<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2229-3-4</ui>
   <ji>1471-2229</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Developmental gene regulation during tomato fruit ripening and <it>in-vitro</it> sepal morphogenesis</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Bartley</snm>
               <mi>E</mi>
               <fnm>Glenn</fnm>
               <insr iid="I1"/>
               <email>geb@pw.usda.gov</email>
            </au>
            <au id="A2">
               <snm>Ishida</snm>
               <mi>K</mi>
               <fnm>Betty</fnm>
               <insr iid="I1"/>
               <email>bkishida@pw.usda.gov</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Western Regional Research Center, United States Department of Agriculture, Agricultural Research Service, 800 Buchanan Street, Albany, CA 94710, USA</p>
            </ins>
         </insg>
         <source>BMC Plant Biology</source>
         <issn>1471-2229</issn>
         <pubdate>2003</pubdate>
         <volume>3</volume>
         <issue>1</issue>
         <fpage>4</fpage>
         <url>http://www.biomedcentral.com/1471-2229/3/4</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">12906715</pubid>
               <pubid idtype="doi">10.1186/1471-2229-3-4</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>16</day>
               <month>4</month>
               <year>2003</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>07</day>
               <month>8</month>
               <year>2003</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>07</day>
               <month>8</month>
               <year>2003</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2003</year>
         <collab>Bartley and Ishida; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22&#176;C turn red and swell like ripening tomato fruit while those at 28&#176;C remain green.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during <it>in vitro </it>sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to <it>RIN </it>and <it>PSY1</it>, ripening-associated genes, and others show quite different expression.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Red ripe (RR) tomatoes, appealing to the eye as well as the palate, are the result of numerous physiological changes controlled by hormonal, environmental, and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect the visual, textural, flavor, and aroma characteristics to make fruit more appealing to potential consumers for dispersal of seed. One hormonal cue, ethylene evolution, active at the onset of the respiratory burst during ripening in this climacteric fruit, has been scrutinized in detail over the years <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Transgenic tomato plants, expressing antisense genes for ethylene biosynthesis enzymes, show that ethylene is necessary for tomato fruit ripening <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. However, something must signal ethylene induction before the climacteric ethylene burst. Because 1-aminocyclopropane-1-carboxylic acid synthase (ACCS), an enzyme involved in ethylene biosynthesis, is induced before the onset of ethylene evolution, it seems reasonable to assume that other factors control early developmental stages of ripening fruit <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. <it>E8</it>, a gene of unknown function, is expressed in the <it>rin </it>mutant, which does not exhibit the climacteric burst of ethylene evolution <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Thus, at least two genes that are not controlled by ethylene are expressed during fruit ripening.</p>
         <p>Developmental regulation of tomato fruit ripening has, until recently, been lacking rigorous investigation <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Transcription factors are crucial in many aspects of plant and animal development, as well as participating in plant responses to stress and environmental cues <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Transcriptional regulators have also been implicated as important elements of evolution and natural variation in plants <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. Maize evolved from teosinte due at least in part to a mutation in the regulatory region of <it>teosinte branched1 </it>(<it>tb1</it>), the gene responsible for branch length. A nucleotide polymorphism was found in the regulatory region of this gene, not in the coding region of the predicted protein <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Tomato fruit size variation is thought to result from changes in gene regulation involving a quantitative trait locus <it>fw2.2</it>, which contains an open reading frame <it>ORFX </it><abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. <it>ORFX </it>is more abundant in smaller fruited tomato, suggesting <it>ORFX </it>may encode a negative regulator of fruit size <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Fruit shape is affected by a new type of regulatory gene, <it>OVATE</it>, which was found by chromosome walking to the <it>OVATE </it>quantitative trait locus (QTL)<abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. A single mutation in this gene causes a change in tomato fruit shape from round to pear-shaped <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. One transcription factor, a MADS-Box gene <it>RIN</it>, is directly involved in tomato fruit ripening, and another, the tomato homolog of the <it>Arabidopsis </it>flower organ-identity gene <it>AGAMOUS</it>, <it>TAG1</it>, is up-regulated during fruit ripening and in-vitro sepal ripening at cool temperatures <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. With the explosive increase in nucleotide sequence information in EST databases and new technologies such as microarray analysis, it should now be possible to delve more deeply into developmental processes of tomato fruit ripening. Sequence analysis of rice and <it>Arabidopsis thaliana </it>genomes indicates the number of putative transcription factors to be >1500 in <it>Arabidopsis </it>with similar numbers in rice and possibly tomato <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. In fact, a recent survey of the TIGR tomato EST databases revealed a number of possible ripening-associated transcription factors <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>A great deal of variation occurs among cultivars in the amount of lycopene accumulation in ripe tomato fruit. One survey of lycopene content reports a range from 0.21 to a very surprising 702.1 &#956;g/g FW <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. This surprisingly high content might have resulted from removal of inedible portions of fruit <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. VFNT Cherry (VC), a small-fruited tomato, contains 200 &#956;g/g FW lycopene in the ripe fruit, while Ailsa Craig (AC), a medium-fruited tomato, contains about 70.5 &#956;g/g FW lycopene <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. In our in-vitro system of VC sepal culture, green sepals kept between 16 and 22&#176;C swell and ripen, producing tomato fruit volatiles and accumulating lycopene <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Sepals kept at 28&#176;C remain green and do not accumulate lycopene. The carotenoid lycopene forms the red color of ripe tomato fruit and is also an antioxidant believed to help prevent some cancers including prostate cancer. In an effort to determine which of these transcription factors are important in tomato fruit ripening and in-vitro sepal ripening, we have characterized their regulation in ripening fruit of two different cultivars of tomato, VC and AC, and during in-vitro VC sepal culture at 16 and 28&#176;C.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Gene Expression During Sepal Morphogenesis</p>
            </st>
            <p>VC tomato sepals cultured <it>in vitro </it>at 16 &#8211; 22&#176;C switch their developmental program to that of ripening fruit <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. They swell, decrease in chlorophyll content, evolve ethylene, accumulate lycopene, and give off fruit volatiles <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. The RT-PCR results in Fig. <figr fid="F1">1</figr> indicate occurrence of a number of patterns of gene expression during in-vitro cultured sepals at 16&#176;C or 28&#176;C. In this experiment green sepals at day 0 were removed from the plant and cultured at 16 or 28&#176;C. After 2 days in culture, sepals were similar at both temperatures and remained green at 14 days but more swollen at both temperatures. At 24 days, sepals at 16&#176;C started to accumulate lycopene and were yellowish orange, while the sepals at 28&#176;C were still green. <it>PHYTOENE SYNTHASE 1 </it>(<it>PSY1</it>), a carotenoid biosynthesis enzyme, is highly regulated during tomato fruit ripening <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp> and was used here to indicate fruit ripening in cool temperature-treated sepals. Two <it>PHYTOENE SYNTHASE </it>genes are found in tomato, <it>PSY1 </it>and <it>PSY2</it>; it is known that <it>PSY1 </it>is the primary transcript in ripening tomato fruit <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. We have also shown in similar experiments that <it>PSY1 </it>is the primary transcript in ripened sepals (unpublished).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Images of RT-PCR reactions digitally captured using a BioRad gel doc system</p>
               </caption>
               <text>
                  <p>Images of RT-PCR reactions digitally captured using a BioRad gel doc system. The left column of images shows results from the cultured sepal experiment. Growth temperature and number of days in culture are at the top of the column. The right column shows images of results from fruit RT-PCR reactions. Cultivar and stage of the fruit are at the top of the column. Stages of the fruit are abbreviated: MG, mature green stage; TU, turning stage; RR, red ripe stage. <it>LeEF-1 </it>control at the bottom is the tomato <it>ELONGATION FACTOR 1</it>-&#945;..</p>
               </text>
               <graphic file="1471-2229-3-4-1"/>
            </fig>
            <p>One of the more dramatic and dominant expression patterns to emerge is that of <it>PSY1</it>, <it>TAG1</it>, <it>TM4</it>, <it>TM6</it>, (AP2-like) TC85031, TC85646, (YABBY2-like) TC89502, and TC84976. Transcripts for these genes are all induced by day 14 or 24 at 16&#176;C, while little or no change is seen in sepals cultured at 28&#176;C. Of these transcripts, <it>TAG1 </it>expression seemed the most dramatic with high expression at 16&#176;C and almost none in sepals cultured at 28&#176;C; other transcripts are induced at 16&#176;C, but also have a low basal level of expression at 28&#176;C with a slight increase at 24 days. <it>PSY1</it>, TC85031, TC89502, and TC85646 are all at least somewhat induced after 2 days at 16&#176;C. Previously Ishida et al. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> showed that <it>TAG1</it>, the tomato homolog of <it>AGAMOUS</it>, a MADS-Box gene involved in <it>Arabidopsis </it>flower development, was up-regulated during sepal morphogenesis and in ripening tomato fruit. Additionally, mRNA for POLYGALACTURONASE (PG) increased in cool temperature-treated sepals and ripening fruit. In fact, ectopic expression of <it>AGAMOUS </it>in tomato caused sepals on greenhouse-grown plants to swell and lose chlorophyll, and, upon placing these plants at 16 &#8211; 18&#176;C, the sepals accumulated lycopene <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B23">23</abbr></abbrgrp>. The fact that ectopic expression alone of <it>AGAMOUS </it>did not suffice for significant lycopene accumulation indicates a requirement for additional factors for this ripening process to occur. Other MADS-Box genes are induced in tomato flowers of plants subjected to 7&#176;C nights and 17&#176;C days <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. <it>TM4</it>, <it>TM5</it>, <it>TM6</it>, and <it>TAG1 </it>are all induced in tomato flowers of cool temperature-treated plants. Flowers of these plants exhibited homeotic and meristic transformations such as petaloid sepals and carpelloid stamens <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. These abnormalities could be related to the high expression of these genes <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. We have investigated a number of putative transcription factors by their expression during ripening <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> to gain a more complete understanding of processes contributing to cool temperature sepal morphogenesis. Our RT-PCR results show a number of promising candidates for ripening-related developmental regulators (Fig. <figr fid="F1">1</figr>). <it>TM4</it>, <it>TAG1</it>, and TC84976 are all induced during cool temperature growth and indeed are also up-regulated during fruit ripening. Our results here confirm previous results showing <it>TM4 </it>and <it>TAG1 </it>up-regulation during cool temperature growth <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B29">29</abbr></abbrgrp>. <it>TM6</it>, however, is induced by cool temperature, but down-regulated during fruit ripening. <it>TM5 </it>showed only slight induction after 14 days at 16&#176;C and did not show up in the TIGR database staged fruit collections.</p>
            <p>A second pattern indicated by these results is that of <it>RIN</it>, a recently discovered MADS-Box gene required for ripening of tomato fruit <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, which has an extremely interesting expression pattern during cool temperature culturing. This gene is induced sometime before 14 days of culture at both 16 and 28&#176;C (Fig. <figr fid="F1">1</figr>). While <it>RIN </it>is induced to a higher level at 16&#176;C, induction at 28&#176;C still seems to be significant and indicates perhaps the start of a developmental program induced by some other factor than cool temperature. However, this program at 28&#176;C does not include a large lycopene accumulation or <it>TAG1 </it>or <it>PG </it>up-regulation <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B15">15</abbr></abbrgrp>. One putative MADS-Box gene, TC92226, is up-regulated at the breaker-turning stage of fruit, but not detected in sepals by RT-PCR at the number of cycles used in this experiment.</p>
            <p>Homeobox genes encode transcription factors that contain a 60 amino acid motif, a DNA-binding structure called the homeodomain. Homeobox genes act in a number of developmental processes in plants <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. <it>Bell1 </it>(<it>BEL1</it>), a homeobox gene in <it>Arabidopsis</it>, affects ovule development <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. The BEL1 protein can interact with other transcription factors, specifically KNOX TALE homeodomain proteins, through conserved protein motifs, and these factors together activate transcription <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. TC85646 and TC89506 have 66 and 46 % similarity to <it>BEL1</it>at the amino acid level, respectively; however, their gene expression patterns differ (Fig. <figr fid="F1">1</figr>). TC85646 is induced at 16&#176;C by 24 days of culture, but TC89506 is induced at 28&#176;C by 14 days, continuing through 24 days. Whether these genes are suppressing or activating transcription of other genes needs further investigation.</p>
            <p>Zinc finger motif-containing, nucleic acid-binding proteins affect plant reproductive development <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. HUA1, a CCCH-type zinc-finger protein in <it>Arabidopsis</it>, regulates stamen and carpel identity and is an RNA-binding protein <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. We previously identified five putative HUA1-like transcripts of tomato by sequence-similarity searches in EST databases <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Transcripts TC87219 and TC86074 were investigated in these experiments, and only one, TC87219, was slightly induced in the 16&#176;C-cultured sepals. WRKY zinc-finger transcription factors, so named for the amino acid sequence WRKYGQK contained in the N-terminal region of their zinc finger motif, have been implicated primarily in defense responses of plants <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. However, one WRKY transcription factor in <it>Arabidopsis</it>, <it>TRANSPARENT TESTA GLABRA 2 </it>(<it>TTG2</it>), seems to be involved in trichome development <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. In our sepal experiment, only TC95361 was slightly induced at 16&#176;C after 24 days of culture.</p>
            <p>TC89502 is most similar to YABBY2, an <it>Arabidopsis </it>zinc-finger protein that belongs to a family of transcription factor proteins that contain a zinc finger and a helix-loop-helix domain, the YABBY domain, and specify abaxial cell fate <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Expression of this transcript was induced in cool temperature growth with no corresponding increase at 28&#176;C.</p>
            <p><it>MYB </it>genes contain DNA-binding, amino acid motifs similar to those found in <it>c-MYB</it>, the animal protooncogenic cellular counter part to <it>v-MYB</it>, the oncogenic component of avian myoblastoma virus <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. In <it>Arabidopsis </it>more than 92 MYB genes have been described <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. In plants, <it>MYB </it>genes regulate secondary metabolism, cell morphology, and signal transduction in plant growth and pathogen defense <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Fourteen <it>myb</it>-related cDNAs have been cloned and characterized from tomato by Lin et al. <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. We previously identified more than 136 putative MYB transcripts in the TIGR tomato EST database <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. We investigated one of these, TC85864, because of its expression in ripening tomato fruit. Our RT-PCR results in the sepal experiment indicate induction at 28&#176;C after 14 days of culture and no induction at 16&#176;C. The deduced protein for this transcript contains two MYB domains that closely resemble, 93 % similarity and 80 % identity, those of an <it>Arabidopsis </it>R2R3-MYB gene CAA74604. Further research is needed to determine the function of this transcription factor. However, in gene-disruption experiments, Meissner et al. <abbrgrp><abbr bid="B38">38</abbr></abbrgrp> found no obvious phenotypes in 32 homozygous insertion lines of 26 genes. Even more intensive greenhouse and plate-based screening failed to find a phenotype for most of these plants, possibly indicating redundancy <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>.</p>
            <p>Three putative polycomb genes identified in fruit collections of the TIGR database <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> were also investigated without much result in our sepal experiment (Fig. <figr fid="F1">1</figr>). Two transcripts were undetected at this number of PCR cycles, and the third showed little regulation. Polycomb proteins are thought to function by forming complexes with additional polycomb proteins to remodel chromatin and repress gene transcription <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>.</p>
            <p>One AP2 domain-containing gene previously identified as TC85031 was investigated with interesting results. The ABC model of floral development involves a system where class A gene expression specifies formation of sepals and in combination with a class B gene specifies petal formation. B and C gene expression together specifies stamen formation, and C expression alone specifies carpel identity <abbrgrp><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp>. In <it>Arabidopsis</it>, <it>APETALA2 </it>(<it>AP2</it>), a B function gene according to the ABC model, is antagonistic to <it>AG </it>and negatively regulates <it>AG </it>expression in sepals and petals <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Our RT-PCR results show that TC85031 is highly induced at 16&#176;C sometime before 24 days of growth. Expression of this <it>AP2</it>-like gene appears to mimic that of <it>TAG1</it>, and EST profiling indicates this gene is highly expressed in ripening tomato fruit <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. <it>AP2 </it>in <it>Arabidopsis </it>does not follow the same expression pattern of other floral organ identity genes as it is ubiquitously expressed in the floral organs of <it>Arabidopsis </it><abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. This <it>AP2</it>-like gene may not have the same function as the <it>Arabidopsis </it>gene. The possible ortholog of <it>AP2 </it>in petunia <it>PhAp2A </it>does complement the <it>Arabidopsis ap2-1 </it>mutant, but expression of <it>Arabidopsis AP2 </it>in petunia did not result in the expected phenotype <abbrgrp><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr></abbrgrp>. The TIGR tomato database lists another <it>AP2</it>-like transcript TC100241, which is not highly expressed in the tomato fruit, but is expressed in the flower. Perhaps TC100241 is the <it>Arabidopsis </it>flower homolog, while TC85031 may have a different function in the fruit.</p>
            <p>TC85295 is a transcript that codes for a protein very similar to WCOR413, a low temperature-induced protein in wheat (<it>Triticum aestivum</it>) <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. This transcript in tomato is also induced in our system after 14 days of cool temperature growth. The function of this protein is unknown, but sequence analysis indicates several trans-membrane helices, suggesting that it stabilizes the plasma membrane during cold stress <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>.</p>
            <p>Over all, we have shown that cool temperature sepal morphogenesis is complex with induced gene expression of MADS-Box genes, <it>TAG1</it>, <it>TM4</it>, and <it>TM6</it>, and possible developmental regulation of <it>RIN</it>, as well as expression of other genes, TC85031, TC84976, TC85646, and TC85295 whose specific functions are unknown. Two genes of unknown regulatory function, TC89506 and TC85864, were up-regulated at 28&#176;C. Further experiments are required to determine specific functions of these putative regulators.</p>
         </sec>
         <sec>
            <st>
               <p>RT-PCR of Genes Expressed During Fruit Development of Two Tomato Cultivars</p>
            </st>
            <p>Tomato fruit quality can be affected by many factors, genetic and environmental, pre- and post-harvest. Flavor and aroma volatiles differ from cultivar to cultivar and during ripening <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp>. Environmental and cultural factors can also affect the flavor of tomatoes <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Harvesting, handling, and post-harvest treatment may also affect fruit quality <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. A number of quantitative trait loci (QTLs) and genes are implicated in fruit size and shape of tomato <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Some of these loci and genes, i.e., the QTL <it>fw2.2</it>, which yielded <it>ORFX</it>, and the QTL <it>ovate </it>which yielded <it>OVATE</it>, appear to be novel negative regulators of fruit size and shape <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. We are particularly interested in regulation of tomato ripening, a climacteric fruit. While ethylene evolution in the climacteric phase has been rigorously studied and manipulated in tomato, very little has been done in the investigation of developmental regulation of tomato fruit ripening <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. As mentioned earlier, transcription factors are involved in many aspects of plant and animal development. Differences in gene regulation may account for physiological and morphological differences that developed during the evolution of organisms <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. A change in the 5-prime untranslated sequence of a homeobox-containing gene <it>LeT6 </it>caused over expression of the gene changing the phenotype of previously unpinnate leaves to pinnate <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. This shows that simple differences in transcription factor abundance could be responsible for morphological and physiological variance in plants. At least one gene, a MADS-Box gene <it>RIN</it>, is required for developmental regulation of ripening, and another, <it>TAG1</it>, is implicated in fruit development <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B28">28</abbr></abbrgrp>. Our results agree with previous <it>RIN </it>and <it>TAG1 </it>results and suggest other developmental regulators may be involved in fruit development and/or ripening. Previously, we described gene expression profiles of a number of putative developmental regulators <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> at different stages in fruit development in the TIGR Tomato EST databases. Here we present further evidence that some of these genes may be involved in tomato fruit development.</p>
            <p>The MADS Box gene family in <it>Arabidopsis </it>consists of more than 80 members, indicating the importance of these transcription factors in plants <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. <it>RIN </it>and <it>TAG1 </it>show similar regulation to that previously published. <it>RIN </it>has quite high expression in both cultivars at the turning and red ripe stages. The similarity in expression in the two cultivars suggests that this gene is critical to the ripening process. <it>TAG1 </it>expression differs considerably between VC and AC, and in fact TC84976, TC90812, and TC85320 all show differences in transcript abundance. Over-expression of <it>TAG1 </it>in transgenic tomato plants caused sepals to become pericarpic <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. This effect could reflect the fruit ripening association of <it>TAG1 </it>in tomato or show that large amounts of TAG1 may partially mimic the action of another MADS-Box gene <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. <it>TM4 </it>was up-regulated at the turning stage and declined at the red ripe stage, showing little difference between cultivars. <it>TM4</it>, as mentioned earlier, is expressed early in flower development and up-regulated during cool temperature growth <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B54">54</abbr></abbrgrp>. Seymour et al. <abbrgrp><abbr bid="B55">55</abbr></abbrgrp> proposed <it>TM4 (TDR4) </it>involvement in fruit texture because of a lack of ripening-related induction of this gene in the <it>Cnr </it>mutant and similarity of the protein sequence to the <it>Arabidopsis </it>gene <it>FRUITFUL</it>. The <it>Cnr </it>mutant differs in fruit texture from wild type because of increased cell separation. These investigators have constructed transgenic plants to determine the relationship between <it>TM4 </it>and fruit texture <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. According to our results, <it>TM5 </it>does not seem to be highly expressed in fruit, although it does show some induction at the turning stage. <it>TM6</it>, another tomato MADS Box gene induced by cool temperatures, has high expression during the mature green stage, but not in turning or red ripe stages. The absence of a difference in expression between the two cultivars might indicate that this transcript has a critical role just prior to the onset of the ripening process. In our previous paper we noted that <it>TM6 </it>showed higher expression in the mature green stage than in the immature green, breaker, or red ripe stages according to the TIGR database <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. <it>TM6 </it>belongs to the <it>Antirrhinum DEF</it>/<it>Arabidopsis AP3 </it>family of MADS Box genes that perform the B function in floral identity. Its expression pattern in tomato flowers, however, differs from that of <it>AP3 </it>or <it>DEF</it>. <it>TM6 </it>is expressed in the three inner whorls unlike the petal and anther expression of <it>AP3 </it>and <it>DEF </it><abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. <it>TM29 </it>belongs to the <it>SEPALLATA </it>family of MADS Box genes that are involved in floral organ identity <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. This gene is expressed in primordia of all four floral organs and in inflorescence and vegetative meristems <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. Transgenic plants expressing the antisense gene develop ectopic shoots that emerge from parthenocarpic fruit, suggesting that <it>TM29 </it>is a negative regulator of parthenocarpic fruit formation <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. Our results suggest induction of <it>TM29 </it>at cool temperatures and at the turning stage in both cultivar, as well as other functions of this gene. TC92226, which is most similar to the <it>Petunia AGAMOUS </it>gene <it>PAGL1 </it>(GenBank Accession L33973), is up-regulated at the turning stage in both cultivars, but is not detected in sepals at the level of PCR we used in this experiment. This result may indicate incompleteness of the cool-temperature-ripening phenomenon of sepals cultured at 16&#176;C. TC85320 and TC90812 are differentially expressed in the two cultivars and the TIGR database profile <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, but show little change in expression during cool temperature, in-vitro culture. A very interesting transcript, TC90812, shows a single band in VFNT that is up-regulated in RR, while in AC the PCR product appears as two bands that decrease in intensity in TU and RR fruits. Whether these two bands in AC fruit represent a gene family or splicing variants is unknown at this time, but, since the regulation of the two bands are similar, splicing could be a factor. TC90812 is very similar to MADS1 from pepper in primary amino acid sequence, but the pepper gene is highly expressed in flowers at fruit set and not in young fruit <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. TC85320 is quite similar to a pepper MADS Box gene, <it>MADS6</it>, which has the same expression pattern as <it>MADS1 </it><abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. These two MADS Box genes may not be critical for ripening or fruit formation but might provide a source for fruit architecture or physiological variation.</p>
            <p>Putative homeobox genes, TC85646, TC94540, are induced at turning stage with higher levels of expression of TC85646 in VC. Different levels of expression of the same gene can have phenotypic effects <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. TC94540 was up-regulated during turning stage, but not detected in sepals during in-vitro ripening, thus suggesting the absence of some components of regulation.</p>
            <p>Of the zinc-finger family of genes we investigated, only TC89462, TC95361, and TC89502 showed differential gene expression between VC and AC. Expression of TC89462 of the WRKY family of zinc-finger proteins increased in the red ripe stage of VC fruit, while in AC it remained low. In the cultivar TA496 used in TIGR databases, TC89462 expression was highest in the breaker stage. TC95361, also a WRKY type zinc-finger transcription factor, increased in the last two stages of ripening (TU and RR) in both cultivars, but to a greater extent in VC.</p>
            <p>The only MYB-type transcription factor investigated did show differential expression in the two cultivars and TIGR database. TC85864 was more abundant in red ripe fruit of VC than at other stages and in was more abundant at the mature green stage of AC than at other stages. The TIGR database indicates higher expression of this gene in breaker stage fruit <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
            <p>Of the three putative polycomb genes investigated in this experiment, only BE435419 expression was detectable in fruit tissue (Fig. <figr fid="F1">1</figr>). This gene was detected only in VC red ripe fruit and not in any fruit stages of AC examined. Again, polycomb genes are thought to affect gene expression through remodeling of chromatin <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>.</p>
            <p>The <it>AP2</it>-like gene TC85031 revealed a similar pattern of expression in fruit as that of <it>TM4</it>, a MADS-Box gene. TC85031 was induced in turning fruits and was similarly expressed in VC and AC. Does this indicate its critical nature in some aspect of ripening?</p>
            <p>We chose to investigate TC85295 because of its up-regulation during ripening, according to TIGR tomato fruit EST collections in which the relative abundance of this transcript increased from 0.2 ESTs per 1000 in mature green collection to 0.5 in breaker, and 1.0 in red ripe fruit. Our results indicate high expression in turning and in red ripe fruit, but showed no difference between the two cultivars. These results might imply the importance of this gene to the ripening process. We believe this gene should be examined in further experiments.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Is cool temperature sepal morphogenesis the same process as tomato fruit ripening? While the expression of some genes such as <it>POLYGALACTURONASE</it>, <it>PHYTOENE SYNTHASE</it>, <it>TM4</it>, and <it>RIN </it>are similar, expression of other genes in ripening fruit and sepal morphogenesis differs. TC92226 and TC94540 are both induced in fruit, but their induction is not detectable during sepal ripening. On the other hand, <it>TM6 </it>is induced in cool temperature-treated sepals, but not during fruit ripening. A number of other differences are also seen in gene expression in the two cultivars. We still must determine which of these putative regulators are critical to tomato fruit ripening and how they affect ripening and fruit development in general. We have revealed a number of very interesting genes to investigate further and have confirmed many of the results of our previous EST database mining. Hopefully, we have provided more interesting targets in the fruit development game.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Sepal cultures</p>
            </st>
            <p>Sepals from small green fruit 3- to 10-mm diameter were harvested from greenhouse-grown plants (<it>Lycopersicon esculentum </it>cv. VFNT Cherry). Sepals were disinfested, separated at the base, and cultured on a solidified medium as previously described <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> at 16 or 28&#176;C. Samples of sepals cultured at both temperatures were subsequently harvested at various times, i.e., 0, 2, 14, and 24 days, and frozen immediately in liquid nitrogen.</p>
         </sec>
         <sec>
            <st>
               <p>Tomato Fruit</p>
            </st>
            <p>Mature green (MG), breaker to turning (TU), and red ripe fruit (RR) were harvested from greenhouse-grown VFNT Cherry LA1221 and Ailsa Craig varieties of tomato, both obtainable from the C. M. Rick Tomato Genetics Resource Center at the University of California, Davis <abbrgrp><abbr bid="B59">59</abbr></abbrgrp>. Only pericarp and skin tissues were used for RNA extraction.</p>
         </sec>
         <sec>
            <st>
               <p>RNA Extraction and RT-PCR</p>
            </st>
            <p>Total RNA was extracted and purified and used in RT-PCR reactions according to Bartley and Ishida <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> with the following modifications: An initial denaturation at 94&#176;C for 2 min and then 24 cycles of denaturation at 92&#176;C for 30 s, annealing at 55&#176;C for 3 min, and extension at 72&#176;C for 7 min. A final extension program was performed at 72&#176;C for 7 min. Oligonucleotide sequences for the <it>AP2</it>-like transcript (TC85031), <it>TAG1 </it>(TC89786), and <it>TM4 </it>(TC94405) can be found in Bartley and Ishida <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, and the sequence for the <it>PSY </it>primers SPS3 and PSY can be found in Bartley and Scolnik <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Oligonucleotides for other transcripts are shown in Table <tblr tid="T1">1</tblr>. The MADS-Box primers were compared to various available nucleotide sequences in the TIGR databases and GenBank to show lack of cross gene amplification among different MADS-Box genes at the conditions used in the PCR. Sequence comparison of primers designed on VFNT sequences such as: <it>TM4</it>, <it>TM5</it>, and <it>TM6 </it>to sequence in the TIGR database showed no differences among the cultivars and TIGR sequences. In fact very few differences between cultivars were found in overall sequence of these transcripts, approximately 2 to 3 nucleotides per gene except for <it>TM4</it>. A stretch of poor sequence in the <it>TM4 </it>entry has an additional 18 nucleotides alternately spaced with true sequence. PCR was performed on equivalent amounts of non&#8211;reverse transcribed total RNA of some of the transcripts to show lack of amplification of genomic DNA.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Oligonucleotide Sequences. Sequences of oligonucleotides used in these experiments not published elsewhere. Primer sets are given for each transcript with the upper sequence being the forward primer and the lower being the reverse primer.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>#</p>
                     </c>
                     <c ca="center">
                        <p>Transcript</p>
                     </c>
                     <c ca="center">
                        <p>5' Sequence</p>
                     </c>
                     <c ca="center">
                        <p>3' Name</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>TC84976</p>
                     </c>
                     <c ca="center">
                        <p>GGCAAGTTGCGTTCTGTAAACGG</p>
                     </c>
                     <c ca="center">
                        <p>TC84976F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TCGACGAATACGACGATAATCAC</p>
                     </c>
                     <c ca="center">
                        <p>TC84976R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>TC90812</p>
                     </c>
                     <c ca="center">
                        <p>TTTGCAGCACTTCAAGCATGGTG</p>
                     </c>
                     <c ca="center">
                        <p>TC90812F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TTACCCAAAATGTGGAGAAGAAG</p>
                     </c>
                     <c ca="center">
                        <p>TC90812R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>TC92226</p>
                     </c>
                     <c ca="center">
                        <p>GAATTACTTGTCGATGAGTCGTC</p>
                     </c>
                     <c ca="center">
                        <p>TC922F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AAATTCTTGAGGTCTCTAGGGC</p>
                     </c>
                     <c ca="center">
                        <p>TC922R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>TC85320</p>
                     </c>
                     <c ca="center">
                        <p>CATGAGATCTCTGTGCTTTGCG</p>
                     </c>
                     <c ca="center">
                        <p>TC853F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CTTTCTCCCTTTCGTTAACCTGC</p>
                     </c>
                     <c ca="center">
                        <p>TC853R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p><it>TM6 </it>(TC90108)</p>
                     </c>
                     <c ca="center">
                        <p>TCAGTATCAGAGTGCACTTGGAG</p>
                     </c>
                     <c ca="center">
                        <p>TM6F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AACTGATATCTTCAGGAGAGACG</p>
                     </c>
                     <c ca="center">
                        <p>TM6R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p><it>RIN </it>(TC91451)</p>
                     </c>
                     <c ca="center">
                        <p>GGCAAGCTTTATGAATTTTGCAG</p>
                     </c>
                     <c ca="center">
                        <p>TC91451F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>GTAGCATCATGTGTTGATGGTGC</p>
                     </c>
                     <c ca="center">
                        <p>TC91451R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p><it>TM5 </it>(TC101989)</p>
                     </c>
                     <c ca="center">
                        <p>GCATGCTAAAGACGTTGGAGAGG</p>
                     </c>
                     <c ca="center">
                        <p>TM5F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TGATGATAGGAAAACCATTGAGC</p>
                     </c>
                     <c ca="center">
                        <p>TM5R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p><it>TM29 </it>(TC99375)</p>
                     </c>
                     <c ca="center">
                        <p>AAAGTGCAGCTATGGAACATTGG</p>
                     </c>
                     <c ca="center">
                        <p>TM29F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>ATGCAAAGCTGAAGATAAAGGAC</p>
                     </c>
                     <c ca="center">
                        <p>TM29R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>TC85646</p>
                     </c>
                     <c ca="center">
                        <p>AAAGAGACGAATATAAGTGCTCC</p>
                     </c>
                     <c ca="center">
                        <p>TC85646F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AGTTGGAAATCGCTTATTCCCAC</p>
                     </c>
                     <c ca="center">
                        <p>TC85646R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>TC94540</p>
                     </c>
                     <c ca="center">
                        <p>ATGGCTAAACATGATGGTGCAGC</p>
                     </c>
                     <c ca="center">
                        <p>TC94540F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AAACTGTAAATCTCTCAATCCTC</p>
                     </c>
                     <c ca="center">
                        <p>TC94540R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>TC89506</p>
                     </c>
                     <c ca="center">
                        <p>CGGTTCGATGCCGGCTCAGACG</p>
                     </c>
                     <c ca="center">
                        <p>TC89506F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TAATCTTGTAATAGTTGAGTCGC</p>
                     </c>
                     <c ca="center">
                        <p>TC89506R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p><it>LET12 </it>(TC93975)</p>
                     </c>
                     <c ca="center">
                        <p>AGCACCAGGTGAAGGTACAGGAG</p>
                     </c>
                     <c ca="center">
                        <p>TC93975F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TTACTGCTTGATTTCACCTGCAC</p>
                     </c>
                     <c ca="center">
                        <p>TC93975R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>TC87219</p>
                     </c>
                     <c ca="center">
                        <p>TCTTACCCGGTCCTTATGTACCT</p>
                     </c>
                     <c ca="center">
                        <p>TC87219F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TCTAAGGGGCATTCGGTATATCAG</p>
                     </c>
                     <c ca="center">
                        <p>TC87219R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>27</p>
                     </c>
                     <c ca="center">
                        <p>TC86074</p>
                     </c>
                     <c ca="center">
                        <p>ATCTGTCTATGGGATGTCACAGC</p>
                     </c>
                     <c ca="center">
                        <p>TC86074F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AGGAAGTATTAGGTTAACTGTACC</p>
                     </c>
                     <c ca="center">
                        <p>TC86074R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="center">
                        <p>TC89462</p>
                     </c>
                     <c ca="center">
                        <p>TAGGACAGTTAGAGAACCTAGAG</p>
                     </c>
                     <c ca="center">
                        <p>TC89462F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AGTTTCAGCAAAGCAATGACTCC</p>
                     </c>
                     <c ca="center">
                        <p>TC89462R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>31</p>
                     </c>
                     <c ca="center">
                        <p>TC95361</p>
                     </c>
                     <c ca="center">
                        <p>GTCAGAAGAAACAGAAAGAGCCG</p>
                     </c>
                     <c ca="center">
                        <p>TC95361F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>32</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TTGTAGTCATGTTTTAGCACCGC</p>
                     </c>
                     <c ca="center">
                        <p>TC95361R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="center">
                        <p><it>YABBY2</it>-like(TC89502)</p>
                     </c>
                     <c ca="center">
                        <p>CTTCTGCAGCACAATTCTTGCGG</p>
                     </c>
                     <c ca="center">
                        <p>TC89502F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>ATAGAGACCAATTGTTTTCTGAGG</p>
                     </c>
                     <c ca="center">
                        <p>TC89502R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>TC85864</p>
                     </c>
                     <c ca="center">
                        <p>TCTGTTATGAATCCGGGTAGTCC</p>
                     </c>
                     <c ca="center">
                        <p>TC85864F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>36</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>GATTACTCAATCTTGCTGATGCC</p>
                     </c>
                     <c ca="center">
                        <p>TC85864R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>37</p>
                     </c>
                     <c ca="center">
                        <p>TC91525</p>
                     </c>
                     <c ca="center">
                        <p>ATTACATGGAGCTAGATATTCCG</p>
                     </c>
                     <c ca="center">
                        <p>TC91525F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>38</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>ATTTTGTAACAGGTTTCTTCAGG</p>
                     </c>
                     <c ca="center">
                        <p>TC91525R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>39</p>
                     </c>
                     <c ca="center">
                        <p>BE435419</p>
                     </c>
                     <c ca="center">
                        <p>CTATGGGACATGAAATACAAGGG</p>
                     </c>
                     <c ca="center">
                        <p>BE435F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>40</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>ATGGCTTTCTTTTGGTTTATTGC</p>
                     </c>
                     <c ca="center">
                        <p>BE435R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>41</p>
                     </c>
                     <c ca="center">
                        <p>TC93803</p>
                     </c>
                     <c ca="center">
                        <p>GGTTGCATAGATGTTGCATTCAG</p>
                     </c>
                     <c ca="center">
                        <p>TC93803F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>42</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CCCATGAGCTTCATAAGCCTGAG</p>
                     </c>
                     <c ca="center">
                        <p>TC93803R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>43</p>
                     </c>
                     <c ca="center">
                        <p>TC85295</p>
                     </c>
                     <c ca="center">
                        <p>ATTGGAGAGAAGCATCAGTAGGC</p>
                     </c>
                     <c ca="center">
                        <p>TC85295F1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>44</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AAGTGGAGAATCAATGCCCAGAC</p>
                     </c>
                     <c ca="center">
                        <p>TC85295R1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>45</p>
                     </c>
                     <c ca="center">
                        <p><it>LeEF-1</it>(TC98347)</p>
                     </c>
                     <c ca="center">
                        <p>TGGCCCTACTGGTTTGACAACTG</p>
                     </c>
                     <c ca="center">
                        <p>alphaF1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>46</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CACAGTTCACTTCCCCTTCTTCTG</p>
                     </c>
                     <c ca="center">
                        <p>alphaR1</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Sequences of oligonucleotides used in these experiments not published elsewhere. Primer sets are given for each transcript with the upper sequence being the forward primer and the lower being the reverse primer.</p>
               </tblfn>
            </tbl>
            <p>As a control, the tomato <it>ELONGATION FACTOR 1</it>-&#945; gene, (<it>LeEF-1</it>, TC98347 and GenBank accession X14449)<abbrgrp><abbr bid="B60">60</abbr></abbrgrp>, was used because of its high and stable expression in mature tomato fruit <abbrgrp><abbr bid="B61">61</abbr><abbr bid="B62">62</abbr></abbrgrp>. However, the original paper involving cloning of this gene showed some variability in expression even in mature fruit <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. We therefore examined the expression profile of this gene in the TIGR database. We found fairly stable high expression in immature green (2.8 ESTs per 1000), mature green (3.4), and breaker stage fruit (2.8) with a slight decline in red ripe fruit (1.8). Leaf expression of TC98347, using the collection of leaf ESTs from the <it>Pseudomonas </it>susceptible library T1079, was less, 0.8 ESTs per 1000. This might account for the less intense band in 0 day sepals in the experiment if, sepals are indeed changing from leaf-like organs into fruit. However, this library was made from <it>Pseudomonas</it>-treated leaves. No normal leaf library with suitable numbers of ESTs was available for use at the time of writing of this paper. <it>LeEF-1 </it>belongs to a gene family in tomato. We compared the sequences of the four most similar members of the family, TC98347, TC98345, TC98346, and TC98349 for primer design. The upstream primer, alphaF1, might possibly amplify other members because four nucleotide mismatches at most occur. The down stream primer alphaR1 should only amplify TC98347 as nucleotide triplets are missing and other mismatches in TC98346 and TC98345 occur, and six mismatched bases occur in TC98349. In the event that TC98349 was amplified, TIGR databases indicate expression at 0.2 ESTs per 1000 in mature green and breaker stages compared to 3.4 and 2.8, respectively, for TC98347 (our control). To show relative abundance differences in RNA, we made 10 fold dilutions of the reverse transcription reactions used for the sepal experiment and performed PCR using the same conditions and <it>LeEF-1 </it>primers (Fig <figr fid="F2">2</figr>.). Loading of 2 &#956;g of total RNA of each sepal sample or fruit stage in each lane (bottom of figure <figr fid="F1">1</figr>) was used as an additional control to compare overall amounts.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Control PCR of <it>LeEF-1 </it>indicating relative abundance of RNAs</p>
               </caption>
               <text>
                  <p>Control PCR of <it>LeEF-1 </it>indicating relative abundance of RNAs. Odd numbered lanes were performed exactly as in Figure <figr fid="F1">1</figr> (sepals), while the even numbered lanes were performed with a 1 in 10 dilution of the reverse transcription reaction.</p>
               </text>
               <graphic file="1471-2229-3-4-2"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p><it>Lycopersicon esculentum </it>cv Ailsa Craig, AC; <it>Lycopersicon esculentum </it>cv VFNT Cherry, VC; expressed sequence tags, EST; reverse transcription-polymerase chain reaction, RT-PCR; The Institute for Genomic Research, TIGR; <it>Lycopersicon esculentum ELONGATION FACTOR 1</it>-&#945;, LeEF-1; mature green stage, MG; breaker stage, BR; turning stage, TU; red ripe stage; RR</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>GB conceived of the study together with BI, carried out the gene expression analysis and drafted the manuscript. BI also edited the manuscript. All authors read and approved the manuscript.</p>
      </sec>
      <sec>
         <st>
            <p>Nomenclature</p>
         </st>
         <p>Tentative consensus sequences (TCs) are cDNA sequences assembled from overlapping ESTs common to that transcript. TC numbers contained in the TIGR Tomato Gene Index are continually changing as new sequences are added and more information developed. We have used the same numbers as we reported previously <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>; however, the numbers have changed in the database <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>. A history of TC numbers is included with each TC, and searches using previous numbers will still locate correct TCs.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors would like to thank Drs. Dominic Wong and Xiaohua He for critical reading of the manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Molecular Biology of Fruit Maturation and Ripening</p>
            </title>
            <aug>
               <au>
                  <snm>Giovannoni</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Annu Rev Plant Physiol Plant Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>52</volume>
            <fpage>725</fpage>
            <lpage>749</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.arplant.52.1.725</pubid>
                  <pubid idtype="pmpid" link="fulltext">11337414</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Gene expression in ripening tomato fruit</p>
            </title>
            <aug>
               <au>
                  <snm>Grierson</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>CRC Crit Rev Plant Sci</source>
            <pubdate>1986</pubdate>
            <volume>3</volume>
            <fpage>113</fpage>
            <lpage>132</lpage>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Molecular genetics of tomato fruit ripening</p>
            </title>
            <aug>
               <au>
                  <snm>Fray</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Grierson</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>1993</pubdate>
            <volume>9</volume>
            <fpage>438</fpage>
            <lpage>443</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0168-9525(93)90108-T</pubid>
                  <pubid idtype="pmpid">8122312</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>The regulation of 1-aminocyclopropane-1-carboxylic acid synthase gene expression during the transition from system-1 to system-2 ethylene synthesis in tomato</p>
            </title>
            <aug>
               <au>
                  <snm>Barry</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Llop-Tous</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Grierson</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2000</pubdate>
            <volume>123</volume>
            <fpage>979</fpage>
            <lpage>86</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">59060</pubid>
                  <pubid idtype="pmpid" link="fulltext">10889246</pubid>
                  <pubid idtype="doi">10.1104/pp.123.3.979</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Use of a tomato mutant constructed with reverse genetics to study fruit ripening, a complex developmental process</p>
            </title>
            <aug>
               <au>
                  <snm>Theologis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oeller</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Rottmann</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Gantz</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Dev Genet</source>
            <pubdate>1993</pubdate>
            <volume>14</volume>
            <fpage>282</fpage>
            <lpage>95</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8222344</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Transcriptional analysis of polygalacturonase and other ripening associated genes in Rutgers, <it>rin</it>, <it>nor</it>, and <it>Nr </it>tomato fruit</p>
            </title>
            <aug>
               <au>
                  <snm>DellaPenna</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lincoln</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Bennett</snm>
                  <fnm>AB</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1989</pubdate>
            <volume>90</volume>
            <fpage>1372</fpage>
            <lpage>1377</lpage>
         </bibl>
         <bibl id="B7">
            <title>
               <p>An ancestral MADS-box gene duplication occurred before the divergence of plants and animals</p>
            </title>
            <aug>
               <au>
                  <snm>Alvarez-Buylla</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Pelaz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Liljegren</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Gold</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Burgeff</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ditta</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>de Pouplana</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Martinez-Castilla</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Yanofsky</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>PNAS</source>
            <pubdate>2000</pubdate>
            <volume>97</volume>
            <fpage>5328</fpage>
            <lpage>5333</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">25828</pubid>
                  <pubid idtype="pmpid" link="fulltext">10805792</pubid>
                  <pubid idtype="doi">10.1073/pnas.97.10.5328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Early evolutionary origin of major Homeodomain sequence classes</p>
            </title>
            <aug>
               <au>
                  <snm>Kappen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Schughart</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ruddle</snm>
                  <fnm>FH</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>1993</pubdate>
            <volume>18</volume>
            <fpage>54</fpage>
            <lpage>70</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.1993.1426</pubid>
                  <pubid idtype="pmpid" link="fulltext">7903958</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Zinc-finger transcription factors in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Takatsuji</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Cell Mol Life Sci</source>
            <pubdate>1998</pubdate>
            <volume>54</volume>
            <fpage>582</fpage>
            <lpage>596</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s000180050186</pubid>
                  <pubid idtype="pmpid">9676577</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Transcriptional Regulators and the Evolution of Plant Form</p>
            </title>
            <aug>
               <au>
                  <snm>Doebley</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lukens</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1998</pubdate>
            <volume>10</volume>
            <fpage>1075</fpage>
            <lpage>1082</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1105/tpc.10.7.1075</pubid>
                  <pubid idtype="pmpid" link="fulltext">9668128</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>The limits of selection during maize domestication</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Stec</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hey</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lukens</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Doebley</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1999</pubdate>
            <volume>398</volume>
            <fpage>236</fpage>
            <lpage>239</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/18435</pubid>
                  <pubid idtype="pmpid" link="fulltext">10094045</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>fw2.2: a quantitative trait locus key to the evolution of tomato fruit size</p>
            </title>
            <aug>
               <au>
                  <snm>Frary</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nesbitt</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Grandillo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Knaap</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cong</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Meller</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Elber</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Alpert</snm>
                  <fnm>KB</fnm>
               </au>
               <au>
                  <snm>Tanksley</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>289</volume>
            <fpage>85</fpage>
            <lpage>88</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.289.5476.85</pubid>
                  <pubid idtype="pmpid" link="fulltext">10884229</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>A new class of regulatory genes underlying the cause of pear-shaped tomato fruit</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Van Eck</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cong</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Tanksley</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>PNAS</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>13302</fpage>
            <lpage>13306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">130628</pubid>
                  <pubid idtype="pmpid" link="fulltext">12242331</pubid>
                  <pubid idtype="doi">10.1073/pnas.162485999</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>A MADS-Box gene necessary for fruit ripening at the tomato ripening-inhibitor (<it>Rin</it>) Locus</p>
            </title>
            <aug>
               <au>
                  <snm>Vrebalov</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ruezinsky</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Padmanabhan</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Medrano</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Drake</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schuch</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Giovannoni</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2002</pubdate>
            <volume>296</volume>
            <fpage>343</fpage>
            <lpage>346</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1068181</pubid>
                  <pubid idtype="pmpid" link="fulltext">11951045</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Induction of <it>AGAMOUS </it>gene expression plays a key role in ripening of tomato sepals in vitro</p>
            </title>
            <aug>
               <au>
                  <snm>Ishida</snm>
                  <fnm>BK</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Say</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1998</pubdate>
            <volume>36</volume>
            <fpage>733</fpage>
            <lpage>739</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1005941330004</pubid>
                  <pubid idtype="pmpid">9526506</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Analysis of the genome sequence of the flowering plant <it>Arabidopsis thaliana</it></p>
            </title>
            <aug>
               <au>
                  <cnm><it>Arabidopsis </it>Genome Initiative</cnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>408</volume>
            <fpage>796</fpage>
            <lpage>815</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35048692</pubid>
                  <pubid idtype="pmpid" link="fulltext">11130711</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>A Draft Sequence of the Rice Genome (Oryza sativa L. ssp. Japonica)</p>
            </title>
            <aug>
               <au>
                  <snm>Goff</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Ricke</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lan</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Presting</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dunn</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Glazebrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sessions</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oeller</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Varma</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hadley</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hutchison</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Katagiri</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lange</snm>
                  <fnm>BM</fnm>
               </au>
               <au>
                  <snm>Moughamer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Xia</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Budworth</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zhong</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miguel</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Paszkowski</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Colbert</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Mao</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Quail</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wing</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dean</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Zharkikh</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sahasrabudhe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cannings</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gutin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pruss</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tavtigian</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Eldredge</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Scholl</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Bhatnagar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Adey</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Rubano</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tusneem</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Robinson</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Feldhaus</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Macalma</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Oliphant</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Briggs</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2002</pubdate>
            <volume>296</volume>
            <fpage>92</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1068275</pubid>
                  <pubid idtype="pmpid" link="fulltext">11935018</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p><it>Arabidopsis </it>transcription factors: genome-wide comparative analysis among eukaryotes</p>
            </title>
            <aug>
               <au>
                  <snm>Riechmann</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Heard</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Reuber</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Keddie</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Adam</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pineda</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ratcliffe</snm>
                  <fnm>OJ</fnm>
               </au>
               <au>
                  <snm>Samaha</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Creelman</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pilgrim</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Broun</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>JZ</fnm>
               </au>
               <au>
                  <snm>Ghandehari</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Sherman</snm>
                  <fnm>BK</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>290</volume>
            <fpage>2105</fpage>
            <lpage>2110</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.290.5499.2105</pubid>
                  <pubid idtype="pmpid" link="fulltext">11118137</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Deductions about the number, organization and evolution of genes in the tomato genome based on analysis of a large EST collection and selective genomic sequencing</p>
            </title>
            <aug>
               <au>
                  <snm>Van der Hoeven</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ronning</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Giovannoni</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tanksley</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2002</pubdate>
            <volume>14</volume>
            <fpage>1441</fpage>
            <lpage>1456</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">150698</pubid>
                  <pubid idtype="pmpid" link="fulltext">12119366</pubid>
                  <pubid idtype="doi">10.1105/tpc.010478</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Digital fruit ripening: data mining in the TIGR tomato gene index</p>
            </title>
            <aug>
               <au>
                  <snm>Bartley</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Ishida</snm>
                  <fnm>BK</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol Rep</source>
            <pubdate>2002</pubdate>
            <volume>20</volume>
            <fpage>115</fpage>
            <lpage>130</lpage>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Lycopene in tomato: chemical and physical properties affected by food processing</p>
            </title>
            <aug>
               <au>
                  <snm>Shi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Le Maguer</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Crit Rev Food Sci Nut</source>
            <pubdate>2000</pubdate>
            <volume>40</volume>
            <fpage>1</fpage>
            <lpage>42</lpage>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Carotenoid composition in raw and cooked spanish vegetables</p>
            </title>
            <aug>
               <au>
                  <snm>Granado</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Olmedilla</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Blanco</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Rojas-Hidalgo</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Agric Food Chem</source>
            <pubdate>1992</pubdate>
            <volume>40</volume>
            <fpage>2135</fpage>
            <lpage>2140</lpage>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Increased lycopene and flavor volatile production in tomato calyces and fruit cultured in Vitro and the effect of 2-(4-chlorophenylthio)triethylamine</p>
            </title>
            <aug>
               <au>
                  <snm>Ishida</snm>
                  <fnm>BK</fnm>
               </au>
               <au>
                  <snm>Mahoney</snm>
                  <fnm>NE</fnm>
               </au>
               <au>
                  <snm>Ling</snm>
                  <fnm>LC</fnm>
               </au>
            </aug>
            <source>J Agric Food Chem</source>
            <pubdate>1998</pubdate>
            <volume>46</volume>
            <fpage>4577</fpage>
            <lpage>4582</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1021/jf980488b</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Carotenoid biosynthesis during tomato fruit development</p>
            </title>
            <aug>
               <au>
                  <snm>Fraser</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Truesdale</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Bird</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Schuch</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bramley</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1994</pubdate>
            <volume>105</volume>
            <fpage>405</fpage>
            <lpage>413</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159369</pubid>
                  <pubid idtype="pmpid">12232210</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Developmental Regulation Is Altered in the Calyx during in Vitro Ovary Culture of Tomato</p>
            </title>
            <aug>
               <au>
                  <snm>Ishida</snm>
                  <fnm>BK</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1991</pubdate>
            <volume>3</volume>
            <fpage>219</fpage>
            <lpage>223</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">159994</pubid>
                  <pubid idtype="pmpid">12324596</pubid>
                  <pubid idtype="doi">10.1105/tpc.3.3.219</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>cDNA cloning, expression during development, and genome mapping of <it>PSY2</it>, a second tomato gene encoding phytoene synthase</p>
            </title>
            <aug>
               <au>
                  <snm>Bartley</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Scolnik</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1993</pubdate>
            <volume>268</volume>
            <fpage>25718</fpage>
            <lpage>25721</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8245008</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Regulation of carotenoid biosynthesis during tomato development</p>
            </title>
            <aug>
               <au>
                  <snm>Giuliano</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Bartley</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Scolnik</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1993</pubdate>
            <volume>5</volume>
            <fpage>379</fpage>
            <lpage>387</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160278</pubid>
                  <pubid idtype="pmpid">8485401</pubid>
                  <pubid idtype="doi">10.1105/tpc.5.4.379</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Isolation of the tomato <it>AGAMOUS </it>gene <it>TAG1 </it>and analysis of its homeotic role in transgenic plants</p>
            </title>
            <aug>
               <au>
                  <snm>Pnueli</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hareven</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Rounsley</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Yanofsky</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Lifschitz</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1994</pubdate>
            <volume>6</volume>
            <fpage>163</fpage>
            <lpage>173</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160424</pubid>
                  <pubid idtype="pmpid">7908549</pubid>
                  <pubid idtype="doi">10.1105/tpc.6.2.163</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Tomato flower abnormalities induced by low temperatures are associated with changes of expression of MADS-Box genes</p>
            </title>
            <aug>
               <au>
                  <snm>Lozano</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Angosto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gomez</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Payan</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Capel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huijser</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Salinas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Martinez-Zapater</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>1998</pubdate>
            <volume>117</volume>
            <fpage>91</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">35026</pubid>
                  <pubid idtype="pmpid" link="fulltext">9576778</pubid>
                  <pubid idtype="doi">10.1104/pp.117.1.91</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Homeoboxes in plant development</p>
            </title>
            <aug>
               <au>
                  <snm>Chan</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Gago</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Palena</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1998</pubdate>
            <volume>1442</volume>
            <fpage>1</fpage>
            <lpage>19</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0167-4781(98)00119-5</pubid>
                  <pubid idtype="pmpid">9767075</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>The <it>BELL1 </it>gene encodes a homeodomain protein involved in pattern formation in the <it>Arabidopsis </it>ovule</p>
            </title>
            <aug>
               <au>
                  <snm>Reiser</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Modrusan</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Margossian</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Samach</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ohad</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Haughn</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1995</pubdate>
            <volume>83</volume>
            <fpage>735</fpage>
            <lpage>742</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8521490</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The <it>Arabidopsis </it>BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals</p>
            </title>
            <aug>
               <au>
                  <snm>Bellaoui</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pidkowich</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Samach</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kushalappa</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kohalmi</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Modrusan</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Crosby</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Haughn</snm>
                  <fnm>GW</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2001</pubdate>
            <volume>13</volume>
            <fpage>2455</fpage>
            <lpage>2470</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">139464</pubid>
                  <pubid idtype="pmpid" link="fulltext">11701881</pubid>
                  <pubid idtype="doi">10.1105/tpc.13.11.2455</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p><it>HUA1</it>, a regulator of stamen and carpel identities in <it>Arabidopsis</it>, codes for a nuclear RNA binding protein</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>X</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2001</pubdate>
            <volume>13</volume>
            <fpage>2269</fpage>
            <lpage>2281</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">139158</pubid>
                  <pubid idtype="pmpid" link="fulltext">11595801</pubid>
                  <pubid idtype="doi">10.1105/tpc.13.10.2269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p><it>TRANSPARENT TESTA GLABRA2</it>, a trichome and seed coat development gene of <it>Arabidopsis</it>, encodes a WRKY transcription factor</p>
            </title>
            <aug>
               <au>
                  <snm>Johnson</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Kolevski</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Smyth</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2002</pubdate>
            <volume>14</volume>
            <fpage>1359</fpage>
            <lpage>1375</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">150785</pubid>
                  <pubid idtype="pmpid" link="fulltext">12084832</pubid>
                  <pubid idtype="doi">10.1105/tpc.001404</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The WRKY superfamily of plant transcription factors</p>
            </title>
            <aug>
               <au>
                  <snm>Eulgem</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Rushton</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Robatzek</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Somssich</snm>
                  <fnm>IE</fnm>
               </au>
            </aug>
            <source>Trends Plant Sci</source>
            <pubdate>2000</pubdate>
            <volume>5</volume>
            <fpage>199</fpage>
            <lpage>206</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1360-1385(00)01600-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">10785665</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Members of the YABBY gene family specify abaxial cell fate in <it>Arabidopsis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Siegfried</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Eshed</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Baum</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Otsuga</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Drews</snm>
                  <fnm>GN</fnm>
               </au>
               <au>
                  <snm>Bowman</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>1999</pubdate>
            <volume>126</volume>
            <fpage>4117</fpage>
            <lpage>4128</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10457020</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>New light on Myc andMyb. Part II. Myb</p>
            </title>
            <aug>
               <au>
                  <snm>L&#252;scher</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Eisenman</snm>
                  <fnm>RN</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>1990</pubdate>
            <volume>4</volume>
            <fpage>2235</fpage>
            <lpage>2241</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2279697</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Function search in a large transcription factor gene family in <it>Arabidopsis</it>: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes</p>
            </title>
            <aug>
               <au>
                  <snm>Meissner</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Cominelli</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Denekamp</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fuertes</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Greco</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kranz</snm>
                  <fnm>HD</fnm>
               </au>
               <au>
                  <snm>Penfield</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Petroni</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Urzainqui</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Paz-Ares</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Smeekens</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tonelli</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Weisshaar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Baumann</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Klimyuk</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Marillonnet</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Patel</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Speulman</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tissier</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Bouchez</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>JJD</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wisman</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bevan</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Plant cell</source>
            <pubdate>1999</pubdate>
            <volume>11</volume>
            <fpage>1827</fpage>
            <lpage>1840</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">144113</pubid>
                  <pubid idtype="pmpid" link="fulltext">10521515</pubid>
                  <pubid idtype="doi">10.1105/tpc.11.10.1827</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Cloning and initial characterization of 14 myb-related cDNAs from tomato (Lycopersicon esculentum cv. Ailsa Craig)</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Merryweather</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>1996</pubdate>
            <volume>30</volume>
            <fpage>1009</fpage>
            <lpage>1020</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8639738</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Mechanisms of transcriptional memory</p>
            </title>
            <aug>
               <au>
                  <snm>Francis</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Kingston</snm>
                  <fnm>RE</fnm>
               </au>
            </aug>
            <source>Nat Rev Mol Cell Biol</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <fpage>409</fpage>
            <lpage>421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35073039</pubid>
                  <pubid idtype="pmpid" link="fulltext">11389465</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Polycomb repression of flowering during early plant development</p>
            </title>
            <aug>
               <au>
                  <snm>Kinoshita</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Harada</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Goldberg</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>PNAS</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>14156</fpage>
            <lpage>14161</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">61184</pubid>
                  <pubid idtype="pmpid" link="fulltext">11698668</pubid>
                  <pubid idtype="doi">10.1073/pnas.241507798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>The war of the whorls: genetic interactions controlling flower development</p>
            </title>
            <aug>
               <au>
                  <snm>Coen</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Meyerowitz</snm>
                  <fnm>EM</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1991</pubdate>
            <volume>353</volume>
            <fpage>31</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/353031a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">1715520</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The ABCs of floral homeotic genes</p>
            </title>
            <aug>
               <au>
                  <snm>Weigel</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Meyerowitz</snm>
                  <fnm>EM</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1994</pubdate>
            <volume>78</volume>
            <fpage>203</fpage>
            <lpage>209</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7913881</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Genetic interactions among floral homeotic genes of <it>Arabidopsis.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Bowman</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Smyth</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>1991</pubdate>
            <volume>112</volume>
            <fpage>1</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1685111</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Control of <it>Arabidopsis </it>flower and seed development by the homeotic gene <it>APETALA2.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Jofuku</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>den Boer</snm>
                  <fnm>BGW</fnm>
               </au>
               <au>
                  <snm>Van Montagu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Okamuro</snm>
                  <fnm>JKL</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1994</pubdate>
            <volume>6</volume>
            <fpage>1211</fpage>
            <lpage>1225</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160514</pubid>
                  <pubid idtype="pmpid">7919989</pubid>
                  <pubid idtype="doi">10.1105/tpc.6.9.1211</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>The inflorescence architecture of Petunia hybrida is modified by the <it>Arabidopsis </it>thaliana <it>Ap2 </it>gene</p>
            </title>
            <aug>
               <au>
                  <snm>Maes</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Van Montagu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gerats</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Dev Genet</source>
            <pubdate>1999</pubdate>
            <volume>25</volume>
            <fpage>199</fpage>
            <lpage>208</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1520-6408(1999)25:3&lt;199::AID-DVG3>3.0.CO;2-L</pubid>
                  <pubid idtype="pmpid" link="fulltext">10528261</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Petunia <it>Ap2</it>-like genes and their role in flower and seed development</p>
            </title>
            <aug>
               <au>
                  <snm>Maes</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Van De Steene</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Zethof</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Karimi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>D'Hauw</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mares</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Van Montagu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gerats</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2001</pubdate>
            <volume>13</volume>
            <fpage>229</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">102239</pubid>
                  <pubid idtype="pmpid" link="fulltext">11226182</pubid>
                  <pubid idtype="doi">10.1105/tpc.13.2.229</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Betaine improves freezing tolerance in wheat</p>
            </title>
            <aug>
               <au>
                  <snm>Allard</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Houde</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kr&#246;l</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ivanov</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Huner</snm>
                  <fnm>NPA</fnm>
               </au>
               <au>
                  <snm>Sarhan</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Plant Cell Physiol</source>
            <pubdate>1998</pubdate>
            <volume>39</volume>
            <fpage>1194</fpage>
            <lpage>1202</lpage>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Quantitative analysis of flavor and other volatiles and for other constituents of two tomato varieties during ripening</p>
            </title>
            <aug>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Nisperos-Carriedo</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Moshonas</snm>
                  <fnm>MG</fnm>
               </au>
            </aug>
            <source>J Amer Soc Hort Sci</source>
            <pubdate>1991</pubdate>
            <volume>116</volume>
            <fpage>265</fpage>
            <lpage>269</lpage>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Quantitative analysis of flavor parameters in six Florida tomato varieties (<it>Lycopersicon esculentum </it>Mill.)</p>
            </title>
            <aug>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Nisperos-Carriedo</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>J Agr Food Chem</source>
            <pubdate>1991</pubdate>
            <volume>39</volume>
            <fpage>1135</fpage>
            <lpage>1140</lpage>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Quality of ripened mutant and transgenic tomato cultigens</p>
            </title>
            <aug>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Shewfelt</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Proc Tomato Quality Wkshp</source>
            <pubdate>1995</pubdate>
            <volume>503</volume>
            <fpage>47</fpage>
            <lpage>57</lpage>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Flavor trivia and tomato aroma: Biochemistry and possible mechanisms for control of important aroma components</p>
            </title>
            <aug>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Shewmaker</snm>
                  <fnm>CK</fnm>
               </au>
               <au>
                  <snm>Schuch</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Hortsci</source>
            <pubdate>2000</pubdate>
            <volume>35</volume>
            <fpage>1013</fpage>
            <lpage>1022</lpage>
         </bibl>
         <bibl id="B53">
            <title>
               <p>A gene fusion at a homeobox locus:Alterations in leaf shape and implications for morphological evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Janssen</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sinha</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1997</pubdate>
            <volume>9</volume>
            <fpage>1289</fpage>
            <lpage>1304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">156998</pubid>
                  <pubid idtype="pmpid">9286107</pubid>
                  <pubid idtype="doi">10.1105/tpc.9.8.1289</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>The MADS box gene family in tomato: temporal expression during floral development, conserved secondary structures and similarity to homeotic genes from <it>Antirrhinum </it>and <it>Arabidopsis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Pnueli</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Abu-Abeid</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zamir</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nacken</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Schwarz-Sommer</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Lifschitz</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Plant J</source>
            <pubdate>1991</pubdate>
            <volume>1</volume>
            <fpage>255</fpage>
            <lpage>266</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1688249</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Genetic identification and genomic organization of factors affecting fruit texture</p>
            </title>
            <aug>
               <au>
                  <snm>Seymour</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Manning</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Popovich</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>J Exp Bot</source>
            <pubdate>2002</pubdate>
            <volume>53</volume>
            <fpage>2065</fpage>
            <lpage>2071</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jxb/erf087</pubid>
                  <pubid idtype="pmpid" link="fulltext">12324530</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>The <it>TM5 </it>MADS box gene mediates organ differentiation in the three inner whorls of tomato flowers</p>
            </title>
            <aug>
               <au>
                  <snm>Pnueli</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hareven</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Broday</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hurwitz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lifschitz</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>1994</pubdate>
            <volume>6</volume>
            <fpage>175</fpage>
            <lpage>186</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">160425</pubid>
                  <pubid idtype="pmpid">12244235</pubid>
                  <pubid idtype="doi">10.1105/tpc.6.2.175</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Down-regulation of <it>TM29</it>, a Tomato <it>SEPALLATA </it>homolog, Causes parthenocarpic fruit development and floral reversion</p>
            </title>
            <aug>
               <au>
                  <snm>Ampomah-Dwamena</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Sutherland</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Veit</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Yao</snm>
                  <fnm>J-L</fnm>
               </au>
            </aug>
            <source>Plant Physiol</source>
            <pubdate>2002</pubdate>
            <volume>130</volume>
            <fpage>605</fpage>
            <lpage>617</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">166590</pubid>
                  <pubid idtype="pmpid" link="fulltext">12376628</pubid>
                  <pubid idtype="doi">10.1104/pp.005223</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Characterization of MADS-box genes from hot pepper</p>
            </title>
            <aug>
               <au>
                  <snm>Sung</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Moon</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Chung</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>An</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Mol Cells</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <fpage>352</fpage>
            <lpage>359</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11459226</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>C. M. Rick Tomato Genetics Resource Center</p>
            </title>
            <url>http://tgrc.ucdavis.edu</url>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Structure and expression of elongation factor 1 alpha in tomato</p>
            </title>
            <aug>
               <au>
                  <snm>Pokalsky</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Haitt</snm>
                  <fnm>WR</fnm>
               </au>
               <au>
                  <snm>Ridge</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Rasmussen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Houck</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Shewmaker</snm>
                  <fnm>CK</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1989</pubdate>
            <volume>17</volume>
            <fpage>4661</fpage>
            <lpage>4673</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2748335</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Tomato contains homologues of <it>Arabidopsis </it>cryptochromes 1 and 2</p>
            </title>
            <aug>
               <au>
                  <snm>Perrotta</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ninu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Flamma</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Weller</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Kendrick</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Nebuloso</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Giuliano</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Plant Mol Biol</source>
            <pubdate>2000</pubdate>
            <volume>42</volume>
            <fpage>765</fpage>
            <lpage>773</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1006371130043</pubid>
                  <pubid idtype="pmpid">10809448</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Fungal-and plant-specific gene markers to follow the bean anthracnose infection process and normalize a bean chitinase mRNA induction</p>
            </title>
            <aug>
               <au>
                  <snm>Mahe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grisvard</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dron</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Plant-Microbe Interact</source>
            <pubdate>1992</pubdate>
            <volume>5</volume>
            <fpage>242</fpage>
            <lpage>248</lpage>
         </bibl>
         <bibl id="B63">
            <title>
               <p>TIGR TOMATO Gene Index</p>
            </title>
            <url>http://www.tigr.org/tdb/tgi/lgi/</url>
         </bibl>
      </refgrp>
   </bm>
</art>

