In order to examine possible localization of the YFP-tail fusions to mitochondria, peroxisomes, and Golgi bodies, we needed constructs expressing fluorescent proteins known to localize to these compartments. Previously we had shown that a yeast coxIV transit sequence fused to GFP resulted in specific labeling of mitochondria 2. For specific labeling of Golgi bodies, we obtained the ERD2::GFP construct that Boevink et al 22 used to describe the remarkable motility of plant Golgi stacks. In order to label perixosomes, we decided to make fusions of a peroxisomal resident enzyme, catalase, which has the uncleavable tripeptide of the PTS1 (Peroxisomal Targeting Signal 1) at the C-terminus 2324. We produced N-terminal YFP or DsRed2 fusion genes with At catalase 2. After transient expression, both YFP::catalase2 and DsRed2::catalase2 constructs did label peroxisomes in onion cells (Figure 1A) as well as in tobacco leaves, as expected (Figure 1B, C). The labeled peroxisomes exhibited motility [see Additional Files 1 and 2] similar to that previously observed in Arabidopsis plants expressing the PST1 signal fused to GFP 525.

To obtain myosin tail sequences, cDNA for myosin XI-5 (At MYA1), myosin XI-6 (At MYA2), myosin XI-8 (At XI-B), myosin XI-15 (At XI-I), myosin XI-16 (At XI-J) and myosin XI-17 (At XI-K) was obtained from Arabidopsis thaliana Columbia leaves by RT-PCR. Sequencing of two cDNAs for each gene confirmed that the gene model in Genbank was correct (data not shown). A few cDNAs exhibited minor nucleotide alterations, likely PCR errors, that did not affect the amino acid sequence. We did not detect any alternative splicing; however, more thorough studies using transcripts from a variety of tissues will be needed to determine whether these genes' transcripts exist in multiple forms.

Amino acid alignment of the predicted tail sequence from the six cloned myosin tails shows a number of regions with high sequence identity (Figure 2A). Five of the 6 myosins exhibit significant sequence identity in the so-called "dilute" domain. The tail of myosin XI-16 is the shortest and lacks the dilute domain entirely (Figure 2A). On a phylogenetic tree based on full length Arabidopsis myosin alignments, Reddy and Day showed myosin XI-5 (At MYA1) and myosin XI-17 (At XI-K) are closely related and myosin XI-6 (At MYA2) and myosin XI-8 (At XI-B) also group together, while myosin XI-16 (At XI-J) and myosin XI-15 (At XI-I) are more diverged 15. When we compare the amino acid sequences of the tail regions of the 6 myosins we have investigated, we note that the same two myosins within each of two pairs exhibit the highest similarity to one another (Figure 2B). Myosin XI-15 is more similar to the myosinXI-17/XI-5 pair than to the other myosins (Figure 2B).

We designed YPF fusion constructs in Agrobacterium vector pEarlygate 104 for each of the six myosin tails. The myosin tail constructs were designed in such a way that the N-terminal actin binding motor domain and the neck domain containing the IQ motif would be missing and replaced by the fluorescent protein. In melanocytes, comparable EGFP-tail fusions result in specific labeling of melanosomes 26. The tail region in our constructs starts after the IQ motif and contains a coiled-coil region as well as a "dilute" domain near the C-terminus. The constructs were either transiently expressed in onion cells or in A. thaliana leaves by bombardment, or in tobacco leaves by agroinfiltration. 24 h after bombardment or 48 h after Agrobacterium infiltration, a yellow fluorescent signal was observed in the cells of the transformed tissues (Figure 3). The fluorescent signal was present in small vesicular structures. While only a few such vesicles are evident in some of the images of a single plane of the cell, they are quite numerous in most cells, as can be seen in a full projection view of several confocal z-stack sections from myosin XI-5-tail expressing tobacco leaf cells (Figure 3A). The fluorescent vesicles vary in size, with measurements revealing that they are between 0.5 – 3 μm in diameter. Thus their size is in the same range as the size of Golgi, mitochondria and peroxisomes, but smaller than chloroplasts and the non-green plastids in onion epidermal cells.

The labeled vesicles were observed to be motile in most cells examined [see Additional files 3, 4, 5, 6]. In other systems, expression of defective myosins lacking a functional motor domain results in cessation of movement of the normal cargo carried by the particular myosin, a dominant negative phenotype 27. Evidently the abnormal YFP-tail myosin is not able to affect the function of a motor that can operate on the fluorescent organelle. If the fusion protein is unable to dimerize with an endogenous myosin and thereby destroy its function, then motility would be expected. Perhaps, unexpectedly, the fusion protein cannot dimerize with its homologous wild-type myosin through the coiled-coil domain but is still able to bind a cargo. The number of molecules of YFP-myosin present through transient expression may not be high enough to dimerize with most wild-type myosins to create a dominant-negative effect. Alternatively, the YFP-truncated myosin may be interacting with subcellular structures to which the wild-type myosin does not normally adhere. Another explanation is that that more than one class XI myosin is responsible for moving the same cargo. A further possible reason for the continued movement of the unidentified vesicles is that other motors move the same vesicle on microtubules; use of both the microfilaments and microtubules for motility has been reported for both Golgi stacks 28 and chloroplasts 9. In animals, melanosomes are moved by both microtubule and actin motors 29. However, the mobility of plant peroxisomes is prevented by actin and myosin inhibitors 56, so the continued movement of these organelles cannot be explained by use of microtubule motors.

The average speed of the mobile vesicular structures and the length of the average track on which the organelles move differs depending on cell type and particular YFP-myosin expressed (Figure 4). The onion epidermal cells are larger and more elongate in shape that most mesophyll cells, and it is evident that peroxisomes exhibit a greater speed and track length in the non-green epidermal vs. green leaf cells. The difference in average organelle track speed in mesophyll cells exhibited by structures labeled by YFP-myosin XI-6 vs. XI-15 and XI-17 suggests that the populations of organelles labeled by these three myosins are not identical. It is clear that all these populations exhibit higher mobility and track length than vesicular structures exhibiting Brownian movement (Figure 4).

In order to determine which myosin tail length would be sufficient for labeling of discrete structures, we designed four different constructs varying by their length (Figure 5). The constructs start either 1) at the half coiled-coil region, or 2) just after the coiled-coil region, or 3) at the half length of the tail, or 4) just before the "dilute" domain. The C-terminus was kept intact in the deletion constructs because studies have shown that mouse MyoVa lacking the C-terminus was unable to co-localize with melanosomes in melanocytes 21. The amino-acid position of each domain was obtained by searching the Pfam database 30. Deletion constructs were made for Myosin XI-5 (At MYA1), Myosin XI-6 (At MYA2), Myosin XI-15 (At XI-I) and Myosin XI-17 (At XI-K).

After agroinfiltration, no major organelle targeting was obtained with any YFP-dilute construct (Figure 6O–R) as compared to full-length tail constructs (Figure 6A–D). The fluorescent signal with the globular dilute domain constructs was primarily in the cytoplasm. Proteins expressed from C half-tail fusion constructs also were usually not specifically targeted to organelles (Figure 6K–N). Sometimes a few punctate structures were labeled (Figure 6K, 6M), but the labeled entities did not move as freely as those observed after labeling with the complete tail constructs (data not shown). Myosin XI-6 and XI-17 YFP fusions without the coiled-coil domain were usually able to label vesicles (Figure 6H–J), but myosin XI-15 (At XI-I) without the coiled-coil region resulted in unspecific cytoplasmic labeling (Figure 6I). While myosin XI-5 and myosin XI-6 YFP fusions lacking half the coiled-coil region still labeled vesicles (Figure 6B, 6C), myosin XI-15 YFP 1/2-tail fusions resulted in only labeling of vesicles in very few cells (Figure 6G). For myosin XI-15, evidently the complete coiled-coil domain is necessary for targeting to a cargo. As observed with the full-length YFP-tail fusions, movement of the organelles occurred when they were labeled with half-coil and no-coil constructs [see Additional file 7].

While the shape and size of the labeled structures following transient YFP-tail expression eliminated chloroplasts and non-green plastids from further consideration, the labeled structures were in the size range of Golgi bodies, mitochondria or peroxisomes. We transiently co-expressed fluorescent proteins known to label these compartments in order to determine whether any myosin XI-labeled compartments corresponded to these 3 organelle types. We expressed either the catalase::DsRed2 construct for peroxisomes, coxIV::GFP 2 for mitochondria, and ERD2::GFP 22 for Golgi labeling. Figures 7, 8, 9 show the result of the co-localization experiments for the six studied myosins.

For Myosin XI-6, the "nocoil" construct was expressed rather than the full tail region, because for unknown reasons, the shorter construct produced more consistent labeling. YFP::Myosin XI-6-nocoil (Figure 7B) co-localized with the peroxisomal catalase::DsRed2 marker but not with the mitochondrial or Golgi body marker. The YFP::Myosin XI-5-tail (Figure 7A), YFP::Myosin XI-8-tail (Figure 8A) and YFP::Myosin XI-15-tail (Figure 8B) do not co-localize with any of the markers. YFP::Myosin XI-16-tail did not co-localize with the peroxisome marker, but slight overlaps were observed with the mitochondrial and Golgi markers (Figure 9A). We did not detect any conclusive co-localization with any marker for YFP::Myosin XI-17-tail (Figure 9B), though occasionally there were a few slight overlaps with Golgi stacks.

The co-localization of YPF::myosin XI-6-nocoil confirms the finding that this myosin interacts with peroxisomes, as previously reported in studies using anti-MYA2 (XI-6) antibodies in transgenic Arabidopsis plants expressing a GFP-tagged peroxisomal targeting signal peptide 31. None of the other five myosin constructs tested co-localized with this peroxisome marker. The overlap of the signal of YFP::myosin XI-16-tail with the Golgi and mitochondrial markers is suggestive but not entirely conclusive, because YFP and GFP are difficult to separate due to overlapping excitation peaks. Further studies with additional control fluorescent protein fusions need to be undertaken in order to verify whether YFP::myosin XI-16 interacts with Golgi bodies and mitochondria. Nevertheless, our experiments do show that motile vesicles are reproducibly labeled with myosin YFP-tail fusions. The identity of these vesicles can be further probed in the future through co-localization with proteins and dyes known to label various compartments involved in vesicular transport processes.

Instead of the reproducible organelle labeling seen in most experiments, on rare occasions we observed long filamentous structures with the characteristic appearance of actin filaments (Figure 10A, 10C). The linear structures were similar to actin microfilaments found in GFP-FABD2 expressing Arabidopsis seedlings 32 or GFP-talin cells 33. Such labeling was unexpected because the actin-binding motor domain is missing in the fusion proteins. However, if heterodimerization between the YFP::myosin-tail fusions and endogenous myosins sometimes occurs, then perhaps the myosin heterodimer could interact with actin filaments, resulting in labeling. Perhaps the rare cells giving filamentous structures were expressing unusually high amounts of the YFP-tail fusion proteins. Because the proteins are being expressed transiently from T-DNA following agroinfilitration, different cells are likely to accumulate different amounts of the YFP-myosin proteins.

Not all linear structures appeared similar to microfilaments. Sometimes we observed short linear structures (Figure 10B, 10D) that appeared more similar to microtubules than microfilaments 34. Usually a myosin would not be expected to react with microtubules. However, there is evidence that motors sometimes link the actin and tubulin cytoskeleton. The Drosophila myosin VI interacts with a microtubule plus-end-binding protein 3536. Even though peroxisomes move on microfilaments 37, the plant peroxisomal multifunctional protein was shown to bind cortical microtubules in vitro, and peroxisomes and microtubules were observed to interact 38. In CHO cells, peroxisome association with microtubules was also described 39. Thus, for unknown reasons, perhaps the myosin XI YFP-tail constructs can sometimes interact with microtubules.

Arabidopsis thaliana cv Columbia leaf RNA extraction was performed using RNeasy Plant Mini Kit (Quiagen) followed by reverse transcription using Omniscript reverse transcriptase (Qiagen) with an oligo-dT₁₇ primer. Myosin XI tails were amplified by PCR using the Taq PCR Master Mix Kit (Quiagen) with the following primer pairs:

For Myosin XI-5 (At MYA1; AT1g17580): Myo5fwd 5'GCTTAGAATGCTGAAAATGGCTGC3' and Myo5rev 5'GGATCTGACCTTTCCAACAAGAAC3';

For Myosin XI-6 (At MYA2; AT5g43900): Myo6fwd 5'GCTTAAGATGGCTGCTAGAG3'and Myo6rev 5'AGTGCAAGAATACAAATGCTGG3';

For Myosin XI-8 (At XIB; AT1g04160): Myo8fwd 5'CTTAAGATGGCTGCTCGAG3'and Myo8rev 5'AGTGCAAGAATACGAATTC3';

For Myosin XI-15 (At XI-I; AT4g33200): Myo15fwd 5'CTTAAACAGGTTGCTAATGAAGC3' and Myo15rev 5'TCAAATGATCTGCTTTGAGGTTG3';

For Myosin XI-16 (At XIJ; AT3g58160): Myo16fwd 5'TCAAAGCAGGCTGACAGAA3' and Myo16rev 5'TCAAAAGTAATCTTCGAAGCCC3';

For Myosin XI-17 (At XIK; AT5g20490): Myo17fwd 5'CGCACGAGACACAGGAGCCCTTA3' and Myo17 rev 5'GGCGATGTACTGCCTTCTTTACG3'.

PCR products were cloned into a pCR2.1-TOPO T/A vector (Invitogen) and sequenced. Cloned myosin tails and cropped tail constructs were further PCR amplified with primers (Table 1) allowing GATEWAY directional cloning using AccuPrime™ Pfx DNA Polymerase (Invitogen). PCR products were cloned into a pENTR/D TOPO vector (Invitrogen), and LR clonase reactions between the entry vectors and the destination vector pEarleyGate104 40 were performed according to manufacturer's instructions (Invitrogen). pENTR/D vectors containing the genes of interest were digested with MluI prior the LR reaction.

At Catalase 2 cDNA (At4g35090) was obtained by RT-PCR using the following primer pairs: 5'ATGGATCCTTACAAGTATCGTC3' and 5'CTAGATGCTTGGCCTCACG3'. The PCR product was cloned into a pCR2.1-TOPO T/A vector (Invitogen), and sequenced. The gene was then amplified with the following primers for allowing a directional cloning into the pENTR/D TOPO vector (Invitrogen): 5'CACCGATCCTTACAAGTATCGTC3' and 5'TTAGATGCTTGGTCTCACG3'. The gene was fused to YFP in the pEarleyGate104 40 by LR reaction (Invitrogen). The catalase cDNA was also fused downstream of DsRed2 in the binary pGDR vector 41 by using the KpnI restriction site. Primers containing KpnI restriction sites (bold) were used: 5'GGGGTACCATGGATCCTTACA3' and 5'GGGGTACCTAGATGCTTGGTC3'. The purified PCR product was digested by KpnI and cloned into the KpnI linearized and dephosphorylated pGDR vector using T4 ligase (Invitrogen). Positive clones were screened by digestion profile and confirmed by sequencing.

Myosin tail sequences were aligned by using MultAlign 42, and edited with GeneDoc 43. Coiled-coil regions were predicted with COILS 44 in the SMART module 4546 and "dilute" domains were identified with Pfam 30. Amino acid similarity tree (cladogram) was made in Megalign (DNAStar) with the Clustal W method.

Onion cells or Arabidopsis thaliana leaves were bombarded with plasmid-coated tungsten particles using a Model PDS 1000/He Biolistic Particle Delivery System™ (BioRad, Hercules, CA, USA) according to manufacturer's instructions. Plasmid DNA (2 μg for each shot) was precipitated on tungsten particles, and onion or A. thaliana epidermal cells were bombarded twice. The expression was observed 24 h after bombardment.

Agrobacterium-mediated transient expression was performed as previously described 47. Briefly, the binary GATEWAY-plasmid vectors were transformed by electroporation into A. tumefaciens strain C58C1 carrying the virulence helper plasmid pCH32 48. The transformants were inoculated into 5 ml LB medium supplemented with 50 μg ml^-1 kanamycin and 5 μg ml^-1 tetracycline and grown at 28°C overnight. Cells were precipitated and resuspended to an OD of 0.5 in solution containing 10 mm MgCl₂, 10 mm MES pH 5.6 and 150 μm acetosyringone. The cells were left at room temperature on the bench for 2 h before infiltration into N. bentamiana leaves. Observation was done 48 h after infiltration.

Confocal microscopy was performed on a Leica DMRE-7 (SDK) microscope equipped with a TCS-SP2 confocal scanning head (Leica Microsystems Inc., Bannockburn, IL, USA). Images were collected with a Leica 63 × HCX PL APO water immersion objective (NA = 1.20). YFP was excited at 514 nm with an ArKr laser, and emission was detected between 525 and 625 nm. Chlorophyll was excited at 488 nm with an ArKr laser and emission was detected between 640 and 715 nm. DsRed was excited at 514 with an ArKr laser or at 543 nm with a GreNe laser and emission was detected between 563 and 660 nm. GFP was excited at 488 with an ArKr laser and emission was detected between 498 and 515 nm. For co-localization experiments, images were sequentially collected in order to minimize cross-talk of GFP and YFP. For time lapse series YFP and chlorophyll were both excited at 488 nm and pictures were collected without frame averages. Organelle motility was measured with the ImarisTrack module from the Image Analyzing Software Imaris 5.0 (Bitplane AG, Zurich, Switzerland). Labeled organelles were detected with the spot function and tracks were analyzed by using the autoregressive motion algorithm. Brownian movement was tracked with the Brownian motion algorithm.