Females heterozygous for the J-allele (Mecp2^tm1.1Jae) 30 were obtained from Rudolf Jaenisch and bred to BALB/cJ males. Females heterozygous for the B-allele (Mecp2^tm1.1Bird) 31 were purchased from the Jackson Laboratory and were bred to C57BL/6J male mice. Tail DNA samples were genotyped for Mecp2 and Sry (for sex determination) as described 33. Sry primers: F: TCCCAGCATGCAAAATACAG; R: TGGTCATGAAACTGCTGCTT. Only male mutant mice and their male wild-type siblings were used, because female heterozygotes are mosaic for MeCP2 deficiency and have variable expressivity of the mutant phenotype. For the microarray experiments and technical validation by qRT-PCR, we studied 23 mutants and 25 wild-type J-allele mice, and 32 mutant and 34 wild-type B-allele mice. For biological validation by qRT-PCR of a new set of samples, we used 20 mutant and 16 wild-type B-allele mice. Animals were euthanized with CO₂. Cerebella and forebrains were snap frozen on dry ice. Total RNA was extracted using TRIzol Reagent (Invitrogen) and analyzed on a 1.5% agarose gel in MOPS buffer. RNA was concentrated and purified with YM30 microcon columns (Millipore). The Animal Care Committee of Stanford University approved all experimental procedures.

Brain samples from RTT individuals, including two hemizygous males with known MECP2 mutations, and non-RTT controls were obtained from the NICHD Brain and Tissue Bank for Developmental Disorders (UMB# 1238, 1420, 1748, 1815, 4516, and 4852) and from the Harvard Brain Tissue Resource Center (#b4160). We extracted total RNA from frozen frontal cortex using RNA Stat 60 (Tel-Test) or TRIzol reagent (Invitrogen). All human materials were obtained and studied under a protocol approved by the Stanford Human Research Protection Program.

Microarrays were obtained from the Stanford Functional Genomics Facility (SFGF) 34. These arrays contain 42,000 different transcripts that represent over 26,000 different genes. The transcripts vary in size and are PCR products from the RIKEN FANTHOM clone sets and a consortium of Stanford collaborators. The clone IDs on the cDNA microarrays are available from SFGF. Further information on the clones can be found at SOURCE 35.

For preparation of reference RNA, we used a pool of 100 cerebella collected from wild-type C57BL/6J and BALB/cJ male mice ranging from P7 to P60 in age. Reference RNA (20 μg) was reverse transcribed using an anchored oligo(dT) primer and labeled with Cy3-dCTP using the CyScribe First-Strand cDNA Labeling Kit (Amersham Biosciences, Catalog # RPN6200). Total RNA (20 μg) from wild-type samples or mutant samples was reverse transcribed and labeled with Cy5-dCTP. Following purification with YM30 microcon tubes, labeled reference cDNA was combined with either labeled wild-type cDNA or labeled mutant cDNA. The combined reactions (reference and wild-type or reference and mutant sample) were applied to a cDNA microarray. Hybridizations were carried out at 65°C for 14–16 hr in a waterbath or hybridization oven. Blocking reagents were added according to the Brown Lab protocol 36.

Following hybridization, microarrays were washed and immediately scanned with a GenePix 4000B microarray scanner (Axon Instruments/Molecular Devices). Automatic and manual quality analysis of array spots was performed with Genepix Pro 4.0. All microarray data were deposited in the Stanford Microarray Database and normalized by total intensity. The Log (base2) of Red/Green Normalized Ratio (Mean) for each gene was retrieved and averaged only if the spot on the microarray was from the same microtiter plate (LUID – laboratory microtiter well ID). Genes were centered by the mean. Up to five replicate microarrays were evaluated for each mutant allele at each time point. There are 41,000 different spots on each microarray. Some of those spots are not "good" spots, meaning they do not pass the Genepix program filter and/or our manual evaluation. Spots do not pass our filter if the signal is too low, the spot does not have an even distribution of signal, or if there are any other experimental problems that deem the spot of poor quality. Some spots removed for low signal may imply that the gene is not expressed. Regardless of the reason, genes were excluded from our analysis if more than 85% of the spots representing a particular gene are filtered from our data set across replicate microarrays. After filtering, the number of genes that remained in our data set were: J-allele: 2 wk (25,365), 4 wk (30,657), 8 wk (29,774); B-allele: 2 wk (28,939), 4 wk (28,005), 8 wk (26,473). Differentially expressed genes were defined as genes whose expression is consistently (P < 0.05) altered across microarray experiments. Paired t-tests (Microsoft Excel) were performed by comparing the expression of each gene in a mutant sample to expression in its wild-type sibling. The data were analyzed with Microsoft Excel and SAM (Sequence Analysis of Microarrays) software 37. Microarrays were centered and clustered using hierarchical clustering software available at the Stanford Microarray Database 3839. The cDNA microarray data can be accessed online via the SMD 88 or via the EBI ArrayExpress 89.

Total RNA (2 μg) was treated with 2U DNase I (Ambion) and reverse transcribed with random hexamers as primers and Superscript II (Invitrogen). qRT-PCR was performed using an ABI 5700 (AME Bioscience) instrument. Melting curve analysis was performed for each reaction to ensure a single peak. Amplicons were visualized after electrophoresis on a 2% agarose gel to ensure presence of a single amplicon. Amplification of β-actin, β 2-microglobulin, Rps28 and RPS18 transcripts served as RNA controls for relative quantitation (User Bulletin #2, Applied Biosystems). Mouse primers used (5' – 3'):

Mecp2 (F: TGACTTCACGGTAACTGGGAG; R: TTTCACCTGAACACCTTCTGATG),

β-actin (F: TGACCCTGAAGTACCCCATTGA; R: CCATGTCGTCCCAGTTGGTAAC)

β 2m (F: ACCCGCCTCACATTGAAATCC; R: CGATCCCAGTAGACGGTCTTG),

Rps28 (F: TAGGGTAACCAAAGTGCTGGGCAG; R: GACATTTCGGATGATAGAGCGG),

Irak1 (F: CAGAACCACCACAGATCATCATC; R: GGCTATCCAAGACCCCTTCTTC),

Fxyd1 (F: TCCATTCACCTACGATTACCACA; R: GAATTTGCATCGACATCTCTTGC),

Reln (F: CTGTGTCATACGCCACGAACA; R: GGGGAGGTACAGGATGTGGAT),

Gtl2 (F: GACCCACCTACTGACTGATGAACTG; R: GTGAAGACACAACAGCCTTTCTCC).

Human primers used (5' – 3'):

FXYD1 (F: AGGGACAATGGCGTCTCTTG; R: CGTAAGTGAACGGGTCGTGTT (NM_005031)

RPS18 (F: CTTTGCCATCACTGCCATTA; R: ACACGTTCCACCTCATCCTC)

We modified a protocol kindly provided by P. Farnham 40. Brains of 4 wk-old male mice were isolated and minced to small pieces. Cross-linking reactions were performed at room temperature for 15 min in the presence of 1% formaldehyde in PBS. Nuclear extracts were prepared and chromatin was fragmented by sonication to produce DNA fragments of an average length between 500 bp and 1000 bp. After pre-cleaning with salmon sperm DNA/protein A agarose (Upstate), we incubated the nuclear extracts with anti-MeCP2 antibody (Upstate) at 4°C overnight. MACs Protein A Micro Beads (Miltenyi Biotec) were added to the reaction to allow the formation of magnetically labeled immune complexes. We purified the bound complexes using a microcolumn following the manufacturer's instructions. After reversal of cross-links and digesting with proteinase K, we isolated DNA fragments with a DNA purification kit (Qiagen). We performed 36 cycles of PCR with primers specific to the first ~ 500–1000 bp of the gene promoter region or to the DMR at the 5' region of the Gtl2 gene.

Primer pairs: Fxyd1 (F: GCATGTCCTGCTGTATGTCG; R: CAGCCAGGGTCAAGAAATGT), Reln (F: AAAGGGAGATTGGGTGACG; R: ACGTGCTTCTGGATGGTTTC), Gtl2 – A (F: TCCAACACGAAATTCTGCAA; R: TGCTGGTCAACATGAACCTC) amplifying nt 94579–94964 and the nested primers Gtl2 – B (F: CGGTCCACTAGGGCTTTTT; R: CCAGGTTTTTAGACCCCAGA) amplifying nt 94645–94775 of AJ320506.

We examined gene expression in the cerebellum of two different Mecp2-mutant mouse models. The Mecp2^tm1.1Jae (J-allele) mutant has an in-frame deletion of exon 3 that codes for half of the MBD 30 (Figure 1A). Therefore, the expected mutant protein, if present, would be unable to bind methylated DNA. In contrast, the sequences encoding the transcriptional-repression domain (TRD), nuclear localization signals and C-terminal WW-binding domain, all encoded by exon 4, are retained. The second mutant, Mecp2^tm1.1Bird (B-allele), is deleted for exon 3 and the coding sequence of exon 4 31. In this allele, ~ 97% of the Mecp2-coding sequence is deleted, as well as a small part of the 3'UTR. No mutant mRNA was detected on Northern blot 31.

Asymptomatic females, heterozygous for a Mecp2 mutation and less than 6 months old, were bred to wild-type males. Offspring were genotyped for Mecp2 and Sry (for sexing). Cerebellar RNA was extracted from hemizygous males at mean ages of 2 wk, 4 wk and 8 wk. At 4 wk, 22% of mutant B-allele mice but none of the J-allele mice were symptomatic. Differences in body weight were observed in both sets of mice beginning at 4 wk, with the mutants being significantly smaller than wild-type littermates. At the "8 wk" time point, 80% of B-allele mice were symptomatic, while the range for J-allele mice extended from 10% at 7 wk to 71% at 9 wk. The most consistent abnormality observed in mutant mice was decreased mobility. At later stages, they developed tremors and hind-limb clasping and appeared poorly groomed.

Primers designed to amplify a region of exon 4 did not detect Mecp2 transcripts in B-allele mice as expected, but qRT-PCR studies revealed normal levels of the mutant Mecp2 transcript in 8 wk old mice with the J-allele (Figure 1B). Therefore, while the Mecp2^tm1.1Bird B-allele represents a true null mutation, the Mecp2^tm1.1Jae (J-allele) produces a stable mutant mRNA capable of directing synthesis of an internally deleted mutant protein that may have retained functions unrelated to ^mCpG binding. By using whole brain extracts for Western blot analyses, we were unable to detect the predicted protein product of 309 amino acids made from the J-allele. All antibodies we tested cross-reacted with an ~ 55 kD unknown protein in all samples and, therefore, the putative J-allele product may have been obscured. Alternatively, it may have been degraded in the majority of neurons.

To discover gene expression differences between mutant and wild-type cerebella, we performed microarray experiments of both mutant strains under the same conditions. Our microarrays contained 26,000 different cDNA clones spotted on glass slides (Stanford Functional Genomics Facility). Reverse-transcribed cDNA samples from either wild-type or mutant cerebella were hybridized to a cDNA microarray together with a reference sample consisting of pooled cerebellum cDNA. By carrying out hierarchical clustering of the microarray data, we found that several parameters greatly influenced the clustering. In comparing expression data from B-allele mice at 8 wk of age, littermates tended to cluster more than mutants of different litters (Figure 2). Clustering data from only the wild-type control mice illustrate the effects of age, strain background, and array batch (Figure 3). Therefore, in the final analysis, we only compared mutant expression arrays to wild-type arrays of mice that were from the same litter and only microarrays from the same batch. Pair-wise t-tests were performed to combine data from different wild-type/mutant pairs.

Consistent with previous expression microarray studies of whole brain or other brain regions, we found that loss of MeCP2 function does not lead to global mis-regulation of gene expression in cerebellum. Even without correction for multiple testing, the total number of differentially expressed genes with a p-value of < 0.05 was not significantly greater than would be expected by chance (Table 1). In B-allele mice, the number of genes with increased expression was slightly greater than would be expected by chance, but only at the 8 wk time point when more of the mutant mice used were symptomatic. The majority of changes reflect an increase of transcript levels, consistent with a relaxation of gene repression.

To identify genes of potential biological significance, we studied the datasets from different time points and different alleles for common differentially expressed genes (DEG), but very few consistent differences were detected. The degree of overlap at 2 wk, 4 wk, and 8 wk for each mutant Mecp2 allele is very small (Figure 4A, Additional file 1). In male mice with the J-allele, no genes showed altered expression at all three time points. In B-allele mice, only one Riken clone (H3142G05) 35 was differentially expressed at all time points. Expression of this gene, later identified as Tep1, was increased on microarrays: 1.24, 1.52, and 1.25 fold at 2 wk, 4 wk and 8 wk, respectively. Tep1, which codes for telomerase-associated protein 1, was first discovered in Tetrahymena and is conserved from ciliates to humans. TEP1 is the RNA-binding protein of the telomerase ribonucleoprotein complex that also contains the catalytic reverse transcriptase subunit and an RNA component that serves as a template for the synthesis of telomeric repeats 41. More recently, TEP1 was also identified as a protein component of vaults that are ribonucleoprotein complexes localized in the cytoplasm of cholinergic nerve terminals close to synaptic vesicles 42. Specifically, TEP1 is required for the stable association of the vault RNA with the vault complex 43. Tep1 expression was not significantly changed in mutant mice with the J-allele.

A total of 27 genes were differentially expressed at two different time points, four in the J-allele mutants and 23 in the B-allele mutants (Figure 4A). The gene displaying the greatest expression change is Gtl2 (Gene-trap locus 2) that was up-regulated 1.6 fold at 2 wk and 1.7 fold at 8 wk in B-allele mutants. Increased RNA levels were detected by two different clones on the cDNA microarrays at 2 wk (2210008A22) and 8 wk (1110014G20). The sequences are non-overlapping, but both represent the Gtl2 locus. Gtl2 is an imprinted gene producing a non-coding RNA of unknown function. The paternally expressed gene Delta-like 1 (Dlk1) and the maternally expressed Gtl2 gene are close to each other within an imprinted gene cluster on distal mouse chromosome 12 44. Dlk1 expression was not significantly changed in either mutant.

Since any expression changes that are relevant for the phenotype might be seen in both mutant strains, we determined the number of common expression changes between the two strains. In general, there is a low degree of overlap (39 out of 3285 genes) between DEGs in the B- and J-allele mutants, and only 15 genes overlap at the same time points (Figure 4B, Additional file 1). Potentially functionally relevant expression changes were observed in both mutants for several genes: Smarcb1, Satb1, Fubp3 and Abt1. Smarcb1 is a component of the SWI/SNF ATP-dependent chromatin-remodeling complex. Two studies have linked MeCP2 and the SWI/SNF chromatin-remodeling complex 545, although this connection is controversial 46. SATB1 (special AT-rich sequence binding protein 1) is predominantly expressed in thymocytes and specifically binds to nuclear matrix attachment regions (MARs) 47. It is involved in chromatin loop formation 48 and mediates formation of a higher-order transcriptionally active chromatin structure in activated T cells 49. Satb1 is also expressed in spinal cord and distinct regions of the developing mouse brain in a mutually exclusive fashion with its close relative Satb2 50. Like SATB1, MeCP2 also binds to nuclear matrix-associated DNA repeat sequences in the human genome, and the chicken ortholog of MeCP2 is the MAR-binding protein ARBP 51. In both mutant mouse models, increased expression was observed for two transcriptional activators, Fubp3 and Abt1, at 8 wk and for two other transcriptional regulators, Rab8a and Prdm4, at 8 wk and 2 wk, respectively (Additional file 1).

For further studies, we selected four genes based on a fold change of at least 1.4 and consistency in the directional change over the majority of microarrays: Irak1, Fxyd1, Reln, and Gtl2 (Table 2). Expression of Irak1, encoding interleukin-1 receptor-associated kinase 1, was increased in all mutant/wild-type comparisons at 8 wk in B-allele mice. In real-time qRT-PCR experiments, Irak1 expression was increased 3.5-fold in the mutant relative to the wild-type 8 wk B-allele cerebellum samples and 1.9-fold in the forebrain (RC and RF, Figure 5). In the microarray data, Irak1 expression was not significantly altered at other ages, nor was it altered in J-allele mice. The Irak1 gene is located only 3 kb distal to Mecp2. Therefore, this expression change may reflect the altered genomic environment. For example, an element that negatively influences Irak1 expression could be deleted in the B-allele, but not in the J-allele that has a much smaller deletion.

Fxyd1 encodes the FXYD domain containing ion transport regulator 1, also called phospholemman. Fxyd1 expression was consistently increased in all microarray experiments (average 1.4 fold) of B-allele mice at 8 wk (Table 2). The results were confirmed by qRT-PCR analysis on the same cerebellum samples (RC, Figure 5). Biological replication by qRT-PCR on a different set of B-allele mice (RC2; 3 wt, 5 mut) yielded more variable results between litters resulting in large SEM error bars and a p-value of 0.13. Fxyd1 expression in forebain samples from six different litters showed no difference between mutant and wild-type samples, but Fxyd1 expression is normally very low in forebrain.

Reln, encoding the extracellular signaling molecule reelin, is highly expressed in the developing cerebellum. Reelin is essential for proper neuronal lamination and synaptic plasticity. We found increased Reln transcript levels (1.5 fold) in four microarray experiments of B-allele samples at 2 wk (M, Figure 5). Reln expression was also increased in qRT-PCR experiments (RC), but this increase is not statistically significant as there was substantial variation among the samples tested (Figure 3). No difference was seen in hippocampus when 5 wild-type and 7 mutant samples were compared (RH, Figure 5).

Gtl2, encoding an imprinted maternally expressed non-translated RNA, is the mouse homolog of MEG3, maternally expressed gene 3, in humans. A study evaluating the transcripts encoded by Gtl2 identified 13 different splice variants 52. Our microarray data revealed significantly increased Gtl2 expression at 2 wk and 8 wk in B-allele mice (M, Figure 5). By qRT-PCR assays, the expression increase was present, but not significant in the same samples (RC) and in forebrain (RF, Figure 5). Cerebellum studies of a new set of mice (3 wt, 5 mut), however, showed no difference (RC2, Figure 5).

To determine if MeCP2 binds directly to the potential target genes, we performed chromatin immunoprecipitation (ChIP) assays on brain tissues. ChIP involves cross-linking genomic DNA to proteins that are bound to it. Subsequently, DNA-protein complexes are isolated by immunoprecipitation with a MeCP2 antibody and cross-links are reversed. The MeCP2 bound sequences are used as templates for semi-quantitative PCR to determine whether the gene region of interest is binding to MeCP2 40.

When we used primers specific for the 500–1000 bp Fxyd1 or Reln promoter regions, ChIP results indicated specific MeCP2 interaction in normal brain extracts (Figure 6). Amplification was enriched only in the presence of MeCP2 antibody (Figure 6, lanes 4). There was no, or much less, amplification of the DNA fragments when ChIP was performed either with nuclear extract from Mecp2-mutant mouse brain (lanes 1), or without MeCP2 specific antibody (lanes 2), or with non-specific antibody (IgG) (lanes 3). The results suggest that MeCP2 is part of a complex that is located at the promoter regions of these genes in normal brain and that this complex may not form in brain of Mecp2^tm1.1Bird mutant mice.

Gtl2 is an imprinted transcript whose maternal-specific expression is controlled by a differentially-methylated region (DMR) that overlaps the promoter region. MeCP2 binding was systematically analyzed using overlapping primer sets, each of which covers 250–400 bp of a region that contains the Gtl2-DMR (AJ320506, nt 92340–95350). MeCP2 binding activity was detected upstream of exon 1 and extending through exon 1 into intron 1 (AJ320506, 93720–95350) (Figure 6). This 1.6 kb region contains 63 CpG dinucleotides, many of which are differentially methylated.

Recently, Deng et al (2007) 53 identified FXYD1 as a target of MeCP2 by increased expression in the frontal cortex of RTT individuals and of Mecp2-mutant mice, with no changes observed in the cerebellum. While these authors confirmed by ChIP that MeCP2 binds to the FXYD1 promoter, their expression results were the opposite of our findings in mouse brain. Therefore, we examined FXYD1 expression in human brain samples from five RTT females, two males with congenital encephalopathy (CE) and documented MECP2 mutations, and seven non-RTT controls (Figure 7). We used real-time quantitative RT-PCR with the same primers as Deng et al. 53. We normalized FXYD1 expression levels to RPS18 expression rather than to rRNA expression. The ages of the donors differed only slightly, with controls in their 30 s and RTT females in their 20 s. The two CE males were between 1 and 2 years old. No MECP2 mutation had been identified in the single female RTT sample (UMB# 1748) with an increased FXYD1 transcript, but a brain contusion lesion was seen on autopsy. Our results do not confirm an increase in FXYD1 expression in frontal cortex of MeCP2-deficient humans, and they agree with our data on Mecp2-mutant mice. If MeCP2 were responsible for silencing FXYD1 in the forebrain, one would expect to observe a major increase in hemizygous males with CE who have no MeCP2 activity at all, as compared to RTT females who are mosaic for MeCP2-deficient and normal cells.

The interleukin-1 receptor-associated kinase 1 gene revealed the largest significant expression increase of any gene, in cerebellum (2.0-fold on microarray and 3.5-fold on qRT-PCR assays) and in forebrain (1.9-fold), but only in B-allele mice. Irak1 is located ~ 3 kb downstream of Mecp2 in the same transcriptional orientation (UCSC Genome browser, Feb 2006 assembly). This suggests that a negative regulator of Irak1 could have been lost with the B-allele deletion, or that the altered local chromatin conformation leads to increased Irak1 expression. The less likely possibility that MeCP2 directly regulates the expression of Irak1 would assume that the J-allele has maintained a negative regulatory function, since Irak1 expression is not increased in J-allele mutants. This allele-specific difference raises the concern that the increased Irak1 expression may be responsible for some dysregulated genes in the B-allele mice that are not dysregulated in the J-allele mice. To identify bona fide MeCP2 targets we, therefore, focused on genes whose promoters bind MeCP2 in ChIP assays. Nevertheless, any studies done with the B-allele mice, at any level, from behavior to histology, should be considered in the light of possible downstream effects of Irak1 overexpression.

IRAK1 belongs to the ser/thr protein kinase family, pelle subfamily. The protein is comprised of a death domain in the N-terminus, a central serine/threonine kinase domain, and a C-terminal serine/threonine rich region. Once phosphorylated, IRAK1 recruits the adapter protein PELI1 and causes activation of Toll-like-receptor-mediated intracellular signaling pathways. Three different splice variants in humans and mice differ in their relative abundance in brain, and differential splicing of IRAK1 may correlate with the aging process 56. Our qRT-PCR assay amplified all three splice forms. Given the postulated role of MeCP2 in alternative splicing 11, it might be of interest to evaluate the relative abundance of the different Irak1 splice forms in Mecp2-mutant B-allele brain.

In wild-type mice, Fxyd1 expression increases drastically from 2 wk to 8 wk in the cerebellum (our microarray data). In Mecp2 mutant mice, microarray and qRT-PCR studies revealed a significant increase of Fxyd1 transcripts at the 8 wk time point in B-allele mutants when compared to wild-type littermates. ChIP analyses confirmed the binding of MeCP2 to the Fxyd1 promoter. We, thus, have identified Fxyd1 as a validated target of MeCP2 binding. In contrast to a recent report by Deng et al. 53, however, Fxyd1 transcripts were not increased in the mutant forebrain where expression levels are normally very low. Attempting to replicate the reported studies in humans, we have used qRT-PCR to measure FYXD1 expression in frontal cortex from male and female individuals with MECP2 mutations and unaffected controls. We found no evidence for increased expression in the mutant samples. Therefore, our data in humans and mice do not support the hypothesis that MeCP2 is responsible for keeping FYXD1/Fxyd1 expression low in the majority of cells of forebrain. A small increase of expression in a neuronal subtype could have gone undetected, but the large increases reported by Deng et al. 53 in RTT frontal cortex are not confirmed by our results.

The protein product, FXYD1, also called phospholemman (PLM), is a small molecule with a single transmembrane domain and a member of the FXYD family of small ion transport regulators. FXYD proteins regulate Na-K-ATPase activity in a tissue- and isoform-specific way. Each FXYD gene is expressed in one or more specific tissues 57. FXYD1 is a major membrane phosphoprotein in heart and muscle. In brain, FXYD1 is predominantly found in the cerebellum, specifically in the molecular layer, in Purkinje neurons, and in axons traversing the granule cell layer, as well as in the choroid plexus 58. The protein forms a helical structure and inserts into lipid membranes in a trans-bilayer fashion 59. FXYD1 tetramers form ion channels selective for K+, Cl-, and taurine that are physically associated with the Na-K-ATPase 60. Recent studies revealed that FXYD1 also inhibits the cardiac Na+/Ca2+ exchanger (NCX1) 61. Overexpression of FXYD1 in adult cardiac myocytes acutely alters contractility as a function of extracellular Ca+ concentration, and Fxyd1 knock-out mice have cardiac hypertrophy 62. Alteration of Fxyd1 expression in the heart of Mecp2-deficient mice and humans could conceivably contribute to cardiac dysfunction and sudden death.

Another member of the FXYD family, FXYD4/CHIF (corticosteroid hormone induced factor) was initially isolated as a glucocorticoid response gene 63. Interestingly, two putative MeCP2 target genes, Sgk1 and Fkbp5 are also glucocorticoid-inducible and were found to be upregulated in 8 wk old B-allele mice studied previously 25. Furthermore, in the Mecp2³⁰⁸ mouse model of MeCP2 deficiency, circulating corticosteroid levels were increased in response to stress, and the gene for corticotropin-releasing hormone (Crh) was overexpressed in brain regions, leading to the conclusion that the mutant mice have an enhanced corticosteroid response to stress via increased CRH signaling 64. Future studies should evaluate whether FXYD1, like FXYD4, is also corticosteroid inducible.

Our identification of Reln as a primary target of MeCP2 is supported by the following observations: Reln transcript levels were increased in microarray and qRT-PCR experiments comparing cerebella from a total of 12 wild-type and 9 mutant mice. And the expression change was seen at the earliest time point (2 wk) when all mice were asymptomatic. No expression change was found in hippocampus. ChIP assay on whole brain documented that MeCP2 binds to the Reln promoter in normal mice. The proximal promoter of Reln is highly CpG-rich and methylated in whole brain extracts 65. Multiple hypermethylation sites at the Reln promoter can be induced by injection of L-methionine. And in a methionine-induced model of schizophrenia, MeCP2 was shown to bind to the Reln promoter 6667.

Reelin is a large extracellular protein that is produced by discrete populations of cells in the brain. It acts through the extracellular milieu on neighboring target cells. Until recently, the primary function of reelin was thought to involve regulation of neuronal migration during fetal brain development, by reelin providing an architectonic signal for the guidance of migrating neurons 6869. Reelin-expressing cells include the Cajal-Retzius (CR) cells in the cortical marginal zone, that are the first neurons to express Mecp2 in development, and cerebellar granule cells. MeCP2-deficient mice have a thinner cortex and more densely packed neurons that could result from migratory defects.

Reln expression continues in the adult, in particular in a subset of GABAergic neurons of the forebrain, as well as in the olfactory bulb 70. Reelin can modulate synaptic plasticity and enhance long-term potentiation (LTP) in adult hippocampal cultures 71. The signaling pathway that reelin acts on involves two high-affinity binding receptors, the very low density lipoprotein receptor (VLDLR) and the apolipoprotein E receptor 2 (ApoER2) 72. Binding of reelin to VLDLR and ApoER2 triggers phosphorylation of the cytoplasmic adaptor protein disabled 1 (Dab1) by Src family kinases, in particular Fyn. This series of reactions is required for cortical layer formation and for hippocampal dendrite development 73. In addition, cyclin-dependent kinase 5-dependent signals are required for the function of reelin not only in neuronal migration but also in synaptic transmission 74. The reelin signaling pathway is also involved in modulating learning and behavior 75. Reelin can regulate NMDA-type glutamate receptor activity and potentiate calcium influx through NMDA receptors in neuronal cultures 75. Sinagra et al. 76 documented a reelin-controlled change in subunit composition of NMDA glutamate receptors during maturation. Reelin signaling through ApoE receptors plays an essential role in synaptic plasticity and function in the adult brain 77.

Interestingly, BDNF, brain-derived neurotrophic factor, a primary target of MeCP2 7879 regulates reelin production in cortical neurons. Bdnf -/- mice have elevated reelin levels in Cajal-Retzius cells. Overexpression of BDNF produces brain abnormalities similar to the phenotype of reeler (rl) mutant mice. This phenotype is preserved in slice cultures of hippocampus 80. Furthermore, in in vitro co-culture systems, exogenous reelin caused dispersal of chain-migrating interneuron precursors in the olfactory bulb, suggesting that overexpression of reelin may affect neuronal migration 81.

We hypothesize that Reln overexpression is responsible for part of the phenotype of MeCP2-deficient mice, and that this phenotype is caused by abnormal neuronal migration in the developing brain of MeCP2-deficient mice and by dysregulation of reelin signaling pathways, thus disturbing synaptic function, in postnatal brain. To test this hypothesis, we have initiated genetic interaction studies. We aim to reduce the level of Reln expression in the Mecp2 mutant background by crossing rl+/- heterozygous males to Mecp2+/- female mice. We have preliminary evidence that the onset of morbid phenotypes is delayed and lifespan prolonged in some of the Mecp2Y/- ;Rln+/- double-mutant mice, when compared to their Mecp2Y/- ;Rln+/+ littermates.

By microarray analysis, we identified Gtl2, called MEG3 (Maternally-expressed gene 3) in humans, as a significantly increased transcript in mutant cerebellum samples. qRT-PCR confirmed increased expression, although not significant due to large biological variation in different litters, in cerebellum and forebrain. Gtl2 encodes a maternally expressed imprinted non-translated RNA of unknown function. Gtl2 is expressed in most tissues, but most highly in brain. It lies within a cluster of imprinted genes on chromosome 12 that is conserved on distal 14q in human. Alternatively-spliced Gtl2 transcripts extend to include intron-encoded C/D box snoRNAs 82 and microRNAs 8384. Thus, Gtl2 might function as a host gene for these small RNAs. In our qRT-PCR assays, the increase in Gtl2 expression in cerebellum was less striking, but Gtl2 expression was consistently increased in the forebrain of Mecp2-deficient mice.

Two previous studies have identified Gtl2 as a possible target of MeCP2. An expression microarray study on whole brain of one B-allele mouse revealed a 1.9-fold increase in Gtl2 expression 25. Independently, by using a variant of differential display technology and qRT-PCR confirmation, Kriaucionis and colleagues 27 detected increased Gtl2 expression in whole brains of B-allele mice. Since the increase was significant only at late symptomatic stages, the authors suggested that it may represent a secondary consequence of the disease pathology. In contrast, our data show a similar increase in Gtl2 expression at 2 wk and at 8 wk, albeit detected by two different cDNA clones on the array. Gtl2 has a CpG-rich promoter region that is unmethylated on the maternal allele and becomes hypermethylated on the paternal allele after fertilization 8586. By ChIP assay, we found that MeCP2 binds in vivo to this region with binding sites extending from 5' of exon 1 into intron 1, raising the possibility that it may play a role in silencing of the paternal allele. Alternatively, MeCP2 may bind to methylated CpG sites on the active maternal chromosome and thus regulate Gtl2 repression in certain brain regions or cell types. Future studies of allele-specific expression levels will address these possibilities.

Considering other previously reported candidate MeCP2 target genes that are represented on our microarrays: Only Snrp70, reported to be increased by qRT-PCR in whole brain from late symptomatic B-allele mice (1.44 fold, p = 0.04)27, showed increased expression (1.5-fold) in cerebellum of 8 wk B-allele mice in our study. None of the following genes had significant expression changes in cerebellum: Uqcrc1 27, Bdnf 87, Dlx5 4, Fkbp5 and Sgk1 25. This is not surprising given that some of these genes may be primarily expressed in other brain regions and/or only in certain neuronal sub-types. Or transcript levels may be variable, when expression is modulated by activity state as for Bdnf 7879. Our experience with biological validation and hierarchical clustering of independent samples taught us about the mitigating effects of different sibship identities. We need to consider that the different mothers are Mecp2+/- heterozygotes, having the genotype of females with RTT. Although not obviously symptomatic yet, their variable X-inactivation status could influence expression profiles in their offspring.