<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2350-6-29</ui>
   <ji>1471-2350</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Association study of functional genetic variants of innate immunity related genes in celiac disease</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Rueda</snm>
               <fnm>B</fnm>
               <insr iid="I1"/>
               <email>blarume@ipb.csic.es</email>
            </au>
            <au id="A2">
               <snm>Zhernakova</snm>
               <fnm>A</fnm>
               <insr iid="I2"/>
               <email>a.zhernakova@med.uu.nl</email>
            </au>
            <au id="A3">
               <snm>L&#243;pez-Nevot</snm>
               <fnm>MA</fnm>
               <insr iid="I3"/>
               <email>miguel.lopez.nevot.sspa@juntadeandalucia.es</email>
            </au>
            <au id="A4">
               <snm>Mart&#237;n</snm>
               <fnm>J</fnm>
               <insr iid="I1"/>
               <email>martin@ipb.csic.es</email>
            </au>
            <au id="A5" ca="yes">
               <snm>Koeleman</snm>
               <fnm>BPC</fnm>
               <insr iid="I2"/>
               <email>b.p.c.koeleman@med.uu.nl</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Instituto de Parasitolog&#237;a y Biomedicina "L&#243;pez-Neyra", CSIC, Granada, Spain</p>
            </ins>
            <ins id="I2">
               <p>Complex Genetics Group, Department of Biomedical Genetics, University Medical Center, Utrecht, The Netherlands</p>
            </ins>
            <ins id="I3">
               <p>Servicio de Inmunolog&#237;a, Hospital Virgen de las Nieves, Granada, Spain</p>
            </ins>
         </insg>
         <source>BMC Medical Genetics</source>
         <issn>1471-2350</issn>
         <pubdate>2005</pubdate>
         <volume>6</volume>
         <issue>1</issue>
         <fpage>29</fpage>
         <url>http://www.biomedcentral.com/1471-2350/6/29</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16078996</pubid>
               <pubid idtype="doi">10.1186/1471-2350-6-29</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>29</day>
               <month>3</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>03</day>
               <month>8</month>
               <year>2005</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>03</day>
               <month>8</month>
               <year>2005</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2005</year>
         <collab>Rueda et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Recent evidence suggest that the innate immune system is implicated in the early events of celiac disease (CD) pathogenesis. In this work for the first time we have assessed the relevance of different proinflammatory mediators typically related to innate immunity in CD predisposition.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>We performed a familial study in which 105 celiac families characterized by the presence of an affected child with CD were genotyped for functional polymorphisms located at regulatory regions of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genes. Familial data was analysed with a transmission disequilibrium test (TDT) that revealed no statistically significant differences in the transmission pattern of the different genetic markers considered.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>The TDT analysis for <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18</it>, and <it>MCP-1 </it>genes genetic variants did not reveal biased transmission to the affected offspring. Only a borderline association of <it>RANTES </it>promoter genetic variants with CD predisposition was observed.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our results suggest that the analysed polymorphisms of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genes do not seem to play a major role in CD genetic predisposition in our population.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Celiac disease (CD) is an autoimmune disorder of the small intestine in which dietary gluten ingestion leads to a chronic inflammatory status of the mucosa <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. There is strong evidence for a genetic component for CD, with the HLA genes being the strongest genetic locus associated with CD predisposition known to date. About 95% of CD patients are carriers of the DQ2 molecule, encoded by DQA1*05/DQB1*02 alleles, compared to ~10% of healthy control subjects. Furthermore, the DQ8 molecule (DQA1*0301/DQB1*0302 is also found more frequently in CD patients although to a lesser extent <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Finally, a role for genes located outside the HLA region has been suggested since the overall contribution of HLA genes to CD genetic predisposition is no more than 40% <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
         <p>T CD4+ lymphocytes are key elements in the induction and progression of CD pathogenesis. Certain gluten peptides bound to DQ2 or DQ8 molecules cause proliferation and production of proinflammatory cytokines by lamina propria CD4 +T cells <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Besides this activation of adaptive immune response, recent evidences suggest that there is an implication of the innate immunity in the initial phases of CD <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. In this regard, some gluten peptides have been demonstrated to drive a danger signal that leads to an activation of the innate immune system <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp> and additionally it is thought that bacteria may play a role in CD <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. In fact, CD patients show an up-regulation in the expression of pro-inflammatory cytokines typically related to the innate immune response, such us IL1, IL-18 and chemokines <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>The IL1 gene cluster located in the chromosomal region 2q12-22 codifies for three proteins: IL-1&#945;, IL-1&#946; and IL-1 receptor agonist (IL-1RN), of which the two first are strong inducers of inflammation while IL-1RN is an effective antagonist binding to the IL-1 receptor without activating the target cell <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. These genes are polymorphic bearing well-characterized single nucleotide polymorphisms (SNPs). Polymorphisms in IL-1&#945; at position -889 C/T (rs1800587) and IL-1&#946; at position -511 C/T (rs1143627) were described <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Furthermore, recent findings showed that the -511 C/T IL-1&#946; genetic variant is related to differences in IL-1&#946; protein secretion <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. The <it>IL-1RN </it>gene contains within its second intron a variable number of an 86-bp tandem repeats (rs380092) <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, showing the allele 2 (IL-1RN*2; two repeats) an increased frequency in a variety of autoimmune and inflammatory disorders <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Another important member of the proinflammatory IL-1 family is IL-18, which is thought to be a key regulator of cytokine expression <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Furthermore, a role for IL-18 in the induction of an anti-gluten inflammatory response has been suggested <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. It is thought that IL-18 gene variation in the promoter region regulates the expression of this cytokine <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Interestingly, in the IL-18 promoter region two SNPs -607 A/C (rs1946518) and -137 G/C (rs187238) were described, which are supposed to alter the IL-18 promoter activity <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>Moreover, raised levels of chemokines such us RANTES (regulated upon activation, normal T-cells expressed and secreted) and monocyte chemoatractant protein-1 (MCP-1) have been observed in the primary immune response to gluten in CD patients <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B8">8</abbr></abbrgrp>. Interestingly, genetic variants within regulatory regions that can affect trancription and protein production levels, <it>RANTES </it>-403 G/A (rs2107538) and -28 G/C (rs2280788) and <it>MCP-1 </it>-2518 G/A (rs1024611) SNPs, were described <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>.</p>
         <p>Taking into consideration these findings, in this work we aimed to investigate the possible implication of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>functional polymorphisms in CD susceptibility.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Patients</p>
            </st>
            <p>In the present work we have analysed a panel of 105 celiac families characterised by the presence of an affected child with CD. The study participants were recruited at "Hospital Materno-Infantil" and "Hospital Clinico Universitario", Granda, (Spain) and were of Spanish Caucasian origin. All patients were diagnosed following the European Society of Paediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN) criteria for CD <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Their age at study was 7.1 &#177; 3.9 years and the mean age for disease diagnosis was 2.7 &#177; 2.72. A 60% were women and 40 % men, showing an anthropometry at diagnosis (weight and height) of P 3&#8211;100 percentile. The mean age of gluten introduction was 6.4 &#177; 1.5 months. Typical symptoms were observed in 72.2 % of patients and 27.8 % showed atypical symptoms. All family members were genotyped in DRB1 and DQB1. DQA1 typing was deduced from DQB1 and DRB1 typing on the basis of the strong linkage disequilibrium among HLA class II alleles.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping</p>
            </st>
            <p>DNA from patients and controls was obtained from peripheral blood using standard methods. For all of the considered SNPs, except <it>IL-1RN </it>and <it>RANTES </it>-403, samples were genotyped using a Taqman 5' allelic discrimination assay. Table <tblr tid="T1">1</tblr> shows the Taqman MGB probes sequences used for each polymorphism provided by the Custom-Taqman-SNP-Genotyping-Assay (Applied Biosystems, Foster City, CA, USA). PCR reaction was carried in a total reaction volume of 5 &#956;l with the following amplification protocol: denaturation at 92&#176;C for 10 min, followed by 50 cycles of denaturation at 92&#176;C for 15 sec and annealing and extension at 58&#176;C for 1 min. Post-PCR, the genotype of each sample was attributed automatically by measuring the allelic specific fluorescence on the ABI PRIM 7900 Sequence Detection Systems using the SDS 2.2.1 software for allelic discrimination (Applied Biosystems, Foster City, CA, USA). <it>RANTE</it>S -403 genotyping was performed using a TaqMan SNP-Genotyping-Assay (part number: C__15874407_10, Applied Biosystems, Foster City, CA, USA).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Taqman probes used for cytokine genotyping</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Polymorphism</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Taqman probe sequence</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-1A -889 C/T (rs1800587)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; CCTTCAATGGTGTTGCC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; CCTTCAATGATGTTGCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-1B -551 C/T (rs1143627)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; CTGTTTTTATGGCTTTCA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; CTGTTTTTATAGCTTTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-18 -607 C/A (rs1946518)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; ATCATTAGAATTTTATGTAATAAT</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; ATCATTAGAATTTTATTTAATAAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-18 -137 G/C (rs187238)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; ACTATTTTCATGAAATCTTTTCT</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; TTTTCATGAAATGTTTTCT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>RANTES -28 G/C (rs2280788)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; CCCCTCAACTGGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; CCCCTGAACTGGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>MCP-1 -2518 G/A (rs1024611)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>VIC &#8211; CAGACAGCTGTCACTTT</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FAM &#8211; CAGACAGCTATCACTTT</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>The <it>IL-1RN </it>polymorphism was genotyped by PCR as previously described <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Briefly, we used a froward primer 5'- CTC AGC AAC ACCT CCT AT and reverse primer 5'- TCC TGG TCT GCA GGT AA, two amplify five possible alleles with different PCR fragment size: 410 bp (allele 1: 4 repeats), 240 bp (allele 2: two repeats), 325 bp (allele 3: 3 repeats), 500 bp (allele 4: 5 repeats), and 595 bp (allele 5: 6 repeats).</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>We used the UNPHASED software created for TDT and case-control analysis <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. We performed a Transmission Disequilibrium Test (TDT), which assesses allele transmission rates in simplex families and tests for deviation from expected 50% transmission. For the haplotype analysis, pair-wise linkage disequilibrium measures were investigated and haplotypes constructed using the expectation-maximization (EM) algorithm implemented in UNPHASED software. The power of the study to detect an effect of a polymorphism in disease susceptibility was estimated using the Quanto v 0.5 software (Department of Preventive Medicine University of Southern California, California, USA) <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>IL1 gene cluster</p>
            </st>
            <p>The transmission pattern for <it>IL-1&#945; </it>-889, <it>IL-1</it>&#946; -511 and <it>IL-1RN </it>VNTR polymorphisms is shown in table <tblr tid="T2">2</tblr>. When transmission of these genetic variants was analysed, none of the alleles showed statistically significant skewing. IL-1&#945; -889 T allele was slightly more transmitted to the affected children (58% transmission for allele T vs 47% for allele C), however the <it>p </it>value failed to reach statistically significant level (Table <tblr tid="T2">2</tblr>). With regard to <it>IL-1RN </it>we observed that alleles IL-1RN*1 and IL-1RN*2 were the most frequent in our population (71.6% and 26.8% respectively), accordingly with previously studies in Caucasian populations <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Allelic frequencies and percentage of transmission of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genetic variants in CD families.</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Alelle frequency in parents (%)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>T:NT</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>% T</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>P</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-1A -551</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>C</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>70.4</p>
                     </c>
                     <c ca="center">
                        <p>111:125</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>T</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>29.6</p>
                     </c>
                     <c ca="center">
                        <p>52:38</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>0.08</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-1B -889</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>T</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>67.6</p>
                     </c>
                     <c ca="center">
                        <p>110:111</p>
                     </c>
                     <c ca="center">
                        <p>49.7</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>C</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>32.4</p>
                     </c>
                     <c ca="center">
                        <p>47:46</p>
                     </c>
                     <c ca="center">
                        <p>50.5</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>IL-1RN</it>
                           </b>
                           <b>VNTR</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>71.6</p>
                     </c>
                     <c ca="center">
                        <p>107:107</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>26.8</p>
                     </c>
                     <c ca="center">
                        <p>43:42</p>
                     </c>
                     <c ca="center">
                        <p>50.6</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1.6</p>
                     </c>
                     <c ca="center">
                        <p>2:2</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-18 -607</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>C</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>61.7</p>
                     </c>
                     <c ca="center">
                        <p>102:103</p>
                     </c>
                     <c ca="center">
                        <p>49.7</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>A</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>38.3</p>
                     </c>
                     <c ca="center">
                        <p>59:58</p>
                     </c>
                     <c ca="center">
                        <p>50.4</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>IL-18 -137</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>G</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>75.9</p>
                     </c>
                     <c ca="center">
                        <p>124:124</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>C</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>24.1</p>
                     </c>
                     <c ca="center">
                        <p>47:47</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>RANTES -28</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>C</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>84.1</p>
                     </c>
                     <c ca="center">
                        <p>155:148</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                     </c>
                     <c ca="center">
                        <p>0.04</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>G</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>15.9</p>
                     </c>
                     <c ca="center">
                        <p>3:10</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>0.04</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>RANTES -403</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>G</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>85.7</p>
                     </c>
                     <c ca="center">
                        <p>141:128</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>A</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>14.3</p>
                     </c>
                     <c ca="center">
                        <p>23:36</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>MCP-1</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>A</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>72.8</p>
                     </c>
                     <c ca="center">
                        <p>117:129</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>G</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>27.2</p>
                     </c>
                     <c ca="center">
                        <p>48:36</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>
                     <b><it>T </it>= transmitted, <it>NT </it>= not transmitted <it>%T </it>= percentage transmitted</b>
                  </p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>IL18 gene</p>
            </st>
            <p>The TDT analysis for -607 A/C and -137 G/C <it>IL-18 </it>promoter genetic variants did not reveal biased transmission of any of the alleles to the affected offspring (Table <tblr tid="T2">2</tblr>).</p>
            <p>The haplotype estimation for the -607 A/C and -137 <it>IL-18 </it>promoter variants revealed complete linkage disequilibrium between the two variants (D' = 1). We observed three out of the four possible haplotypic combinations in CD families (Table <tblr tid="T3">3</tblr>). The transmission pattern of <it>IL-18 </it>promoter haplotypes did not show any statistically significant skewing (Table <tblr tid="T3">3</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Transmission pattern of haplotypes inferred for IL-18 and RANTES promoter genetic variant in CD families</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Gene</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Haplotype</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Transmitted (%)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>No transmitted (%)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>P</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Il-18</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-607A/-137G</p>
                     </c>
                     <c ca="center">
                        <p>37 (24)</p>
                     </c>
                     <c ca="center">
                        <p>35 (22.5)</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>-607A/-137C</p>
                     </c>
                     <c ca="center">
                        <p>19 (12.2)</p>
                     </c>
                     <c ca="center">
                        <p>20 (13)</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>-607C/-137G</p>
                     </c>
                     <c ca="center">
                        <p>99 (63.8)</p>
                     </c>
                     <c ca="center">
                        <p>100 (64.5)</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>RANTES</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-403G/-28A</p>
                     </c>
                     <c ca="center">
                        <p>3 (1.4)</p>
                     </c>
                     <c ca="center">
                        <p>8 (5.2)</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>-403A/-28C</p>
                     </c>
                     <c ca="center">
                        <p>19 (12.3)</p>
                     </c>
                     <c ca="center">
                        <p>26 (16.8)</p>
                     </c>
                     <c ca="center">
                        <p>NS</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>-403G/-28C</p>
                     </c>
                     <c ca="center">
                        <p>132 (85.7)</p>
                     </c>
                     <c ca="center">
                        <p>119 (81.5)</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>MCP-1 and RANTES</p>
            </st>
            <p>After analyzing the <it>MCP-1 </it>-2518 G/A alleles transmission we observed that none of the alleles was preferentially transmitted from heterozygous parents to the affected offspring (Table <tblr tid="T2">2</tblr>). Regarding to the <it>RANTES </it>promoter genetic variants the mutant alleles -403 A and -28 G showed an overall allele frequency similar to that expected for Caucasian populations (84.1% and 96.5% respectively in our population) <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. The transmission of both -403G/A and -28 C/G SNPs showed a slightly deviation from the 50% expected transmission pattern (Table <tblr tid="T2">2</tblr>). Alleles -403 G and -28 C were more transmitted to the affected offspring with borderline significance (<it>P </it>= 0.04 and <it>P </it>= 0.06 respectively) (Table <tblr tid="T2">2</tblr>). In addition, we estimated haplotypes for both genetic variants. Three out of the four haplotypic combinations were observed, being the -403G/-28C and -403A/-28C haplotypes the most common in CD families. No significant distorted transmission pattern for <it>RANTES </it>promoter haplotypes was observed (Table <tblr tid="T3">3</tblr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>CD is considered a model for autoimmune disorders since many of the components that generate the altered immune response to gluten have been well characterized <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. However, there are some relevant events of CD pathogenesis that remain unclear, for instance the stimuli that drives the high IFN&#947; levels in the small intestine of CD patients and why only one out of 20&#8211;30 DQ2-positive individuals develops CD <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. An explanation for these questions might be provided from recent studies that point out a role for the innate immunity in CD <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. This finding supports a novel focus of research in CD molecular and genetic basis, opening a new field for the functional search of CD candidate genes.</p>
         <p>In this work, for the first time we have assessed the relevance of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genes in CD predisposition. All these genes have been previously associated with susceptibility to several autoimmune disorders <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. However, we failed to detect an association of <it>IL-1&#945;, IL-1&#946;, IL-1RN, IL-18</it>, and <it>MCP-1 </it>genes with CD predisposition using a TDT analysis in our cohort of 105 simplex CD families. Only a borderline significant association of <it>RANTES </it>promoter genetic variants with CD predisposition was observed.</p>
         <p>Several studies have focused on the role of <it>RANTES </it>-403G/A and -28 G/C promoter polymorphisms in susceptibility to different autoimmune disorders. The <it>RANTES </it>-403A allele has been associated with susceptibility to multiple sclerosis (MS) and polymialgia rheumatica <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>. On the other hand, the <it>RANTES </it>-28G allele was observed to be a genetic risk for clinical complications such us diabetic neprhopathy, early onset of MS, lower levels of C3 in SLE, and higher incidence of central nervous system lupus <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B41">41</abbr></abbrgrp>. Both <it>RANTES </it>-403A and -28G alleles were associated with higher RANTES expression levels <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. However, considering the multiple testing of the 6 different genes of our study, the association observed for <it>RANTES </it>promoter variants in our population can not be considered as being significant. Therefore, our results of <it>RANTES </it>suggest that further studies should be performed to clarify the role of <it>RANTES </it>in CD and autoimmune diseases in general.</p>
         <p>Using a familial approach we eliminate the risk of population stratification derived from case-control association studies. In addition, we estimated that our study design would have considerable power to detect the effect of a polymorphism with moderate to high risk for CD. Assuming an additive model, a minor allele frequency of 0.30 (corresponding to a median value of the majority of markers considered) and RR of 1.8 we would reach 81% power to detect an association in our population. Nevertheless, under a dominant model the power drops to 49% and considering a lower disease allele frequency, for instance 0.16 as is the case of <it>RANTES </it>-28, our study power would decrease to a 64% for a RR of 1.8, and increases to 82% when we assume a RR of 2.0. For this reason, the low level of significance that our TDT analysis reached for <it>RANTES </it>promoter genetic variants might well reflect a true positive, and therefore needs further confirmation using a larger group of CD families.</p>
         <p>Taking into account our findings, it is suggested that the analysed genetic polymorphisms of <it>IL-1&#945;, IL1-&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genes seem not to play a major role in CD susceptibility in our population. It might be possible that the release of these cytokines and chemokines observed in CD patients could be derived from the activity of other innate immunity related pro-inflammatory mediators with higher influence in disease pathogenesis. In this regard, it is known that in CD the cytokine expression pattern in response to gluten is strongly dominated by IFN&#947; <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Of note, in a recent work we assessed the influence of a functional dinucleotide polymorphism of IFN&#947; gene in CD predisposition. An association of a higher IFN&#947; producer allele with CD was observed, supporting a possible explanation for the high levels of INF&#947; observed in intestinal mucosa of CD patients <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>.</p>
         <p>Other proinflammatory mediators related with innate immunity such as, TNF-&#945; and IL-12, has been analysed with respect to CD susceptibility. In accordance with our findings no evidence of association was found between IL-12 and CD in two independent studies <abbrgrp><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp>. Regarding TNF-&#945; it has been difficult to dissect the relevance of this genetic marker in CD since it maps within HLA clas III region and it shows linkage disequilibrium with CD disease predisposing DQ2 alleles. In fact controversial results have been obtained, and there is no consensus about an independent or due to linkage disequilibrium role of TNF-&#945; in CD susceptibility <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Our results suggest that <it>IL-1&#945;, IL1-&#946;, IL-1RN, IL-18, RANTES </it>and <it>MCP-1 </it>genetic variants do not play a major role in CD genetic predisposition, although the suggestive evidence for <it>RANTES </it>deserves further investigation. Furthermore, we consider the innate response an intriguing focus of research and it should be of interest to investigate the role of other cytokines up-regulated in the early events of CD.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>B.R., carried out the genotyping and statistical analysis and drafted the manuscript.</p>
         <p>A.Z., participated in the genotyping and helped in the use of the ABI PRIM 7900 Sequence Detection Systems and SDS 2.2.1 software.</p>
         <p>M.A. L-N., collected the samples and revised the manuscript.</p>
         <p>J.M., participated in the manuscript design and coordination and helped to draft the manuscript</p>
         <p>B.K., reviewed the statistical analysis and helped to draft the manuscript.</p>
         <p>All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by grant SAF03-460 from Plan Nacional de I+D (CICYT), and in part by Consejer&#237;a de Educaci&#243;n, Junta de Andaluc&#237;a, grupo CTS-180.</p>
            <p><b>B.K</b>. is supported by the Dutch Diabetes Research Foundation, The Netherlands Organisation for Health Research and Development (ZonMW) and The Juvenile Diabetes Research Foundation International (JDRF) (2001.10.004).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Coeliac disease: dissecting a complex inflammatory disorder</p>
            </title>
            <aug>
               <au>
                  <snm>Sollid</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Nature Review Immunology</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <fpage>647</fpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/nri885</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>HLA in coeliac disease: Unravelling the complex genetics of a complex disorder</p>
            </title>
            <aug>
               <au>
                  <snm>Louka</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Sollid</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Tissue Antigens</source>
            <pubdate>2003</pubdate>
            <volume>61</volume>
            <fpage>105</fpage>
            <lpage>117</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12694579</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Green</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Jabri</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2003</pubdate>
            <volume>362</volume>
            <fpage>383</fpage>
            <lpage>391</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(03)14027-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12907013</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Innate immunity and coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Schuppan</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Esslinger</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Dieterich</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2003</pubdate>
            <volume>362</volume>
            <fpage>3</fpage>
            <lpage>4</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(03)13843-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">12853189</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Maiuri</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ciacci</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ricciardelli</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Vacca</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Raia</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Auricchio</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Picard</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Osman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Quaratino</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Londei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>2003</pubdate>
            <volume>362</volume>
            <fpage>30</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0140-6736(03)13803-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">12853196</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Activation of macrophages by gliadin fragments: isolation and characterization of active peptide</p>
            </title>
            <aug>
               <au>
                  <snm>Tuckova</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Novotna</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Novak</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Flegelova</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Kveton</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Jelinkova</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Zidek</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Man</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tlaskalova-Hogenova</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>2002</pubdate>
            <volume>71</volume>
            <fpage>625</fpage>
            <lpage>631</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11927649</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Presence of bacteria and innate immunity of intestinal epithelium in childhood celiac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Forsberg</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Fahlgren</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Horstedt</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hammarstrom</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hernell</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Hammarstrom</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Am J Gastroenterol</source>
            <pubdate>2004</pubdate>
            <volume>99</volume>
            <fpage>894</fpage>
            <lpage>904</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1572-0241.2004.04157.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15128357</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Increased proinflammatory cytokine gene expression in the colonic mucosa of coeliac disease patients in the early period after gluten challenge</p>
            </title>
            <aug>
               <au>
                  <snm>Chowers</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Marsh</snm>
                  <fnm>MN</fnm>
               </au>
               <au>
                  <snm>De Grandpre</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nyberg</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Theofilopoulos</snm>
                  <fnm>AN</fnm>
               </au>
               <au>
                  <snm>Kagnoff</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>1997</pubdate>
            <volume>107</volume>
            <fpage>141</fpage>
            <lpage>147</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2249.1997.d01-892.x</pubid>
                  <pubid idtype="pmpid">9010269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Pre- and post-treatment serum levels of cytokines IL-1beta, IL-6, and IL-1 receptor antagonist in celiac disease. Are they related to the associated osteopenia?</p>
            </title>
            <aug>
               <au>
                  <snm>Fornari</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Pedreira</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Niveloni</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Diez</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Vazquez</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Mazure</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sugai</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Smecuol</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Boerr</snm>
                  <fnm>L</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am J Gastroenterol</source>
            <pubdate>1998</pubdate>
            <volume>93</volume>
            <fpage>413</fpage>
            <lpage>418</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9580142</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Interleukin 18 and associated markers of T helper cell type 1 activity in coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Salvati</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>MacDonald</snm>
                  <fnm>TT</fnm>
               </au>
               <au>
                  <snm>Bajaj-Elliott</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Borrelli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Staiano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Auricchio</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Troncone</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Monteleone</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Gut</source>
            <pubdate>2002</pubdate>
            <volume>50</volume>
            <fpage>186</fpage>
            <lpage>190</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/gut.50.2.186</pubid>
                  <pubid idtype="pmpid" link="fulltext">11788557</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>The balance between IL-1 and IL-1Ra in disease</p>
            </title>
            <aug>
               <au>
                  <snm>Arend</snm>
                  <fnm>WP</fnm>
               </au>
            </aug>
            <source>Cytokine Growth Factor Rev</source>
            <pubdate>2002</pubdate>
            <volume>13</volume>
            <fpage>323</fpage>
            <lpage>340</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1359-6101(02)00020-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12220547</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Single base polymorphism at -511 in the human interleukin-1 beta gene (IL1 beta)</p>
            </title>
            <aug>
               <au>
                  <snm>di Giovine</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Takhsh</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Blakemore</snm>
                  <fnm>AI</fnm>
               </au>
               <au>
                  <snm>Duff</snm>
                  <fnm>GW</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>1992</pubdate>
            <volume>1</volume>
            <fpage>450</fpage>
            <xrefbib>
               <pubid idtype="pmpid">1301918</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>A genetic association between juvenile rheumatoid arthritis and a novel interleukin-1 alpha polymorphism</p>
            </title>
            <aug>
               <au>
                  <snm>McDowell</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Symons</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Ploski</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Forre</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Duff</snm>
                  <fnm>GW</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>1995</pubdate>
            <volume>38</volume>
            <fpage>221</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7848312</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Correlation of polymorphic variation in the promoter region of the interleukin-1 beta gene with secretion of interleukin-1 beta protein</p>
            </title>
            <aug>
               <au>
                  <snm>Hall</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Perregaux</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gabel</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Woodworth</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Durham</snm>
                  <fnm>LK</fnm>
               </au>
               <au>
                  <snm>Huizinga</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Breedveld</snm>
                  <fnm>FC</fnm>
               </au>
               <au>
                  <snm>Seymour</snm>
                  <fnm>AB</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>1976</fpage>
            <lpage>1983</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20310</pubid>
                  <pubid idtype="pmpid" link="fulltext">15188375</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat</p>
            </title>
            <aug>
               <au>
                  <snm>Tarlow</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Blakemore</snm>
                  <fnm>AI</fnm>
               </au>
               <au>
                  <snm>Lennard</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Solari</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hughes</snm>
                  <fnm>HN</fnm>
               </au>
               <au>
                  <snm>Steinkasserer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Duff</snm>
                  <fnm>GW</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>1993</pubdate>
            <volume>91</volume>
            <fpage>403</fpage>
            <lpage>404</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00217368</pubid>
                  <pubid idtype="pmpid">8500797</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Influence of interleukin-1 receptor antagonist gene polymorphism on disease</p>
            </title>
            <aug>
               <au>
                  <snm>Witkin</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Gerber</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ledger</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>34</volume>
            <fpage>204</fpage>
            <lpage>209</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/338261</pubid>
                  <pubid idtype="pmpid" link="fulltext">11740709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Interleukin-18</p>
            </title>
            <aug>
               <au>
                  <snm>Gracie</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Robertson</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>McInnes</snm>
                  <fnm>IB</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>2003</pubdate>
            <volume>73</volume>
            <fpage>213</fpage>
            <lpage>224</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1189/jlb.0602313</pubid>
                  <pubid idtype="pmpid" link="fulltext">12554798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Administration of exogenous interleukin-18 and interleukin-12 prevents the induction of oral tolerance</p>
            </title>
            <aug>
               <au>
                  <snm>Eaton</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Garside</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Immunology</source>
            <pubdate>2003</pubdate>
            <volume>108</volume>
            <fpage>196</fpage>
            <lpage>203</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2567.2003.01570.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12562328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Enhanced interleukin-18 levels in the peripheral blood of children with coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lettesjo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hansson</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bergqvist</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gronlund</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dannaeus</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2005</pubdate>
            <volume>139</volume>
            <fpage>138</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2249.2005.02661.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15606624</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Regulation of IL-18 (IFN-gamma-inducing factor) gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Tone</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Tone</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Fairchild</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Waldmann</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1997</pubdate>
            <volume>159</volume>
            <fpage>6156</fpage>
            <lpage>6163</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9550417</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation</p>
            </title>
            <aug>
               <au>
                  <snm>Giedraitis</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>WX</fnm>
               </au>
               <au>
                  <snm>Hillert</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Neuroimmunol</source>
            <pubdate>2001</pubdate>
            <volume>112</volume>
            <fpage>146</fpage>
            <lpage>152</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0165-5728(00)00407-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">11108943</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Polymorphism in RANTES chemokine promoter affects HIV-1 disease progression</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Chao</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nakayama</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Taguchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Xin</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Takamatsu</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Saito</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ishikawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Akaza</snm>
                  <fnm>T</fnm>
               </au>
               <etal/>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>4581</fpage>
            <lpage>4585</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">16375</pubid>
                  <pubid idtype="pmpid" link="fulltext">10200305</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.8.4581</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Chemokine RANTES promoter polymorphism affects risk of both HIV infection and disease progression in the Multicenter AIDS Cohort Study</p>
            </title>
            <aug>
               <au>
                  <snm>McDermott</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Beecroft</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kleeberger</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Al-Sharif</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Ollier</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Zimmerman</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Boatin</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Leitman</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Detels</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hajeer</snm>
                  <fnm>AH</fnm>
               </au>
               <etal/>
            </aug>
            <source>Aids</source>
            <pubdate>2000</pubdate>
            <volume>14</volume>
            <fpage>2671</fpage>
            <lpage>2678</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00002030-200012010-00006</pubid>
                  <pubid idtype="pmpid" link="fulltext">11125885</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression</p>
            </title>
            <aug>
               <au>
                  <snm>Rovin</snm>
                  <fnm>BH</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Saxena</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1999</pubdate>
            <volume>259</volume>
            <fpage>344</fpage>
            <lpage>348</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1999.0796</pubid>
                  <pubid idtype="pmpid" link="fulltext">10362511</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Revised criteria for diagnosis of coeliac disease. Report of Working Group of European Society of Paediatric Gastroenterology and Nutrition</p>
            </title>
            <source>Arch Dis Child</source>
            <pubdate>1990</pubdate>
            <volume>65</volume>
            <fpage>909</fpage>
            <lpage>11</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2205160</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Absence of a genetic association between IL-1RN and IL-1B gene polymorphisms in ulcerative colitis and Crohn disease in multiple populations from northeast England</p>
            </title>
            <aug>
               <au>
                  <snm>Craggs</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>West</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Curtis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Welfare</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hudson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Donaldson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mansfield</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Scand J Gastroenterol</source>
            <pubdate>2001</pubdate>
            <volume>36</volume>
            <fpage>1173</fpage>
            <lpage>1178</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/00365520152584806</pubid>
                  <pubid idtype="pmpid">11686217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Methods and software for association tests of uncertain haplotypes in case-parent trios</p>
            </title>
            <aug>
               <au>
                  <snm>Dudbridge</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2002</pubdate>
            <volume>71</volume>
            <issue>Suppl</issue>
            <fpage>A2338</fpage>
            <url>http://portal.litbio.org/Registered/Webapp/glue/</url>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Candidate gene association analysis for a quantitative trait, using parent-offspring trios</p>
            </title>
            <aug>
               <au>
                  <snm>Gauderman</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Genet Epidemiol</source>
            <pubdate>2003</pubdate>
            <volume>25</volume>
            <fpage>327</fpage>
            <lpage>338</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/gepi.10262</pubid>
                  <pubid idtype="pmpid" link="fulltext">14639702</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>A rare polymorphism at position -28 in the human RANTES promoter</p>
            </title>
            <aug>
               <au>
                  <snm>al Sharif</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ollier</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Hajeer</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Eur J Immunogenet</source>
            <pubdate>1999</pubdate>
            <volume>26</volume>
            <fpage>373</fpage>
            <lpage>374</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2370.1999.00162.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10553504</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>A polymorphism at position -403 in the human RANTES promoter</p>
            </title>
            <aug>
               <au>
                  <snm>Hajeer</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>al Sharif</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ollier</snm>
                  <fnm>WE</fnm>
               </au>
            </aug>
            <source>Eur J Immunogenet</source>
            <pubdate>1999</pubdate>
            <volume>26</volume>
            <fpage>375</fpage>
            <lpage>376</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2370.1999.00163.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10553505</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Systemic lupus erythematosus and genetic variation in the interleukin 1 gene cluster: a population based study in the southeastern United States</p>
            </title>
            <aug>
               <au>
                  <snm>Parks</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Dooley</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Treadwell</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>St Clair</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Gilkeson</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Pandey</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Ann Rheum Dis</source>
            <pubdate>2004</pubdate>
            <volume>63</volume>
            <fpage>91</fpage>
            <lpage>94</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1136/ard.2003.007336</pubid>
                  <pubid idtype="pmpid" link="fulltext">14672899</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The interleukin 1 gene cluster contains a major susceptibility locus for ankylosing spondylitis</p>
            </title>
            <aug>
               <au>
                  <snm>Timms</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Crane</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Sims</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Cordell</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Bradbury</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Abbott</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Coyne</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Beynon</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Herzberg</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Duff</snm>
                  <fnm>GW</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2004</pubdate>
            <volume>75</volume>
            <fpage>587</fpage>
            <lpage>595</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/424695</pubid>
                  <pubid idtype="pmpid" link="fulltext">15309690</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Interleukin 1 genotypes in multiple sclerosis and relationship to disease severity</p>
            </title>
            <aug>
               <au>
                  <snm>Mann</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Stevenson</snm>
                  <fnm>VL</fnm>
               </au>
               <au>
                  <snm>Leary</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Boggild</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Ko Ko</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Fryer</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Strange</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>AJ</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Neuroimmunol</source>
            <pubdate>2002</pubdate>
            <volume>129</volume>
            <fpage>197</fpage>
            <lpage>204</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0165-5728(02)00181-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">12161036</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Relationship of polymorphisms of the Interleukin-1 gene cluster to occurrence and severity of rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Kaijzel</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>van Dongen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bakker</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Breedveld</snm>
                  <fnm>FC</fnm>
               </au>
               <au>
                  <snm>Huizinga</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Verweij</snm>
                  <fnm>CL</fnm>
               </au>
            </aug>
            <source>Tissue Antigens</source>
            <pubdate>2002</pubdate>
            <volume>59</volume>
            <fpage>122</fpage>
            <lpage>126</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1399-0039.2002.590208.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12028539</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Association of interleukin-18 gene promoter polymorphisms in type 1 diabetes and autoimmune thyroid disease</p>
            </title>
            <aug>
               <au>
                  <snm>Ide</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kawasaki</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Abiru</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Fukushima</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ishii</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Takahashi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kuwahara</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fujita</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kita</snm>
                  <fnm>A</fnm>
               </au>
               <etal/>
            </aug>
            <source>Ann N Y Acad Sci</source>
            <pubdate>2003</pubdate>
            <volume>1005</volume>
            <fpage>436</fpage>
            <lpage>439</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1196/annals.1288.074</pubid>
                  <pubid idtype="pmpid" link="fulltext">14679107</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Interleukin IL-18 gene promoter polymorphisms in adult patients with type 1 diabetes mellitus and latent autoimmune diabetes in adults</p>
            </title>
            <aug>
               <au>
                  <snm>Novota</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kolostova</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pinterova</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Novak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Treslova</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Andel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cerna</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Immunol Lett</source>
            <pubdate>2005</pubdate>
            <volume>96</volume>
            <fpage>247</fpage>
            <lpage>251</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.imlet.2004.08.016</pubid>
                  <pubid idtype="pmpid" link="fulltext">15585330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>RANTES promoter genotype is associated with diabetic nephropathy in type 2 diabetic subjects</p>
            </title>
            <aug>
               <au>
                  <snm>Nakajima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nomiyama</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ogihara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ikeda</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kanno</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Iwashita</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sakai</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Watada</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Onuma</snm>
                  <fnm>T</fnm>
               </au>
               <etal/>
            </aug>
            <source>Diabetes Care</source>
            <pubdate>2003</pubdate>
            <volume>26</volume>
            <fpage>892</fpage>
            <lpage>898</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12610055</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Polymorphisms in the promoter region of RANTES and the regulatory region of monocyte chemoattractant protein-1 among Chinese children with systemic lupus erythematosus</p>
            </title>
            <aug>
               <au>
                  <snm>Liao</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Yao</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Chung</snm>
                  <fnm>HT</fnm>
               </au>
               <au>
                  <snm>See</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Kuo</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>2004</pubdate>
            <volume>31</volume>
            <fpage>2062</fpage>
            <lpage>2067</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15468376</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Strong association of a functional polymorphism in the monocyte chemoattractant protein 1 promoter gene with lupus nephritis</p>
            </title>
            <aug>
               <au>
                  <snm>Tucci</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barnes</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Sobel</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Croker</snm>
                  <fnm>BP</fnm>
               </au>
               <au>
                  <snm>Segal</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Reeves</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>HB</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>1842</fpage>
            <lpage>1849</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20266</pubid>
                  <pubid idtype="pmpid" link="fulltext">15188361</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>The polymorphism of monocyte chemoattractant protein-1 is associated with the renal disease of SLE</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Chung</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>YS</fnm>
               </au>
            </aug>
            <source>Am J Kidney Dis</source>
            <pubdate>2002</pubdate>
            <volume>40</volume>
            <fpage>1146</fpage>
            <lpage>1152</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1053/ajkd.2002.36858</pubid>
                  <pubid idtype="pmpid" link="fulltext">12460032</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>RANTES: a genetic risk marker for multiple sclerosis</p>
            </title>
            <aug>
               <au>
                  <snm>Gade-Andavolu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Comings</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>MacMurray</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vuthoori</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Tourtellotte</snm>
                  <fnm>WW</fnm>
               </au>
               <au>
                  <snm>Nagra</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Cone</snm>
                  <fnm>LA</fnm>
               </au>
            </aug>
            <source>Mult Scler</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>536</fpage>
            <lpage>539</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1191/1352458504ms1080oa</pubid>
                  <pubid idtype="pmpid" link="fulltext">15471370</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>RANTES gene polymorphism in polymyalgia rheumatica, giant cell arteritis and rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Makki</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>al Sharif</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gonzalez-Gay</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Garcia-Porrua</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ollier</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Hajeer</snm>
                  <fnm>AH</fnm>
               </au>
            </aug>
            <source>Clin Exp Rheumatol</source>
            <pubdate>2000</pubdate>
            <volume>18</volume>
            <fpage>391</fpage>
            <lpage>393</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10895380</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Gluten induces an intestinal cytokine response strongly dominated by interferon gamma in patients with celiac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Nilsen</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Jahnsen</snm>
                  <fnm>FL</fnm>
               </au>
               <au>
                  <snm>Lundin</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Johansen</snm>
                  <fnm>FE</fnm>
               </au>
               <au>
                  <snm>Fausa</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Sollid</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Jahnsen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Brandtzaeg</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Gastroenterology</source>
            <pubdate>1998</pubdate>
            <volume>115</volume>
            <fpage>551</fpage>
            <lpage>563</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9721152</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>A functional variant of IFNgamma gene is associated with coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Rueda</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Martinez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lopez-Nevot</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Mas-Fontao</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Paco</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Ortega</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fernandez-Arquero</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Urcelay</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gomez de la Concha</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2004</pubdate>
            <volume>5</volume>
            <fpage>517</fpage>
            <lpage>519</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364115</pubid>
                  <pubid idtype="pmpid" link="fulltext">15215891</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>The IL12B gene does not confer susceptibility to coeliac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Louka</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Torinsson Naluai</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>D'Alfonso</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ascher</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Coto</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Ek</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Giordano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gudjonsdottir</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Mellai</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Momigliano-Richiardi</snm>
                  <fnm>P</fnm>
               </au>
               <etal/>
            </aug>
            <source>Tissue Antigens</source>
            <pubdate>2002</pubdate>
            <volume>59</volume>
            <fpage>70</fpage>
            <lpage>72</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1399-0039.2002.590117.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11972887</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>IL12B and IRF1 gene polymorphisms and susceptibility to celiac disease</p>
            </title>
            <aug>
               <au>
                  <snm>Seegers</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Borm</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>van Belzen</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Mulder</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Bailing</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Crusius</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Meijer</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Wijmenga</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pena</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Bouma</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Eur J Immunogenet</source>
            <pubdate>2003</pubdate>
            <volume>30</volume>
            <fpage>421</fpage>
            <lpage>425</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2370.2003.00428.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14675396</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Celiac disease and TNF promoter polymorphisms</p>
            </title>
            <aug>
               <au>
                  <snm>de la Concha</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Fernandez-Arquero</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vigil</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rubio</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Maluenda</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Polanco</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Figueredo</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Hum Immunol</source>
            <pubdate>2000</pubdate>
            <volume>61</volume>
            <fpage>513</fpage>
            <lpage>517</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0198-8859(99)00187-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">10773355</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Cytokine gene polymorphisms and genetic association with coeliac disease in the Finnish population</p>
            </title>
            <aug>
               <au>
                  <snm>Woolley</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mustalahti</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Maki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Partanen</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Scand J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>61</volume>
            <fpage>51</fpage>
            <lpage>56</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.0300-9475.2005.01525.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15644122</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
      <sec>
         <st>
            <p>Pre-publication history</p>
         </st>
         <p>The pre-publication history for this paper can be accessed here:</p>
         <p>
            <url>http://www.biomedcentral.com/1471-2350/6/29/prepub</url>
         </p>
      </sec>
   </bm>
</art>
