRCA1</it>: c.187-188delAG, c.330A &gt; G, c.5236G &gt; A, c.5242C &gt; A, c.589-590delCT; numbered GeneBank <ext-link ext-link-type="gen" ext-link-id="U14680">U14680</ext-link>; <it>BRCA2: </it>c.3036-3039delACAA, c.5374-5377delTATG, c.6857-6858delAA, c.9254-9258del5, c.9538-3539delAA numbered GeneBank <ext-link ext-link-type="gen" ext-link-id="U43746">U43746</ext-link>). In the remaining 24 samples, no <it>BRCA1/2 </it>mutations were present. DNA was extracted from peripheral blood leucocytes by standard procedures.</p>
			</sec>
			<sec>
				<st>
					<p>SNaPshot multiplex primer design</p>
				</st>
				<p>The primers for PCR amplification and SNaPshot extension reactions (Tables <tblr tid="T1">1</tblr> and <tblr tid="T2">2</tblr>) were both designed to have an annealing temperature around 60&#176;C using Primer3 software <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. To test for possible repetitive sequences, primers were aligned with the NCBI sequence databases using BLAST <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. AutoDimer Software <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> was used to test for potential hairpin structures and primer-dimer problems. Primer synthesis was performed by Sigma-Genosys Ltd. (Pampisford, Cambridgeshire, UK). All minisequencing primers were purified by HPLC to remove incomplete primer synthesis products. Co-amplification in the same amplicon was used to detect c.5236 G &gt; C and c.589-590delCT closely positioned in exon 18 of <it>BRCA1</it>. The PCR product sizes ranged from 151 bp to 250 bp.</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>PCR primer sequences (5'&#8594;3')</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>
									<b>
										<it>Mutation (Predicted effect)</it>
									</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>PCR primers</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Size bp</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>Exon</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.187-188delAG (p.Q23fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F ttcgcgttgaagaagtacaaaa</p>
								<p>R ttccctagtatgtaaggtcaattctg</p>
							</c>
							<c ca="left">
								<p>151</p>
							</c>
							<c ca="left">
								<p>2</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.330 A &gt; G (p.64-71<it>del</it>)</b>
								</p>
							</c>
							<c ca="left">
								<p>F ggctcttaagggcagttgtg</p>
								<p>R cctactgtggttgcttccaa</p>
							</c>
							<c ca="left">
								<p>235</p>
							</c>
							<c ca="left">
								<p>5</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.589-590delCT (p.S157X)</b>
								</p>
							</c>
							<c ca="left">
								<p>F ctcttcaggaggaaaagcaca</p>
								<p>R cctgagacccttacccaattc</p>
							</c>
							<c ca="left">
								<p>186</p>
							</c>
							<c ca="left">
								<p>8</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.5236 G &gt; C (p.G1706A)</b>
								</p>
								<p>
									<b><it>BRCA1 </it>c.5242 C &gt; A (p.A1708E)</b>
								</p>
							</c>
							<c ca="left">
								<p>F ggacagcacttcctgattttg</p>
								<p>R taaagggaggaggggagaaa</p>
							</c>
							<c ca="left">
								<p>174</p>
							</c>
							<c ca="left">
								<p>18</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.3036-3039delACAA (p.K936fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F ttcatgaaacagacttgacttgtg</p>
								<p>R ttcaaggagatgtccgatttt</p>
							</c>
							<c ca="left">
								<p>208</p>
							</c>
							<c ca="left">
								<p>11</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.5374-5377delTATG (p.Y1716fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F tggcttagagaaggaatatttgatg</p>
								<p>R ctggctcaataccagaatcaag</p>
							</c>
							<c ca="left">
								<p>250</p>
							</c>
							<c ca="left">
								<p>11</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.6857-6858delAA (p.E2210fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F tgggaaaagaacaggcttca</p>
								<p>R gaatgtgtggcatgacttgg</p>
							</c>
							<c ca="left">
								<p>217</p>
							</c>
							<c ca="left">
								<p>11</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.9254-9258del5 (p.Y3009fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F tcttccattgcatctttctca</p>
								<p>R ggtttgtaccggtagttgttga</p>
							</c>
							<c ca="left">
								<p>209</p>
							</c>
							<c ca="left">
								<p>23</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.9538-9539delAA (p.K3104fs)</b>
								</p>
							</c>
							<c ca="left">
								<p>F gagtttcctttcttgcatcttaaa</p>
								<p>R gcctgatttggattctggtc</p>
							</c>
							<c ca="left">
								<p>221</p>
							</c>
							<c ca="left">
								<p>25</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>Extension primer sequences</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="left">
								<p>
									<ul>
										<b>
											<it>Mutation</it>
										</b>
									</ul>
								</p>
							</c>
							<c ca="left">
								<p>
									<ul>
										<b>Extension Primer</b>
									</ul>
								</p>
							</c>
							<c ca="left">
								<p>
									<ul>
										<b>Size bp</b>
									</ul>
								</p>
							</c>
							<c ca="left">
								<p>
									<ul>
										<b>
											<it>Change</it>
										</b>
									</ul>
								</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.187-188delAG</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gac</b>tcattaatgctatgcagaaaatcttag</p>
							</c>
							<c ca="left">
								<p>30</p>
							</c>
							<c ca="left">
								<p>
									<b>A/T</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.5236 G &gt; C</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gact</b>tgaacggacactgaaatattttctag</p>
							</c>
							<c ca="left">
								<p>30</p>
							</c>
							<c ca="left">
								<p>
									<b>G/C</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.330 A &gt; G</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gactga</b>tgtcctttatgtaagaatgatataaccaaa</p>
							</c>
							<c ca="left">
								<p>36</p>
							</c>
							<c ca="left">
								<p>
									<b>A/G</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.5374-5377delTATG</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gactgactgact</b>aatactgcagattatgtaggaaattatttg</p>
							</c>
							<c ca="left">
								<p>42</p>
							</c>
							<c ca="left">
								<p>
									<b>T/A</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.589-590delCT</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gactgactgactgactgactgact</b>aaaccagtctcagtgtccaactct</p>
							</c>
							<c ca="left">
								<p>48</p>
							</c>
							<c ca="left">
								<p>
									<b>C/A</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.3036-3039delACAA</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gacgactgactgactgactgactgact</b>ggttttatatggagacacaggtgataa</p>
							</c>
							<c ca="left">
								<p>54</p>
							</c>
							<c ca="left">
								<p>
									<b>A/G</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA1 </it>c.5242C &gt; A</b>
								</p>
							</c>
							<c ca="left">
								<p>R <b>acgactgactgactgactgactgactgactgactgact</b>gctaactacccattttcctccc</p>
							</c>
							<c ca="left">
								<p>60</p>
							</c>
							<c ca="left">
								<p>
									<b>T/G</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.9254-9258del5</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gacgactgactgactgactgactgactgact</b>gttaacagaaggaaagagatacagaattt</p>
							</c>
							<c ca="left">
								<p>60</p>
							</c>
							<c ca="left">
								<p>
									<b>A/C</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.6857-6858delAA</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gacgactgactgactgactgactgactgactgactgact</b>ctgatgttcctgtgaaaacaaatatag</p>
							</c>
							<c ca="left">
								<p>66</p>
							</c>
							<c ca="left">
								<p>
									<b>A/G</b>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b><it>BRCA2 </it>c.9538-9539delAA</b>
								</p>
							</c>
							<c ca="left">
								<p>F <b>gagactgactgactgactgactgactgactgactgactgactgact</b>acgaatgttacaatttactggcaata</p>
							</c>
							<c ca="left">
								<p>72</p>
							</c>
							<c ca="left">
								<p>
									<b>A/G</b>
								</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>* Poly(d<b>GACT</b>) tail</p>
					</tblfn>
				</tbl>
				<p>The extension primer was designed to anneal immediately adjacent to the nucleotide at the mutation site, on either the sense or anti-sense DNA strand, for the detection of <it>BRCA1 </it>c.5242C &gt; A mutation we used anti-sense primer. The primer orientation allowed a multiplexed SNaPshot reaction encompassing all the loci to be detected in the absence of intra- and inter-primer complementarities.</p>
			</sec>
			<sec>
				<st>
					<p>PCR multiplex amplification</p>
				</st>
				<p>The PCR multiplex co-amplified 9 fragments for the 10 <it>BRCA1/BRCA2 </it>mutations, with sizes ranging from 174 to 250 bp with a single amplicon encompassing the two exon 18 mutations: c.5242 G &gt; A, and c.589-590delCT of <it>BRCA1 </it>gene. Amplification was performed using 5 ng of DNA template, 2 &#215; PCR master mix from QIAGEN Multiplex PCR kit (Qiagen Hilden Germany), 10 &#215; amplification primer mix (2 <it>&#956;</it>M each primer with final concentration of 0.2 <it>&#956;</it>M, optimal for most primer-template systems). Cycling was carried out using a 9700 thermocycler (Applied Biosystems, Foster City, CA, USA). Following a 95&#176;C initial activation step for HotStar Taq DNA polymerase of 15 minutes, a total of 35 cycles were made using the following conditions: 94&#176;C denaturation for 30 seconds, primer annealing at 60&#176;C for 90 seconds, followed by 15 minutes of final extension at 72&#176;C and a 4&#176;C holding step. PCR quality and yield were checked using an Agilent 2100 Expert Bioanalyzer DNA 500/DNA 1000 (Agilent Technologies Inc. Santa Clara, CA USA).</p>
			</sec>
			<sec>
				<st>
					<p>Minisequencing SNaPshot reaction</p>
				</st>
				<p>After amplification, PCR products required purification to remove primers and un-incorporated dNTPs. This post-PCR purification was performed as follows: 1 <it>&#956;</it>l of PCR product was incubated with 0.5 <it>&#956;</it>l of ExoSapIT (Amershan Pharmacia Biotech) for 15 min at 37&#176;C followed by 15 min at 80&#176;C for enzyme inactivation. The minisequencing reaction was performed using the SNaPshot&#8482; kit in a 9700 thermocycler with 2 <it>&#956;</it>l of SNaPshot ready reaction mix, 0.2 <it>&#956;</it>M of extension primer for each mutation and 1.5 <it>&#956;</it>l of purified PCR products in a 5 <it>&#956;</it>l total volume. Extension used 25 cycles of denaturation at 96&#176;C for 10 seconds, annealing at 50&#176;C for 5 seconds and extension at 60&#176;C for 30 seconds. Detection of extension products is based on four different fluorochromes to assay each base and controlled extension primer sizes (the length of a primer regulated using different sized non-homologous Poly-dGACT tails at the 5' end). Final extension product sizes ranged between 30 and 72 bp (see Table <tblr tid="T2">2</tblr>). After the minisequencing reaction, a post-extension treatment to remove the 50-phosphoryl group of the ddNTPs helps to prevent unincorporated terminators from comigrating with the extended primers and producing high background signal. For this a 10 <it>&#956;</it>l final volume was treated with 1 <it>&#956;</it>l of SAP (Amersham Biosciences) for 60 min at 37&#176;C, followed by 15 min at 80&#176;C for enzyme inactivation.</p>
			</sec>
			<sec>
				<st>
					<p>Electroforetic SNaPshot conditions</p>
				</st>
				<p>The minisequencing products (1.5 <it>&#956;</it>l) were mixed with 10 <it>&#956;</it>l of HiDi&#8482; formamide and 0.5 <it>&#956;</it>l of GeneScan-120 LIZ size standard (Applied Biosystems) and denatured at 95&#176;C for 5 minutes. The fluorescently labeled fragments were resolved by capillary electrophoresis on an ABI PRISM 3730 &#215; l Genetic Analyzer (Applied Biosystems). Minisequencing products were injected electrokinetically for 10 seconds at 15 kV and electrophorezed for 20 min at 15 kV and 9 mA at 60&#176;C (default module) in a 36 cm length capillary using POP-7&#8482; polymer with the laser set at a constant power of 9.9 mW. The resulting data was analyzed with GeneMapper&#8482; 3.7 Software (Applied Biosystems).</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<p>The SNaPshot reaction was performed on samples previously analyzed by direct sequencing and all mutations were concordant. Mutations are usually present in the heterozygous state yielding two peaks, one with the expected size and color and a "mutant" peak with a different color according to the base incorporated (Fig. <figr fid="F1">1</figr>).</p>
			<fig id="F1">
				<title>
					<p>Figure 1</p>
				</title>
				<caption>
					<p>Electropherograms of Genscan Analysis of the SNaPshot reaction</p>
				</caption>
				<text>
					<p>Electropherograms of Genscan Analysis of the SNaPshot reaction. On the top, a control DNA sample with the position and nucleotide of the wild type allele indicated. Following, electropherograms for the most frequents <it>BRCA1/2 </it>mutations.</p>
				</text>
				<graphic file="1471-2350-8-40-1"/>
			</fig>
			<p>The electrophoretic mobility of the extension products depends not only on their lengths, but also on the neighboring nucleotide sequences and on the fluorescent dye used in the reaction.</p>
			<p>Therefore, as expected, the detected size determined by the automated sequencer and the real size of certain products were slightly different. It can be tentatively said that to ensure correct differentiation of the extended primer, amplicons should differ by at least six nucleotides in length. Some fragments display stronger fluorescent signal than others in the electropherogram (even after colour compensation with the appropriate matrix) due to variation in minisequencing chemistry. Therefore, mutations are detected by the automated sequencer at different peak heights depending on the terminator and dye label. In general, guanine labeled with dR100 produces a higher signal than the other ddNTPs. However, this fact does not unduly affect the readability of the electropherogram [see also <abbrgrp><abbr bid="B17">17</abbr></abbrgrp></p>
			<p>No false positive results were observed in control samples without mutations, demonstrating the reliability of the procedure and repetitive assays proved the reproducibility of the method.</p>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<p>The genetic analysis of <it>BRCA1 </it>and <it>BRCA2 </it>is complex and expensive essentially because their length. Nevertheless, the presence of recurrent and founder mutations allows a pre-screening for the identification of the most frequent mutations found in each geographical region. This is the case of the single <it>BRCA2 </it>mutation found in the Icelandic population (c.999del5), and the 3 founder Ashkenazi Jews mutations that comprise the genetic test targeted to this population. In contrast to isolated populations the number of mutations that need to be included in the pre-screening process in Spanish population is substantially higher: ten recurrent and founder mutations represent approximately 50 % of the identified familial mutations, and are good candidates to be included in the pre-screening [12, and communication of Infante M, et al. at the XXIII Congreso Nacional de Gen&#233;tica Humana, Spain]. Based on this high-frequency-mutation group, we have developed a SNaPshot reaction to analyze all ten mutations in a single assay. This strategy has numerous advantages. Firstly, a single tube reaction is used for each patient that implies the reduction in term of number of steps and handling. Secondly, high-throughput genotyping is possible as the process can be automated, and the assay is carried out in 96 wells plates. In addition, the interpretation of the peak patterns is very simple and the method is sensitive [see other forensic applications in 18 and 19] and low cost. Lastly, the design is highly flexible: (i) more mutations can be added to the multiplex and (ii) SNaPshot can detect point mutations but also indels, as in our design (some point mutations: c.330A &gt; G or c.5236G &gt; A, and some indels: c.187-188delAG or c.3036-3039delACAA).</p>
			<p>The SNaPshot design we propose here represents an advance in the genetic diagnosis of <it>BRCA1 </it>and <it>BRCA2 </it>Spanish families, since permits the identification of the 46.6 % of <it>BRCA1 </it>and more than 56.6 % of the <it>BRCA2 </it>families in few hours. Moreover it is not only useful for Spanish patients, but also for those populations with Spanish ancestry such as those from Latin American countries. Many families from Latin America can trace their European ancestry to the period of Spanish colonization, and, in the last century, to migratory movements from diverse regions of Spain. An example of this is the occurrence of two Spanish mutations c.330A &gt; G in <it>BRCA1 </it>and c.6857-6858delAA in <it>BRCA2 </it>in populations with Spanish ancestry: the former was found in Latin/South American/Caribbean families with Galician ancestors <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>, and the later mutation was described in one Chilean family with Catalan origins <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>.</p>
			<p>The utility of our SNaPshot design in Latin American population also applies to recent admixture populations. Thus, for instance, the study of Torres et al. <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> shows that three mutations account for almost 80% of deleterious mutations identified in a Hispanic American cohort from Colombia. Two of these three mutations are frequent in Spanish population and included in our SNaPshot multiplex design we present here, supporting the utility of our design for the initial screening of Latino American breast cancer families. Five of the nine different mutations observed in Chile <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> are in the Top 20 Mutation Frequency of the BIC database <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. This suggest that a modified SNaPshot considering these Top 20 mutation (some already included in our SNaPshot design) could yield good results for screening in Chile as in other recently admixture populations.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>In summary, here we propose a fast, flexible and cost-effective multiplex assay of the ten most frequent <it>BRCA1 </it>and <it>BRCA2 </it>mutations in Spain, for the initial screening of Spanish and Spanish ancestry population's breast/ovarian cancer families.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>The author(s) declare that they have no competing interests.</p>
		</sec>
		<sec>
			<st>
				<p>Authors' contributions</p>
			</st>
			<p>SF performed the genetic design, carried out the genetic analysis and drafted the manuscript. AB and AFM helped with the genetic analysis of the samples and drafted the manuscript. VAI help in the methodological design. CRP and AC helped to draft and revised the manuscript. AV conceived the study, participated in its design and coordination, and wrote the manuscript. All authors read and approved the final manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>The Spanish grants of the Ministerio de Sanidad y Consumo (PI052275), Xunta de Galicia (PGIDIT06BTF910101PR) and Fundaci&#243;n de Investigaci&#243;n M&#233;dica Mutua Madrile&#241;a given to AV supported this project. AB is a Fellowship from Instituto de Salud Carlos III (Ministerio de Sanidad, Spain). We thank Dr. Antonio Salas for useful comments on the article.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>An evaluation of genetic heterogeneity in 145 breast ovarian cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Narod</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Ford</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Devilee</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Barkardottir</snm>
						<fnm>RB</fnm>
					</au>
					<au>
						<snm>Lynch</snm>
						<fnm>HT</fnm>
					</au>
					<au>
						<snm>Smith</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Ponder</snm>
						<fnm>BAJ</fnm>
					</au>
					<au>
						<snm>Weber</snm>
						<fnm>BL</fnm>
					</au>
					<au>
						<snm>Garber</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Birch</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Cornelis</snm>
						<fnm>RS</fnm>
					</au>
					<au>
						<snm>Kelsell</snm>
						<fnm>DP</fnm>
					</au>
					<au>
						<snm>Spurr</snm>
						<fnm>NK</fnm>
					</au>
					<au>
						<snm>Smyth</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Haites</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Sobol</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Bignon</snm>
						<fnm>Y-J</fnm>
					</au>
					<au>
						<snm>Chang-Claude</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hamann</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Borg</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Piver</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Gallion</snm>
						<fnm>HH</fnm>
					</au>
					<au>
						<snm>Struewing</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Whittemore</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Tonin</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Goldgar</snm>
						<fnm>DE</fnm>
					</au>
					<au>
						<snm>Easton</snm>
						<fnm>DF</fnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>1995</pubdate>
				<volume>56</volume>
				<fpage>254</fpage>
				<lpage>264</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1801289</pubid>
						<pubid idtype="pmpid">7825586</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>Genetic heterogeneity and penetrance analysis of the <it>BRCA1 </it>and <it>BRCA2 </it>genes in breast cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Ford</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Easton</snm>
						<fnm>DF</fnm>
					</au>
					<au>
						<snm>Stratton</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Narod</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Goldgar</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Devilee</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Bishop</snm>
						<fnm>DT</fnm>
					</au>
					<au>
						<snm>Weber</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Lenoir</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Chang-Claude</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Sobol</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Teare</snm>
						<fnm>MD</fnm>
					</au>
					<au>
						<snm>Struewing</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Arason</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Scherneck</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Peto</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Rebbeck</snm>
						<fnm>TR</fnm>
					</au>
					<au>
						<snm>Tonin</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Neuhausen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Barkardottir</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Eyfjord</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Lynch</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Ponder</snm>
						<fnm>BAJ</fnm>
					</au>
					<au>
						<snm>Gayther</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Birch</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Lindblom</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Stoppa-Lyonnet</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Bignon</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Borg</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Hamann</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Haites</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Scott</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Maugard</snm>
						<fnm>CM</fnm>
					</au>
					<au>
						<snm>Vasen</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Seitz</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Cannon-Albright</snm>
						<fnm>LA</fnm>
					</au>
					<au>
						<snm>Schofield</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Zelada-Hedman</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<cnm>the Breast Cancer Linkage Consortium</cnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>1998</pubdate>
				<volume>62</volume>
				<fpage>676</fpage>
				<lpage>689</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1376944</pubid>
						<pubid idtype="pmpid" link="fulltext">9497246</pubid>
						<pubid idtype="doi">10.1086/301749</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Breast Cancer Information Core internet web site</p>
				</title>
				<url>http://www.nhgri.nih.gov/Intramural_research/Lab_transfer/Bic/index.html</url>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Frequency of recurrent <it>BRCA1 </it>and <it>BRCA2 </it>mutations in Ashkenazi Jewish breast cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Tonin</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Weber</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Offit</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Couch</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Rebbeck</snm>
						<fnm>TR</fnm>
					</au>
					<au>
						<snm>Neuhausen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Godwin</snm>
						<fnm>AK</fnm>
					</au>
					<au>
						<snm>Daly</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Wagner-Costalos</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Berman</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Grana</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Fox</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Kane</snm>
						<fnm>MF</fnm>
					</au>
					<au>
						<snm>Kolodner</snm>
						<fnm>RD</fnm>
					</au>
					<au>
						<snm>Krainer</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Haber</snm>
						<fnm>DA</fnm>
					</au>
					<au>
						<snm>Struewing</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Warner</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Rosen</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Lerman</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Peshkin</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Norton</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Serova</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Foulkes</snm>
						<fnm>WD</fnm>
					</au>
					<au>
						<snm>Lynch</snm>
						<fnm>HT</fnm>
					</au>
					<au>
						<snm>Lenoir</snm>
						<fnm>GM</fnm>
					</au>
					<au>
						<snm>Narod</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Garber</snm>
						<fnm>JE</fnm>
					</au>
				</aug>
				<source>Nat Med</source>
				<pubdate>1996</pubdate>
				<volume>2</volume>
				<fpage>1179</fpage>
				<lpage>1183</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/nm1196-1179</pubid>
						<pubid idtype="pmpid">8898735</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>Recurrent <it>BRCA2 </it>6174delT mutations in Ashkenazi Jewish women affected by breast cancer</p>
				</title>
				<aug>
					<au>
						<snm>Neuhausen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Gilewski</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Norton</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Tran</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>McGuire</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Swensen</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hampel</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Borgen</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Brown</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Skolnick</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Shattuck-Eidens</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Jhanwar</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Goldgar</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Offit</snm>
						<fnm>K</fnm>
					</au>
				</aug>
				<source>Nat Genet</source>
				<pubdate>1996</pubdate>
				<volume>13</volume>
				<fpage>126</fpage>
				<lpage>128</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/ng0596-126</pubid>
						<pubid idtype="pmpid" link="fulltext">8673092</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>High prevalence of the 999del5 mutation in Icelandic breast and ovarian cancer patients</p>
				</title>
				<aug>
					<au>
						<snm>Johannesdottir</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Gudmundsson</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bergthorsson</snm>
						<fnm>JT</fnm>
					</au>
					<au>
						<snm>Arason</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Agnarsson</snm>
						<fnm>BA</fnm>
					</au>
					<au>
						<snm>Eiriksdottir</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Johannsson</snm>
						<fnm>OT</fnm>
					</au>
					<au>
						<snm>Borg</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Ingvarsson</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Easton</snm>
						<fnm>DF</fnm>
					</au>
					<au>
						<snm>Egilsson</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Barkardottir</snm>
						<fnm>RB</fnm>
					</au>
				</aug>
				<source>Cancer Res</source>
				<pubdate>1996</pubdate>
				<volume>56</volume>
				<fpage>3663</fpage>
				<lpage>3665</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">8706004</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Evidence of founder mutations in Finnish <it>BRCA1 </it>and <it>BRCA2 </it>families</p>
				</title>
				<aug>
					<au>
						<snm>Huusko</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Paakkonen</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Launonen</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Poyhonen</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Blanco</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Kauppila</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Puistola</snm>
						<fnm>U</fnm>
					</au>
					<au>
						<snm>Kiviniemi</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Kujala</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Leisti</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Winqvist</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>1998</pubdate>
				<volume>62</volume>
				<fpage>1544</fpage>
				<lpage>1548</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1377159</pubid>
						<pubid idtype="pmpid" link="fulltext">9585608</pubid>
						<pubid idtype="doi">10.1086/301880</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>A high proportion of novel mutations in <it>BRCA1 </it>with strong founder effects among Dutch and Belgian hereditary breast and ovarian cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Peelen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>van Vliet</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Petrij-Bosch</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Mieremet</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Szabo</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>van den Ouweland</snm>
						<fnm>AMW</fnm>
					</au>
					<au>
						<snm>Hogervorst</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Brohet</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Ligtenberg</snm>
						<fnm>MJL</fnm>
					</au>
					<au>
						<snm>Teugels</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>van der Luijt</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>van der Hout</snm>
						<fnm>AH</fnm>
					</au>
					<au>
						<snm>Gille</snm>
						<fnm>JJP</fnm>
					</au>
					<au>
						<snm>Pals</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Jedema</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Olmer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>van Leeuwen</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Newman</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Plandsoen</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>van der Est</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Brink</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Hageman</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Arts</snm>
						<fnm>PJW</fnm>
					</au>
					<au>
						<snm>Bakker</snm>
						<fnm>MM</fnm>
					</au>
					<au>
						<snm>Willems</snm>
						<fnm>HW</fnm>
					</au>
					<au>
						<snm>van der Looij</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Neyns</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Bonduelle</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Jansen</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Oosterwijk</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Sijmons</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Smeets</snm>
						<fnm>HJM</fnm>
					</au>
					<au>
						<snm>van Asperen</snm>
						<fnm>CJ</fnm>
					</au>
					<au>
						<snm>Meijers-Heijboer</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Klijn</snm>
						<fnm>JGM</fnm>
					</au>
					<au>
						<snm>de Greve</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>King</snm>
						<fnm>M-C</fnm>
					</au>
					<au>
						<snm>Menko</snm>
						<fnm>FH</fnm>
					</au>
					<au>
						<snm>Brunner</snm>
						<fnm>HG</fnm>
					</au>
					<au>
						<snm>Halley</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>van Ommen</snm>
						<fnm>G-JB</fnm>
					</au>
					<au>
						<snm>Vasen</snm>
						<fnm>HFA</fnm>
					</au>
					<au>
						<snm>Cornelisse</snm>
						<fnm>CJ</fnm>
					</au>
					<au>
						<snm>van 'tVeer</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>de Knijff</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Bakker</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Devilee</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>1997</pubdate>
				<volume>60</volume>
				<fpage>1041</fpage>
				<lpage>1049</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1712432</pubid>
						<pubid idtype="pmpid">9150151</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p><it>BRCA1 </it>genomic deletions are major founder mutations in Dutch breast cancer patients</p>
				</title>
				<aug>
					<au>
						<snm>Petrij-Bosch</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Peelen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>van Vliet</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>van Eijk</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Olmer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Drusedau</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Hogervorst</snm>
						<fnm>FB</fnm>
					</au>
					<au>
						<snm>Hageman</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Arts</snm>
						<fnm>PJ</fnm>
					</au>
					<au>
						<snm>Ligtenberg</snm>
						<fnm>MJ</fnm>
					</au>
					<au>
						<snm>Meijers-Heijboer</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Klijn</snm>
						<fnm>JG</fnm>
					</au>
					<au>
						<snm>Vasen</snm>
						<fnm>HF</fnm>
					</au>
					<au>
						<snm>Cornelisse</snm>
						<fnm>CJ</fnm>
					</au>
					<au>
						<snm>van't Veer</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Bakker</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>van Ommen</snm>
						<fnm>GJ</fnm>
					</au>
					<au>
						<snm>Devilee</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Nat Genet</source>
				<pubdate>1997</pubdate>
				<volume>17</volume>
				<fpage>341</fpage>
				<lpage>345</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/ng1197-341</pubid>
						<pubid idtype="pmpid" link="fulltext">9354803</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<title>
					<p>Founder <it>BRCA1 </it>and <it>BRCA2 </it>mutations in French Canadian breast and ovarian cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Tonin</snm>
						<fnm>PN</fnm>
					</au>
					<au>
						<snm>Mes-Masson</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Futreal</snm>
						<fnm>PA</fnm>
					</au>
					<au>
						<snm>Morgan</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Mahon</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Foulkes</snm>
						<fnm>WD</fnm>
					</au>
					<au>
						<snm>Cole</snm>
						<fnm>DE</fnm>
					</au>
					<au>
						<snm>Provencher</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Ghadirian</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Narod</snm>
						<fnm>SA</fnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>1998</pubdate>
				<volume>63</volume>
				<fpage>1341</fpage>
				<lpage>1351</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1377544</pubid>
						<pubid idtype="pmpid" link="fulltext">9792861</pubid>
						<pubid idtype="doi">10.1086/302099</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Founder mutations in the <it>BRCA1 </it>gene in Polish families with breast-ovarian cancer</p>
				</title>
				<aug>
					<au>
						<snm>Gorski</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Byrski</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Huzarski</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Jakubowska</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Menkiszak</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Gronwald</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Pluzanska</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Bebenek</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Fischer-Maliszewska</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Grzybowska</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Narod</snm>
						<fnm>SA</fnm>
					</au>
					<au>
						<snm>Lubinski</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>Am J Hum Genet</source>
				<pubdate>2000</pubdate>
				<volume>66</volume>
				<fpage>1963</fpage>
				<lpage>1968</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">1378051</pubid>
						<pubid idtype="pmpid" link="fulltext">10788334</pubid>
						<pubid idtype="doi">10.1086/302922</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Analysis of <it>BRCA1 </it>and <it>BRCA2 </it>genes in Spanish breast/ovarian cancer patients: a high proportion of mutations unique to Spain and evidence of founder effects</p>
				</title>
				<aug>
					<au>
						<snm>D&#237;ez</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Osorio</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Duran</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Mart&#237;nez-Ferrandis</snm>
						<fnm>JI</fnm>
					</au>
					<au>
						<snm>de la Hoya</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Salazar</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Vega</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Campos</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Rodr&#237;guez-L&#243;pez</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Velasco</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Chaves</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>D&#237;az-Rubio</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Jes&#250;s Cruz</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Torres</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Esteban</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Cervantes</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Alonso</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>San Roman</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Gonz&#225;lez-Sarmiento</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Miner</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Carracedo</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Eugenia Armengod</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Cald&#233;s</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Ben&#237;tez</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Baiget</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Hum Mut</source>
				<pubdate>2003</pubdate>
				<volume>22</volume>
				<fpage>301</fpage>
				<lpage>312</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/humu.10260</pubid>
						<pubid idtype="pmpid" link="fulltext">12955716</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Multiplex single-nucleotide primer extension analysis to simultaneously detect eleven <it>BRCA1 </it>mutations in breast cancer families</p>
				</title>
				<aug>
					<au>
						<snm>Revillion</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Verdiere</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Fournier</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Hornez</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Peyrat</snm>
						<fnm>JP</fnm>
					</au>
				</aug>
				<source>Clin Chem</source>
				<pubdate>2004</pubdate>
				<volume>50</volume>
				<fpage>203</fpage>
				<lpage>206</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1373/clinchem.2003.023713</pubid>
						<pubid idtype="pmpid" link="fulltext">14709649</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Primer3 software</p>
				</title>
				<url>http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi</url>
			</bibl>
			<bibl id="B15">
				<title>
					<p>BLAST (Basic Local Alignment Search Tool)</p>
				</title>
				<url>http://www.ncbi.nlm.nih.gov/blast/blast.cgi</url>
			</bibl>
			<bibl id="B16">
				<title>
					<p>AutoDimer Software</p>
				</title>
				<url>http://www.cstl.nist.gov/div831/strbase//AutoDimerHomepage/AutoDimerProgramHomepage.htm</url>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Coding region mitochondrial DNA SNPs: targeting East Asian and Native American haplogroups</p>
				</title>
				<aug>
					<au>
						<snm>&#193;lvarez-Iglesias</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Jaime</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Carracedo</snm>
						<fnm>&#193;</fnm>
					</au>
					<au>
						<snm>Salas</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Forensic Sci Int Genet</source>
				<pubdate>2007</pubdate>
				<volume>1</volume>
				<fpage>44</fpage>
				<lpage>55</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1016/j.fsigen.2006.09.001</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>Typing of mitochondrial DNA coding region SNPs of forensic and anthropological interest using SNaPshot minisequencing</p>
				</title>
				<aug>
					<au>
						<snm>Quint&#225;ns</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>&#193;lvarez-Iglesias</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Salas</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Phillips</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Lareu</snm>
						<fnm>MV</fnm>
					</au>
					<au>
						<snm>Carracedo</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Forensic Sci Int</source>
				<pubdate>2004</pubdate>
				<volume>140</volume>
				<issue>2&#8211;3</issue>
				<fpage>251</fpage>
				<lpage>257</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.forsciint.2003.12.005</pubid>
						<pubid idtype="pmpid" link="fulltext">15036446</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>Results of the 2003&#8211;2004 GEP-ISFG collaborative study on mitochondrial DNA: focus on the mtDNA profile of a mixed semen-saliva stain</p>
				</title>
				<aug>
					<au>
						<snm>Crespillo</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Paredes</snm>
						<fnm>MR</fnm>
					</au>
					<au>
						<snm>Prieto</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Montesino</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Salas</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Albarran</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>&#193;lvarez-Iglesias</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Amorin</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Berniell-Lee</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Brehm</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Carril</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Corach</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Cuevas</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Di Lonardo</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Doutremepuich</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Espinheira</snm>
						<fnm>RM</fnm>
					</au>
					<au>
						<snm>Espinoza</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>G&#243;mez</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Gonz&#225;lez</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Hernandez</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Hidalgo</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Jimenez</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Leite</snm>
						<fnm>FP</fnm>
					</au>
					<au>
						<snm>L&#243;pez</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>L&#243;pez-Soto</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Lorente</snm>
						<fnm>JA</fnm>
					</au>
					<au>
						<snm>Pagano</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Palacio</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Pestano</snm>
						<fnm>JJ</fnm>
					</au>
					<au>
						<snm>Pinheiro</snm>
						<fnm>MF</fnm>
					</au>
					<au>
						<snm>Raimondi</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Ram&#243;n</snm>
						<fnm>MM</fnm>
					</au>
					<au>
						<snm>Tovar</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Vidal-Rioja</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Vide</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Whittle</snm>
						<fnm>MR</fnm>
					</au>
					<au>
						<snm>Yunis</snm>
						<fnm>JJ</fnm>
					</au>
					<au>
						<snm>Garcia-Hirschfel</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>Forensic Sci Int</source>
				<pubdate>2006</pubdate>
				<volume>160</volume>
				<issue>2&#8211;3</issue>
				<fpage>157</fpage>
				<lpage>167</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">16243467</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>The R71G <it>BRCA1 </it>is a founder Spanish mutation and leads to aberrant splicing of the transcript</p>
				</title>
				<aug>
					<au>
						<snm>Vega</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Campos</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Bressac-de-Paillerets</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Bond</snm>
						<fnm>PM</fnm>
					</au>
					<au>
						<snm>Janin</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Douglas</snm>
						<fnm>FS</fnm>
					</au>
					<au>
						<snm>Domenech</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Baena</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Pericay</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Alonso</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Carracedo</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Baiget</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>D&#237;ez</snm>
						<fnm>O</fnm>
					</au>
				</aug>
				<source>Hum Mut</source>
				<pubdate>2001</pubdate>
				<volume>17</volume>
				<fpage>520</fpage>
				<lpage>521</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/humu.1136</pubid>
						<pubid idtype="pmpid" link="fulltext">11385711</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Analysis of <it>BRCA1 </it>and <it>BRCA2 </it>in Breast and Breast/Ovarian Cancer Families shows Population Substructure in the Iberian Peninsula</p>
				</title>
				<aug>
					<au>
						<snm>Vega</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Torres</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Mart&#237;nez</snm>
						<fnm>JI</fnm>
					</au>
					<au>
						<snm>Ru&#237;z-Ponte</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Barros</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Carracedo</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Ann Hum Genet</source>
				<pubdate>2002</pubdate>
				<volume>63</volume>
				<fpage>29</fpage>
				<lpage>36</lpage>
				<xrefbib>
					<pubid idtype="doi">10.1017/S0003480001001014</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>High proportion of BRCA1/2 founder mutations in Hispanic breast/ovarian cancer families from Colombia</p>
				</title>
				<aug>
					<au>
						<snm>Torres</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Rashid</snm>
						<fnm>MU</fnm>
					</au>
					<au>
						<snm>Gil</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Umana</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Ramelli</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Robledo</snm>
						<fnm>JF</fnm>
					</au>
					<au>
						<snm>Tawil</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Torregrosa</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Briceno</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Hamann</snm>
						<fnm>U</fnm>
					</au>
				</aug>
				<source>Breast Cancer Res Treat</source>
				<pubdate>2006</pubdate>
				<inpress/>
			</bibl>
			<bibl id="B23">
				<title>
					<p><it>BRCA1 </it>and <it>BRCA2 </it>mutations in a South American population</p>
				</title>
				<aug>
					<au>
						<snm>Jara</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Ampuero</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Santibanez</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Seccia</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Rodr&#237;guez</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Bustamante</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Mart&#237;nez</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Catenaccio</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Lay-Son</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Blanco</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Reyes</snm>
						<fnm>JM</fnm>
					</au>
				</aug>
				<source>Cancer Genet Cytogenet</source>
				<pubdate>2006</pubdate>
				<volume>166</volume>
				<fpage>36</fpage>
				<lpage>45</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.cancergencyto.2005.08.019</pubid>
						<pubid idtype="pmpid" link="fulltext">16616110</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
		<sec>
			<st>
				<p>Pre-publication history</p>
			</st>
			<p>The pre-publication history for this paper can be accessed here:</p>
			<p>
				<url>http://www.biomedcentral.com/1471-2350/8/40/prepub</url>
			</p>
		</sec>
	</bm>
</art>
