<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1471-2229-12-103</ui>
	<ji>1471-2229</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>Identification of three MAPKKKs forming a linear signaling pathway leading to programmed cell death in <it>Nicotiana benthamiana</it>
				</p>
			</title>
			<aug>
				<au id="A1"><snm>Hashimoto</snm><fnm>Masayoshi</fnm><insr iid="I1"/><email>ahashi@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A2"><snm>Komatsu</snm><fnm>Ken</fnm><insr iid="I1"/><email>akomatsu@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A3"><snm>Maejima</snm><fnm>Kensaku</fnm><insr iid="I1"/><email>amaejima@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A4"><snm>Okano</snm><fnm>Yukari</fnm><insr iid="I1"/><email>9889787606@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A5"><snm>Shiraishi</snm><fnm>Takuya</fnm><insr iid="I1"/><email>4199446278@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A6"><snm>Ishikawa</snm><fnm>Kazuya</fnm><insr iid="I1"/><email>3767539939@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A7"><snm>Takinami</snm><fnm>Yusuke</fnm><insr iid="I1"/><email>8276605485@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A8"><snm>Yamaji</snm><fnm>Yasuyuki</fnm><insr iid="I1"/><email>ayyamaji@mail.ecc.u-tokyo.ac.jp</email></au>
				<au id="A9" ca="yes"><snm>Namba</snm><fnm>Shigetou</fnm><insr iid="I1"/><email>anamba@mail.ecc.u-tokyo.ac.jp</email></au>
			</aug>
			<insg>
				<ins id="I1"><p>Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo, 113-8657, Japan</p></ins>
			</insg>
			<source>BMC Plant Biology</source>
			<section><title><p>Plant-biotic interactions</p></title></section><issn>1471-2229</issn>
			<pubdate>2012</pubdate>
			<volume>12</volume>
			<issue>1</issue>
			<fpage>103</fpage>
			<url>http://www.biomedcentral.com/1471-2229/12/103</url>
			<xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2229-12-103</pubid><pubid idtype="pmpid">22770370</pubid></pubidlist></xrefbib>
		</bibl>
		<history><rec><date><day>19</day><month>3</month><year>2012</year></date></rec><acc><date><day>26</day><month>6</month><year>2012</year></date></acc><pub><date><day>8</day><month>7</month><year>2012</year></date></pub></history>
		<cpyrt><year>2012</year><collab>Hashimoto et al.; licensee BioMed Central Ltd.</collab><note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note></cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st><p>The mitogen-activated protein kinase (MAPK) cascade is an evolutionarily ancient mechanism of signal transduction found in eukaryotic cells. In plants, MAPK cascades are associated with responses to various abiotic and biotic stresses such as plant pathogens. MAPK cascades function through sequential phosphorylation: MAPK kinase kinases (MAPKKKs) phosphorylate MAPK kinases (MAPKKs), and phosphorylated MAPKKs phosphorylate MAPKs. Of these three types of kinase, the MAPKKKs exhibit the most divergence in the plant genome. Their great diversity is assumed to allow MAPKKKs to regulate many specific signaling pathways in plants despite the relatively limited number of MAPKKs and MAPKs. Although some plant MAPKKKs, including the MAPKKK&#945; of <it>Nicotiana benthamiana</it> (NbMAPKKK&#945;), are known to play crucial roles in plant defense responses, the functional relationship among MAPKKK genes is poorly understood. Here, we performed a comparative functional analysis of MAPKKKs to investigate the signaling pathway leading to the defense response.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st><p>We cloned three novel MAPKKK genes from <it>N. benthamiana</it>: <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and <it>NbMAPKKK&#949;2</it>. Transient overexpression of full-length NbMAPKKK&#946; or NbMAPKKK&#947; or their kinase domains in <it>N. benthamiana</it> leaves induced hypersensitive response (HR)-like cell death associated with hydrogen peroxide production. This activity was dependent on the kinase activity of the overexpressed MAPKKK. In addition, virus-induced silencing of <it>NbMAPKKK&#946;</it> or <it>NbMAPKKK&#947;</it> expression significantly suppressed the induction of programmed cell death (PCD) by viral infection. Furthermore, in epistasis analysis of the functional relationships among NbMAPKKK&#946;, NbMAPKKK&#947;, and NbMAPKKK&#945; (previously shown to be involved in plant defense responses) conducted by combining transient overexpression analysis and virus-induced gene silencing, silencing of <it>NbMAPKKK&#945;</it> suppressed cell death induced by the overexpression of the NbMAPKKK&#946; kinase domain or of NbMAPKKK&#947;, but silencing of <it>NbMAPKKK&#946;</it> failed to suppress cell death induced by the overexpression of NbMAPKKK&#945; or NbMAPKKK&#947;. Silencing of <it>NbMAPKKK&#947;</it> suppressed cell death induced by the NbMAPKKK&#946; kinase domain but not that induced by NbMAPKKK&#945;.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusions</p>
					</st><p>These results demonstrate that in addition to NbMAPKKK&#945;, NbMAPKKK&#946; and NbMAPKKK&#947; also function as positive regulators of PCD. Furthermore, these three MAPKKKs form a linear signaling pathway leading to PCD; this pathway proceeds from NbMAPKKK&#946; to NbMAPKKK&#947; to NbMAPKKK&#945;.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st><p>Because plants lack an adaptive immune system, appropriate perceptions and responses of individual cells to various environmental stimuli, such as the biotic stress caused by phytopathogenic microorganisms, are critically important. The plant defense response against biotic stress is triggered by the recognition of conserved pathogen-associated molecular patterns (PAMPs) or of pathogen strain-specific factors known as elicitors or effectors <abbrgrp>
					<abbr bid="B1">1</abbr>
				</abbrgrp>. The response triggered by PAMPs is known as the basal defense response, whereas that triggered by specific elicitors is known as the hypersensitive response (HR). In the latter, an effector is recognized by a corresponding plant resistance (R) protein. The HR is frequently accompanied by programmed cell death (PCD), which plays a particularly important role in the defense against biotrophic pathogens but is also an essential function in normal plant development and differentiation <abbrgrp>
					<abbr bid="B2">2</abbr>
				</abbrgrp>. Although many plant components required for the PCD-associated HR have been identified, the entire signaling pathway leading to PCD has not been elucidated.</p><p>The mitogen-activated protein kinase (MAPK) cascade is a highly evolutionarily conserved signal transduction mechanism found in eukaryotic cells. Subsequent to activation of the cascade by various extracellular stimuli, the signal is transduced intracellularly by sequential phosphorylation. In plants, MAPK cascades are associated with developmental and hormonal responses and with stress responses to abiotic and biotic factors <abbrgrp>
					<abbr bid="B3">3</abbr>
				</abbrgrp>. A MAPK cascade consists of three functionally linked protein kinases: a MAPK is phosphorylated and activated by a MAPK kinase (MAPKK), which is in turn activated by an upstream MAPK kinase kinase (MAPKKK). Typical MAPK substrates are cytoplasmic or nuclear proteins, such as transcription factors <abbrgrp>
					<abbr bid="B3">3</abbr>
				</abbrgrp>. MAPKKKs are the most divergent of these three types of kinases in plants; the <it>Arabidopsis thaliana</it> genome contains approximately 60 MAPKKKs, 10 MAPKKs, and 20 MAPKs <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>.</p><p>Based on phylogenetic analysis of the amino acid sequences of their catalytic kinase domains, plant MAPKKKs have been classified into three groups: A, B, and C <abbrgrp>
					<abbr bid="B4">4</abbr>
				</abbrgrp>. Group A contains many MAPKKKs involved in PCD and stress and defense responses; e.g., <it>A. thaliana</it> AtMEKK1 is involved in the signaling pathway of basal defense induced by PAMPs <abbrgrp>
					<abbr bid="B5">5</abbr>
				</abbrgrp>, and <it>Medicago sativa</it> MsOMTK1 <abbrgrp>
					<abbr bid="B6">6</abbr>
				</abbrgrp> is involved in that of oxidative stress-induced cell death. Group A also includes MAPKKKs that have important functions in HR induction. Silencing of the genes encoding <it>Nicotiana tabacum</it> NPK1 (NtNPK1) and <it>Nicotiana benthamiana</it> MAPKKK&#945; (NbMAPKKK&#945;) suppresses the <it>N</it> gene-mediated HR induced by the helicase domain of tobacco mosaic virus (TMV) replicase and <it>Pto</it>-mediated HR induced by <it>Pseudomonas syringae</it> pv. tomato (Pst) effector avrPto, respectively <abbrgrp>
					<abbr bid="B7">7</abbr>
					<abbr bid="B8">8</abbr>
				</abbrgrp>. Recently, <it>N. benthamiana</it> NbMAPKKK&#949; and its tomato (<it>Solanum lycopersicum</it>) ortholog SlMAPKKK&#949; have been implicated in PCD induction in the HR against Gram-negative bacterial pathogens <abbrgrp>
					<abbr bid="B9">9</abbr>
				</abbrgrp>. In addition, silencing of the genes encoding the MAPKK MEK2 and the MAPK SIPK, both of which act downstream of NbMAPKKK&#945;, also attenuates the <it>N</it> gene-mediated HR against TMV <abbrgrp>
					<abbr bid="B10">10</abbr>
				</abbrgrp>. Conversely, silencing of the tomato orthologs of MAPKK MEK1 and MAPK NTF6, both of whose tobacco orthologs act downstream of NtNPK1in tobacco, leads to loss of the <it>Pto</it>-mediated HR in tomato <abbrgrp>
					<abbr bid="B11">11</abbr>
				</abbrgrp>. Therefore, the NtNPK1- and NbMAPKKK&#945;-initiated MAPK cascades are essential for both the <it>N</it> gene-mediated and the <it>Pto</it>-mediated HR, suggesting that at least two distinct MAPK cascades are involved in the regulation of a single HR event <abbrgrp>
					<abbr bid="B8">8</abbr>
				</abbrgrp>. Furthermore, it is now becoming apparent that two distinct MAPK cascades are involved in non-HR environmental responses <abbrgrp>
					<abbr bid="B12">12</abbr>
				</abbrgrp>.</p><p>Plants generally appear to use the same MAPKK/MAPK sets in different responses to environmental stimuli. The <it>A. thaliana</it> MAPKKs AtMKK4 and AtMKK5 and/or their downstream component MPK6 are involved not only in the signaling pathway for basal defense downstream of AtMEKK1 but also in ethylene production and stomata formation <abbrgrp>
					<abbr bid="B5">5</abbr>
					<abbr bid="B13">13</abbr>
					<abbr bid="B14">14</abbr>
				</abbrgrp>. Given the relatively limited number of MAPKKs and MAPKs in plants, the diversity of these responses (functions) is assumed to be possible due to the great diversity of MAPKKKs <abbrgrp>
					<abbr bid="B15">15</abbr>
					<abbr bid="B16">16</abbr>
				</abbrgrp>. Therefore, comparative functional analysis among MAPKKKs is needed to reveal the molecular mechanisms underlying a variety of responses to environmental stresses.</p><p>We previously showed that systemic necrosis, the disease symptom caused by plantago asiatica mosaic virus Li1 (PlAMV-Li1), was accompanied by resistance traits similar to HR. Using tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) <abbrgrp>
					<abbr bid="B17">17</abbr>
				</abbrgrp>, we demonstrated that NbSGT1 and NbRAR1, which are important in the HR, and the MAPK cascade including NbMAPKKK&#945;/NbMEK2, are essential for the induction of PCD-associated systemic necrosis induced by PlAMV-Li1 <abbrgrp>
					<abbr bid="B18">18</abbr>
					<abbr bid="B19">19</abbr>
				</abbrgrp>. This result and those described above led us to hypothesize that other MAPKKK genes in addition to NbMAPKKK&#945; are involved in the systemic necrosis induced by PlAMV-Li1.</p><p>In the present study, we isolated three novel group A MAPKKK genes from <it>N. benthamiana</it>, a model plant of the family Solanaceae, using an expressed sequence-tag (EST) database. The three cloned genes were designated <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and <it>NbMAPKKK&#949;2</it>. Further study revealed that NbMAPKKK&#946; and NbMAPKKK&#947; are positive regulators of PCD. In addition, the results of epistasis analysis performed using VIGS and agroinfiltration suggest that two of these MAPKKKs (NbMAPKKK&#946; and NbMAPKKK&#947;), together with NbMAPKKK&#945;, comprise a linear signaling pathway important in the induction of PCD.</p>
		</sec>
		<sec>
			<st>
				<p>Results</p>
			</st>
			<sec>
				<st>
					<p>Cloning of three novel group A MAPKKK genes from <it>Nicotiana benthamiana</it>
					</p>
				</st><p>To conduct a comparative analysis of the roles of MAPKKK genes in defense responses, we first sought to clone <it>N. benthamiana</it> MAPKKK genes belonging to group A. Group A includes four subgroups, A1&#8211;A4, and contains many genes involved in plant defense responses. To obtain one <it>N. benthamiana</it> MAPKKK gene homolog from each group A subgroup, we selected the following: the <it>Arabidopsis</it> MAPKKK genes <it>AtMEKK1</it>
					<abbrgrp>
						<abbr bid="B20">20</abbr>
					</abbrgrp>, <it>AtMAPKKK&#947;</it>, and <it>AtMAPKKK&#949;1</it>
					<abbrgrp>
						<abbr bid="B21">21</abbr>
						<abbr bid="B22">22</abbr>
					</abbrgrp> as representatives of the A1, A2, and A4 subgroups, respectively. For the A3 subgroup, which includes NtNPK1 <abbrgrp>
						<abbr bid="B23">23</abbr>
					</abbrgrp> and AtANP1, we were able to amplify <it>N. benthamiana</it> cDNA fragments using <it>NtNPK1</it>-specific primers; the amplified gene turned out to be 98.0% identical in nucleotide sequence to that encoding the NtNPK1 kinase domain, which has been well characterized for its role in defense responses <abbrgrp>
						<abbr bid="B7">7</abbr>
					</abbrgrp>. Therefore, the A3 subgroup was excluded from further study.</p><p>Using the nucleotide sequences encoding the highly conserved kinase domains of AtMEKK1 <abbrgrp>
						<abbr bid="B19">19</abbr>
					</abbrgrp>, AtMAPKKK&#947;, and AtMAPKKK&#949;1 as queries for BLAST searches against the <it>N. benthamiana</it>, <it>N. tabacum</it>, and <it>Solanum lycopersicum</it> EST databases, we obtained three EST sequences: <it>N. benthamiana</it> TC15397, <it>N. tabacum</it> BP133312, and <it>S. lycopersicum</it> BI931567, respectively. Based on these sequences, we designed specific primers to isolate full-length <it>N. benthamiana</it> MAPKKK cDNA clones, as described in the Materials and Methods. The cloned <it>N. benthamiana</it> MAPKKK genes are predicted to encode proteins with highly conserved kinase domains and more divergence in other regions, a general feature of plant MAPKKK genes <abbrgrp>
						<abbr bid="B4">4</abbr>
					</abbrgrp>.</p><p>Next, we used the amino acid sequences of the kinase domains of our newly cloned MAPKKKs and those of other previously identified MAPKKKs to construct a phylogenetic tree (Figure <figr fid="F1">1</figr>A). Our newly cloned MAPKKK genes were tentatively designated after the name of the most closely related genes in the phylogenetic tree. Thus, our A2 <it>MAPKKK</it> homolog was designated <it>NbMAPKKK&#947;</it> after <it>A. thaliana AtMAPKKK&#947;</it>. At a late phase of this study, an A4 <it>MAPKKK</it> homolog, <it>N. benthamiana NbMAPKKK&#949;</it>, was reported <abbrgrp>
						<abbr bid="B9">9</abbr>
					</abbrgrp>. Although our A4 homolog shares high sequence similarity with <it>NbMAPKKK&#949;</it>, the genes were not identical (96.6% or 95.0% identity at the nucleotide or amino acid level, respectively) and differed in length. Because these results indicated that A4 <it>MAPKKK</it> homologs in <it>N. benthamiana</it> consisted of at least two genes, our A4 homolog was designated <it>NbMAPKKK&#949;2</it> after <it>NbMAPKKK&#949;</it>. In fact, from the recently released <it>N. benthamiana</it> draft genome sequence (<url>http://solgenomics.net/</url>), only two contigs that show high sequence homology (about ~90%) with <it>NbMAPKKK&#949;2</it> were retrieved and each of these sequences corresponded to <it>NbMAPKKK&#949;2</it> and <it>NbMAPKKK&#949;</it>, respectively. Although our A1 <it>MAPKKK</it> homolog was most closely related to <it>MsOMTK1</it>, which was designated after the functional features of its gene products, designating this gene &#8220;<it>NbOMTK1</it>&#8221; was apparently incorrect, as we do not know if our A1 homologous gene product and MsOMTK1 have a similar function. The next most closely related genes were <it>AtMEKK1</it> and <it>Brassica napus BnMAPKKK&#946;1</it>. Therefore, our A1 homolog was designated <it>NbMAPKKK&#946;</it> after <it>BnMAPKKK&#946;1</it>, a gene of the A1 subgroup, in accordance with other newly cloned genes <it>NbMAPKKK&#947;</it> and <it>NbMAPKKK&#949;2</it>. The <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and <it>NbMAPKKK&#949;2</it> cDNA sequences determined in this study were deposited in the DNA Data Bank of Japan (DDBJ) under the accession numbers AB649283, AB649284, and AB649285, respectively.</p>
				<fig id="F1"><title><p>Figure 1</p></title><caption><p>Phylogenetic analysis of plant MAPKKK genes and structural features of novel <it>N. benthamiana</it> MAPKKK genes</p></caption><text>
   <p><b>Phylogenetic analysis of plant MAPKKK genes and structural features of novel </b><b><it>N. benthamiana </it></b><b>MAPKKK genes. A</b>) Phylogenetic tree for the kinase domain-encoding regions of group A MAPKKK genes. Numbers represent bootstrap scores. Names of genes used in this study are shown in boldface. Names of the three novel MAPKKK genes are underlined. <b>B</b>) Diagram of the domain structures of the three novel MAPKKK genes. ORFs are indicated by boxes. The 5&#8242;- and 3&#8242;-untranslated regions (UTRs) are shown as horizontal lines at the left and right, respectively, of the boxes. Shaded boxes and gray boxes indicate kinase domains and ARM domains, respectively. ORFs and UTRs are drawn to the same scale.</p>
</text><graphic file="1471-2229-12-103-1"/></fig><p>The domain structures of the three novel MAPKKK genes are shown in Figure <figr fid="F1">1</figr>B. The <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and <it>NbMAPKKK&#949;2</it> cDNA are 2477, 2794, and 4708 bp in length, respectively, and are respectively predicted to encode proteins of 564, 651, and 1395 amino acids. Kinase domains are found in the C-terminal regions of NbMAPKKK&#946; and NbMAPKKK&#947; and the N-terminal region of NbMAPKKK&#949;2. The C-terminal region of NbMAPKKK&#949;2 contains two ARM (armadillo/&#946;-catenin-like repeat) domains. The domain structures of these proteins are similar to those of their respective <it>A. thaliana</it> homologs.</p>
			</sec>
			<sec>
				<st>
					<p>Overexpression of the NbMAPKKK&#946; and NbMAPKKK&#947; kinase domains, but not the NbMAPKKK&#949;2 kinase domain, causes cell death</p>
				</st><p>Overexpression of the kinase domain of the tomato homolog of NbMAPKKK&#945;, SlMAPKKK&#945;, in <it>N. benthamiana</it> leaves by agroinfiltration has been reported to induce pathogen-independent cell death <abbrgrp>
						<abbr bid="B8">8</abbr>
					</abbrgrp>. To investigate whether our three newly identified MAPKKKs also possessed cell death-inducing activity, we performed transient overexpression analysis of each kinase domain using agroinfiltration. The transient overexpression of the kinase domains of NbMAPKKK&#946; and NbMAPKKK&#947; induced pathogen-independent cell death in the infiltrated area (Figure <figr fid="F2">2</figr>A). In the infiltrated areas, cell death was associated with significant hydrogen peroxide production, which is detected by a characteristic brown color that emerges upon 3,3'-diaminobenzidine (DAB) staining. These results were confirmed by measuring the extent of cell death using an ion leakage assay (Figure <figr fid="F2">2</figr>B), which showed significantly increased ion leakage in the NbMAPKKK&#946;- and NbMAPKKK&#947;-overexpressing areas. No significant difference in the level of ion leakage was observed for NbMAPKKK&#946; vs. NbMAPKKK&#947;. In contrast, overexpression of the kinase domain of NbMAPKKK&#949;2 failed to induce cell death or hydrogen peroxide production and failed to increase the level of ion leakage. Western blot analysis using anti-Myc monoclonal antibody (Millipore, Billerica, MA, USA) was performed to assess the expression levels of these kinase domains (Figure <figr fid="F2">2</figr>C). Specific signals of NbMAPKKK&#946; and NbMAPKKK&#949;2 kinase domains were detected, but no accumulation of NbMAPKKK<it>&#947;</it> kinase domain was found. However, we suppose that the NbMAPKKK<it>&#947;</it> kinase domain was accurately expressed, even at very low levels, because its overexpression rapidly induced cell death. Western blot analysis also showed that the accumulated expression level of NbMAPKKK&#949;2 kinase domain, whose overexpression did not induce cell death, was much greater than the expression levels of the NbMAPKKK&#946; and NbMAPKKK&#947; kinase domains. Because these results indicated that NbMAPKKK&#949;2 is not involved in the induction of pathogen-independent cell death, we excluded NbMAPKKK&#949;2 from further analysis.</p>
				<fig id="F2"><title><p>Figure 2</p></title><caption><p>Overexpression of NbMAPKKK&#946; and NbMAPKKK&#947; induces pathogen-independent cell death in <it>N. benthamiana</it> leaves</p></caption><text>
   <p><b>Overexpression of NbMAPKKK&#946; and NbMAPKKK&#947; induces pathogen-independent cell death in </b><b><it>N. benthamiana </it></b><b>leaves. </b><it>N. benthamiana </it> leaves were infiltrated with <it>Agrobacterium </it> strains carrying pEarleyGate203 vector <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> derivatives harboring the coding sequences for mutant or full-length MAPKKKs. All experiments, except that shown in Figure <figr fid="F4">4</figr>, were repeated at least three times with similar results. <b>A</b>) Symptoms of infiltrated <it>N. benthamiana</it> leaf areas overexpressing the indicated MAPKKK kinase domain (KDs) or ATP-binding site-deficient (K&#8201;&#8594;&#8201;M) KD mutants. Images of the same leaves after DAB staining are shown in the lower panels. DAB staining to detect hydrogen peroxide production was performed as previously described <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Pictures were taken 5 days post-infiltration (dpi). Each protein was transiently co-expressed with silencing suppressor p19. <it>Agrobacterium</it> cultures were grown to a turbidity (OD<sub>600</sub>) of 0.5 for use in agroinfiltration. <b>B</b>) Ion leakage in the infiltrated leaf areas overexpressing wild-type or K&#8201;&#8594;&#8201;M mutant NbMAPKKK&#946; or NbMAPKKK&#947; or their wild-type or K&#8201;&#8594;&#8201;M mutant KDs or NbMAPKKK&#949;2 KD. GUS and NbMAPKKK&#945; were used as internal controls. The ion leakage assay was performed as previously described <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Data shown represent means&#8201;&#177;&#8201;standard deviation of at least three independent plants. <b>C</b>) Western blot analysis of Myc-tagged NbMAPKKK&#946; or NbMAPKKK&#947; KDs or their K&#8201;&#8594;&#8201;M mutants or NbMAPKKK&#949;2 KD. Myc-tagged GUS was used as an internal control. Total proteins were extracted from each gene-infiltrated area at 5 dpi. Two replicates are shown for each Myc-tagged construct. <b>D</b>) Symptoms of infiltrated leaf areas overexpressing full-length wild-type or K&#8201;&#8594;&#8201;M mutant NbMAPKKK&#946; or NbMAPKKK&#947;. Images of the same leaves after DAB staining are shown in the lower panels.</p>
</text><graphic file="1471-2229-12-103-2"/></fig>
			</sec>
			<sec>
				<st>
					<p>Overexpression of full-length, catalytically active NbMAPKKK&#946; or NbMAPKKK&#947; causes cell death</p>
				</st><p>To further investigate the involvement of NbMAPKKK&#946; and NbMAPKKK&#947; in pathogen-independent cell death, we conducted transient overexpression experiments using their full-length open reading frames (ORFs). As shown in Figure <figr fid="F2">2</figr>D, overexpression of NbMAPKKK&#946; or NbMAPKKK<it>&#947;</it> induced cell death. The observed level of ion leakage was similar for overexpression of NbMAPKKK&#946;, NbMAPKKK&#947;, and NbMAPKKK&#945;, which was used as a positive control (Figure <figr fid="F2">2</figr>B).</p><p>Several previous studies have demonstrated that kinase activity is required for the triggering of pathogen-independent cell death by transient overexpression of a component of a MAPK cascade <abbrgrp>
						<abbr bid="B8">8</abbr>
						<abbr bid="B24">24</abbr>
						<abbr bid="B25">25</abbr>
					</abbrgrp>. To examine whether NbMAPKKK&#946;- and NbMAPKKK&#947;-induced cell death also required kinase activity, we constructed full-length and kinase domain MAPKKK mutants deficient in ATP binding. In these mutants, the essential conserved lysine residue (K) in the ATP-binding site of the kinase domain was replaced with a methionine (M) <abbrgrp>
						<abbr bid="B8">8</abbr>
					</abbrgrp>. As shown in Figure <figr fid="F2">2</figr>A and <figr fid="F2">2</figr>D, none of these K&#8201;&#8594;&#8201;M mutants induced cell death when overexpressed. This result was confirmed by DAB staining (Figure <figr fid="F2">2</figr>A and <figr fid="F2">2</figr>D) and ion leakage assays (Figure <figr fid="F2">2</figr>B). Also, the expression of these kinase domain K&#8201;&#8594;&#8201;M mutants was confirmed by western blot analysis with anti-Myc monoclonal antibody (Figure <figr fid="F2">2</figr>C). These results indicate that cell death induced by the transient overexpression of <it>N. benthamiana</it> NbMAPKKK&#946; or NbMAPKKK&#947; is dependent on their kinase activities.</p>
			</sec>
			<sec>
				<st>
					<p>Silencing of <it>NbMAPKKK&#946;</it> or <it>NbMAPKKK&#947;</it> suppresses PlAMV-Li1-induced PCD</p>
				</st><p>In light of the above finding that overexpression of full-length NbMAPKKK&#946; or NbMAPKKK&#947; or their kinase domains can induce cell death, we expected that silencing of the genes encoding these MAPKKKs would suppress virally induced PCD. Therefore, we used a TRV-based VIGS system <abbrgrp>
						<abbr bid="B17">17</abbr>
					</abbrgrp> to silence <it>NbMAPKKK&#946;</it> and <it>NbMAPKKK&#947;</it>. Successful silencing of each gene was confirmed by analyzing the expression of <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and <it>NbMAPKKK&#945;</it> (control) using real-time reverse transcription (RT)-PCR analysis (Figure <figr fid="F3">3</figr>A). Also, Southern blot analyses using a kinase domain-specific probe of each gene revealed that <it>NbMAPKKK&#946;</it> and <it>NbMAPKKK&#947;</it> exist as single-copy and multiple-copy genes, respectively, in the <it>N. benthamiana</it> genome (Additional file <supplr sid="S1">1</supplr>: Figure S1). In the <it>N. benthamiana</it> draft genome, two contigs showing high sequence homology (about &gt;90%) with <it>NbMAPKKK&#947;</it> were obtained, suggesting that there are at least two copies of <it>NbMAPKKK&#947;</it> homologs. Thus, we assume that a single gene is specifically targeted in <it>NbMAPKKK&#946;</it>-silenced plants, but one or more highly similar genes might be targeted in <it>NbMAPKKK&#947;</it>-silenced plants. Hereafter, we use the term &#8220;<it>NbMAPKKK&#947;</it>&#8221; to indicate <it>NbMAPKKK&#947;</it> and/or its homologous gene(s) except for transient overexpression experiments. The gene-silenced plants did not display any obvious phenotypic differences compared with non-silenced (VIGS vector) control plants (Figure <figr fid="F3">3</figr>B), suggesting that neither NbMAPKKK&#946; nor NbMAPKKK&#947; is involved in normal plant growth and development. In contrast, silencing of NtNPK1, a MAPKKK involved in cell plate formation in plant cytokinesis and in <it>N</it> gene-mediated HR cell death, causes severe stunting of plants <abbrgrp>
					<abbr bid="B7">7</abbr>
				</abbrgrp>.</p>
			<suppl id="S1">
				<title>
					<p>Additional file 1</p>
				</title>
				<text>
					<p>
						<b>Figure S1.</b> Southern blot analysis of <b>A</b>) <it>NbMAPKKK&#946;</it> and <b>B</b>) <it>NbMAPKKK&#947;</it> using kinase domain-specific DNA probes. DNA probes were generated by using the PCR DIG Probe Synthesis Kit (Roche, Basel, Switzerland) according to the manufacturer&#8217;s instructions. Each lane was loaded with 5 &#956;g of total genomic DNA digested with each restriction enzyme. </p>
				</text>
				<file name="1471-2229-12-103-S1.pdf">
   <p>Click here for file</p>
</file>
			</suppl>
			<fig id="F3"><title><p>Figure 3</p></title><caption><p>Silencing of <it>NbMAPKKK&#946;</it> and <it>NbMAPKKK&#947;</it> suppresses PlAMV-Li1-induced PCD</p></caption><text>
   <p><b>Silencing of </b><b><it>NbMAPKKK&#946; </it></b><b>and </b><b><it>NbMAPKKK&#947; </it></b><b>suppresses PlAMV-Li1-induced PCD. A</b>) Confirmation of specific MAPKKK gene silencing in gene-silenced plants. The relative quantities of <it>NbMAPKKK&#945;</it>, <it>NbMAPKKK&#946;</it>, and <it>NbMAPKKK&#947;</it> mRNA in non-silenced or <it>NbMAPKKK&#945;</it>-, <it>NbMAPKKK&#946;-</it>, or <it>NbMAPKKK&#947;</it>-silenced plants were measured using real-time RT-PCR. The data for each leaf tissue sample were normalized to the Nb18S rRNA gene expression level in the same sample. Data shown represent means&#8201;&#177;&#8201;standard deviation of at least three independent plants. Asterisks indicate statistically significant differences from control plants (<it>P</it>&#8201;&lt;&#8201;0.05). <b>B</b>) Typical phenotypes observed in non-silenced and <it>NbMAPKKK&#946;</it>- and <it>NbMAPKKK&#947;</it>-silenced plants. Pictures were taken 21 dpi. <b>C</b>) Symptoms in the PlAMV-Li1-infiltrated areas of non-silenced and <it>NbMAPKKK&#946;</it>- or <it>NbMAPKKK&#947;</it>-silenced plants (upper panels) and DAB staining of the same leaves (lower panels). Red circles indicate cell death; yellow circles indicate no symptoms. Leaves were infiltrated with a PlAMV-Li1-expressing <it>Agrobacterium</it> culture grown to a turbidity (OD<sub>600</sub>) of 0.05. <b>D</b>) Ion leakage in the PlAMV-Li1-infiltrated areas of non-silenced and <it>NbMAPKKK&#946;</it>- or <it>NbMAPKKK&#947;</it>- silenced plants. Data shown represent means&#8201;&#177;&#8201;standard deviation of at least three independent plants. Asterisks indicate statistically significant differences from control plants (<it>P</it>&#8201;&lt;&#8201;0.05).</p>
</text><graphic file="1471-2229-12-103-3"/></fig><p>
				<it>NbMAPKKK&#946;</it>- and <it>NbMAPKKK&#947;</it>-silenced plants and control non-silenced plants were subsequently inoculated with PlAMV-Li1, which induces PCD-associated necrosis in <it>N. benthamiana</it>. In the PlAMV-Li1-infiltrated areas of non-silenced plants, we observed characteristic necrotic symptoms and brown color staining, indicating the accumulation of hydrogen peroxide. However, in the Li1-infiltrated <it>NbMAPKKK&#946;</it>-silenced plants, cell death and hydrogen peroxide production were completely compromised. Also, in <it>NbMAPKKK&#947;</it>-silenced plants, cell death and hydrogen peroxide production were suppressed completely and partially, respectively, despite only about 20% decrease in the abundance of <it>NbMAPKKK&#947;</it> transcripts (Figure <figr fid="F3">3</figr>C). Suppression of cell death in the <it>NbMAPKKK&#946;</it>- and <it>NbMAPKKK&#947;</it>-silenced plants was confirmed using ion leakage assays (Figure <figr fid="F3">3</figr>D). The suppression of cell death in <it>NbMAPKKK&#947;</it>-silenced plants despite the slight decrease in its mRNA can be explained by a strict requirement of a high level of NbMAPKKK&#947; protein in cell death. Although it is possible that residual NbMAPKKK&#947; protein contributes to the decreased level of hydrogen peroxide production, its level might be too low to induce cell death. These results indicate that NbMAPKKK&#946; and NbMAPKKK&#947; are involved in hydrogen peroxide production and PCD induced by PlAMV-Li1.</p>
		</sec>
		<sec>
			<st>
				<p>NbMAPKKK&#945;, NbMAPKKK&#946;, and NbMAPKKK&#946; form a linear signaling pathway that induces cell death</p>
			</st><p>Together with the findings of our previous study showing that NbMAPKKK&#945; is involved in PlAMV-Li1-induced PCD <abbrgrp>
					<abbr bid="B19">19</abbr>
				</abbrgrp>, the above findings demonstrate that <it>NbMAPKKK&#946;</it> and <it>NbMAPKKK&#947;</it> are also essential for this virally induced PCD. To determine the relationships among these three genes in the PCD signaling pathway, we designed epistasis experiments combining transient overexpression and silencing of combinations of these genes. In these experiments, plants with a specific VIGS-silenced MAPKKK gene were agroinfiltrated with an <it>Agrobacterium</it> culture expressing a different MAPKKK gene, and the level of ion leakage was measured. Prior to the epistasis experiments, a preliminary experiment was performed to determine the minimum turbidity of <it>Agrobacterium</it> inoculum for each gene sufficient to induce complete cell death. Complete cell death was observed at the following cell densities at OD<sub>600</sub>: 0.5, NbMAPKKK&#945;; 1.0, NbMAPKKK&#946;; and 0.05, NbMAPKKK&#947;. Although each MAPKKK was overexpressed at different concentrations of <it>Agrobacterium</it> inocula, no significant difference in the basal ion leakage level was observed among the different turbidities (ranging from 0.05 to 1.0) of <it>Agrobacterium</it> inocula that expressed the GUS gene in wild-type plants (Additional file <supplr sid="S2">2</supplr>: Figure S2). For NbMAPKKK&#946;, cell death induced by both the full-length ORF and kinase domain was slow and weak, but cell death induced by the kinase domain was more often observed than that induced by the full-length ORF. In the ion leakage assay shown in Figure <figr fid="F2">2</figr>B, this tendency was detected, although the difference in cell death induced by the full-length ORF and kinase domain of NbMAPKKK&#946; was not statistically significant. Previous reports have shown that the substrate specificity of MAPKKK is not affected when only the kinase domain is transiently activated <abbrgrp>
					<abbr bid="B5">5</abbr>
					<abbr bid="B8">8</abbr>
					<abbr bid="B26">26</abbr>
				</abbrgrp>. Hence, the kinase domain of NbMAPKKK&#946; was used for further analysis, instead of the full-length ORF.</p>
			<suppl id="S2">
				<title>
					<p>Additional file 2</p>
				</title>
				<text>
					<p>
						<b>Figure S2.</b> Ion leakage of GUS-infiltrated areas. An <it>Agrobacterium</it> strain expressing the GUS gene using the 35 S promoter was infiltrated at the following turbidities: 0.05, 0.5, and 1.0. </p>
				</text>
				<file name="1471-2229-12-103-S2.pdf">
   <p>Click here for file</p>
</file>
			</suppl><p>As shown in Figure <figr fid="F4">4</figr>A, ion leakage levels induced by transient expression of the NbMAPKKK&#946; kinase domain or full-length NbMAPKKK&#947; were lower in <it>NbMAPKKK&#945;</it>-silenced plants than in VIGS vector-only control plants. Cell death induced by both NbMAPKKK&#946; and NbMAPKKK&#947; was consistently significantly suppressed in <it>NbMAPKKK&#945;</it>-silenced plants compared to control plants (data not shown). This result suggests that NbMAPKKK&#945; either acts downstream of both NbMAPKKK&#946; and NbMAPKKK&#947; in cell death induction or plays an essential role in codependent activation of both NbMAPKKK&#946; and NbMAPKKK&#947;. In contrast, the ion leakage levels induced by transient expression of full-length NbMAPKKK&#945; or NbMAPKKK&#947; were similar in <it>NbMAPKKK&#946;</it>-silenced plants and control plants (Figure <figr fid="F4">4</figr>B), suggesting that NbMAPKKK&#945; and NbMAPKKK&#946; are not codependent in their activation; rather, NbMAPKKK&#946; functions upstream of NbMAPKKK&#945; in the cell death signaling pathway. This result led us to postulate that NbMAPKKK&#946; functions upstream of NbMAPKKK&#947;. As expected, in <it>NbMAPKKK&#947;</it>-silenced plants, cell death and the ion leakage level induced by the transient overexpression of the NbMAPKKK&#946; kinase domain were significantly compromised compared to control plants (data not shown and Figure <figr fid="F4">4</figr>C, respectively). Cell death and the ion leakage induced by transient overexpression of NbMAPKKK&#945;, however, were similar in <it>NbMAPKKK&#947;</it>-silenced and control plants (data not shown and Figure <figr fid="F4">4</figr>C, respectively), confirming that NbMAPKKK&#946; functions upstream of NbMAPKKK&#947; and that NbMAPKKK&#947; functions upstream of NbMAPKKK&#945;. In this epistasis analysis, ion leakage levels were closely associated with the intensity of cell death at all combinations of these genes. Thus, these three MAPKKK genes form a linear signaling pathway leading to PCD in which NbMAPKKK&#946; and NbMAPKKK&#945; function as the furthest upstream and downstream components, respectively, of the three MAPKKK components.</p>
			<fig id="F4"><title><p>Figure 4</p></title><caption><p>Epistasis analysis of the functional relationships among NbMAPKKK&#945;, NbMAPKKK&#946;, and NbMAPKKK&#947;</p></caption><text>
   <p><b>Epistasis analysis of the functional relationships among NbMAPKKK&#945;, NbMAPKKK&#946;, and NbMAPKKK&#947;.</b> Epistasis analysis was performed by combining functional activation and suppression of specific combinations of MAPKKKs using transient overexpression and VIGS, respectively. Cell death in infiltrated areas was quantified using ion leakage assays at 4 dpi. Data shown represent means&#8201;&#177;&#8201;standard deviation for at least five plants. Asterisks indicate statistically significant differences from control plants (<it>P</it>&#8201;&lt;&#8201;0.05). All experiments described in this figure were repeated two times with similar results. <b>A</b>) Cell death in the NbMAPKKK&#946; kinase domain (&#946;kinase)- or NbMAPKKK&#947; (&#947;ORF)-overexpressing areas of non-silenced and <it>NbMAPKKK&#945;</it>-silenced plants. <it>Agrobacterium</it> cultures expressing &#946;kinase and &#947;ORF were grown to a turbidity of 1.0 and 0.05, respectively, for infiltration. <b>B</b>) Cell death in the NbMAPKKK&#945; (&#945;ORF)- or &#947;ORF-overexpressing areas of non-silenced and <it>NbMAPKKK&#946;</it>-silenced plants. <it>Agrobacterium</it> cultures expressing &#945;ORF and &#947;ORF were grown to a turbidity of 0.5 or 0.05, respectively, for infiltration. <b>C</b>) Cell death in the &#945;ORF- or &#946;kinase-overexpressing areas of non-silenced and <it>NbMAPKKK&#947;</it>-silenced plants. <it>Agrobacterium</it> cultures expressing &#945;ORF and &#946;kinase were grown to a turbidity of 0.5 or 1.0, respectively, for infiltration.</p>
</text><graphic file="1471-2229-12-103-4"/></fig>
		</sec>
	</sec>
	<sec>
		<st>
			<p>Discussion</p>
		</st><p>In our previous study <abbrgrp>
				<abbr bid="B19">19</abbr>
			</abbrgrp>, we showed that a MAPK cascade including NbMAPKKK&#945; and NbMEK2 is required for both the PCD-associated systemic necrosis induced by PlAMV-Li1 and the <it>Rx</it>-mediated HR against potato virus X. Several studies have demonstrated that at least two MAPK cascades are involved in plant responses to various environmental stimuli <abbrgrp>
				<abbr bid="B8">8</abbr>
				<abbr bid="B12">12</abbr>
			</abbrgrp>. The great diversity of plant MAPKKK genes is assumed to underlie the ability of plants to mount specific signaling responses to various environmental stimuli <abbrgrp>
				<abbr bid="B15">15</abbr>
				<abbr bid="B16">16</abbr>
			</abbrgrp>. Therefore, to better understand the functions of MAPKKKs in the induction of PCD, we performed a comparative functional analysis of <it>N. benthamiana</it> MAPKKK genes. In the previous and present study, we demonstrated that three of these genes, <it>NbMAPKKK&#945;</it>
			<abbrgrp>
				<abbr bid="B19">19</abbr>
			</abbrgrp>, <it>NbMAPKKK&#946;</it>, and <it>NbMAPKKK&#947;</it> (and/or its homologs), function as positive regulators of PlAMV-Li1-induced PCD and are not functionally redundant in the cell death signaling pathway. In the VIGS experiments, not only <it>NbMAPKKK&#947;</it> but also its homologous gene(s) were presumably knocked down in TRV-<it>NbMAPKKK&#947;</it>-infected plants. However, only one gene in the A2 subgroup was obtained from the cloning experiments, suggesting that <it>NbMAPKKK&#947;</it> homologous gene(s), which carries almost the same sequence as <it>NbMAPKKK&#947;</it> itself, must be effectively knocked down in TRV-<it>NbMAPKKK&#947;</it>-infected plants. In addition, overexpression of the <it>NbMAPKKK&#947;</it> full-length ORF and kinase domain could induce rapid cell death. Therefore, NbMAPKKK&#947; itself could play an important role in the cell death signaling pathway.</p><p>We also explored the functional relationship among these three MAPKKK genes by performing an epistasis experiment based on the assumption that if signaling protein A functions upstream of signaling protein B, signaling by activated A will be suppressed by silencing of B expression, whereas signaling by activated B will not be suppressed by silencing of A expression. Our results (Figure <figr fid="F4">4</figr>) demonstrate that NbMAPKKK&#945;, NbMAPKKK&#946;, and NbMAPKKK&#947;, which represents NbMAPKKK&#947; and/or its homologous gene(s), form a linear signaling pathway leading to cell death induction in which NbMAPKKK&#946; acts upstream of NbMAPKKK&#947; and NbMAPKKK&#947; acts upstream of NbMAPKKK&#945;. Results of a similar epistasis analysis have suggested that an NPK1/MEK1/NTF6 MAPK cascade functions downstream of a MAPKKK&#945;/MEK2/SIPK MAPK cascade in the induction of PCD in plants <abbrgrp>
				<abbr bid="B8">8</abbr>
			</abbrgrp>. These results support the possibility that NbMAPKKK&#945;, NbMAPKKK&#946;, NbMAPKKK&#947;, and NPK1 initiate four distinct MAPK cascades that are coordinately involved in plant cell death. Alternatively, different sets of MAPK cascades might be involved in cell death signaling pathways induced by different plant&#8211;microbe interactions. To investigate this issue, further research is needed to determine whether NbMAPKKK&#946; and NbMAPKKK&#947; participate in the <it>N</it> gene-mediated HR against TMV or in the <it>Pto</it>-mediated HR against Pst.</p><p>In our experiments, the transient overexpression of the NbMAPKKK&#949;2 kinase domain by agroinfiltration did not induce cell death (Figure <figr fid="F2">2</figr>A). However, Melech-Bonfil and associates have shown that the tomato homolog of NbMAPKKK&#949;2, SlMAPKKK&#949;, is required for PCD induction in the HR against Gram-negative bacterial pathogens <abbrgrp>
				<abbr bid="B9">9</abbr>
			</abbrgrp>. Furthermore, they showed that the transient overexpression of the tomato SlMAPKKK&#949; kinase domain in <it>N. benthamiana</it> induces pathogen-independent cell death. A comparison between the amino acid sequences of the kinase domains of NbMAPKKK&#949;2 and SlMAPKKK&#949; indicated only three amino acid differences. These three residues are not highly conserved and are not predicted to be essential for plant kinase catalytic activity, so explaining this functional difference solely by the amino acid sequence level is difficult. Although at first glance, our results seem to contradict theirs, the results cannot be directly compared because three factors in our transient overexpression experiments differed from theirs: promoters, <it>Agrobacterium</it> strains, and species origin of the homologous genes. These three factors, which could influence the expression levels of overexpressed proteins, are critical for the execution of cell death elicited by proteins possessing cell death-inducing activity <abbrgrp>
				<abbr bid="B27">27</abbr>
				<abbr bid="B28">28</abbr>
			</abbrgrp>. Moreover, the amount of overexpressed NbMAPKKK&#949;2 kinase domain in our experiment was much more than the amounts of NbMAPKKK&#946; kinase domain and its K&#8201;&#8594;&#8201;M mutant or NbMAPKKK&#947; kinase domain that can induce cell death and was comparable to the amount of the NbMAPKKK&#947; kinase domain K&#8201;&#8594;&#8201;M mutant. Therefore, NbMAPKKK&#949;2 might be a less potent inducer of cell death than other MAPKKKs.</p><p>Our suggestion that several MAPK cascades function in a linear signaling pathway in the induction of cell death raises a concern about their roles in plant defense responses. To prevent pathogen invasion, plants commonly employ two types of receptors [NBS-LRR (nucleotide-binding site and leucine-rich repeat) receptors and RLK (receptor-like kinase)-type receptors] <abbrgrp>
				<abbr bid="B1">1</abbr>
			</abbrgrp> to sense multiple PAMPs or effectors derived from biotrophic and necrotrophic pathogens. When plants perceive pathogens, the transcription of a common set of genes that act against various types of pathogens is activated <abbrgrp>
				<abbr bid="B29">29</abbr>
				<abbr bid="B30">30</abbr>
			</abbrgrp>, subsequently producing many defense responses, including cell death and the production of low-molecular-weight signaling compounds such as ethylene and reactive oxygen species (ROS). Activation of the MAPKKK&#945;/MEK2/SIPK cascade can induce production of ethylene and ROS <abbrgrp>
				<abbr bid="B31">31</abbr>
				<abbr bid="B32">32</abbr>
			</abbrgrp>. NPK1, which initiates another MAPK cascade, is activated by the ROS produced by the MAPK cascade initiated by MAPKKK&#945; <abbrgrp>
				<abbr bid="B26">26</abbr>
			</abbrgrp>. Similarly, the alfalfa MAPKKK MsOMTK1 is activated by hydrogen peroxide <abbrgrp>
				<abbr bid="B6">6</abbr>
			</abbrgrp>. These results suggest that compounds induced by an upstream-acting MAPK cascade function as signaling molecules that activate a downstream-acting MAPK cascade. In addition, they suggest that the involvement of several MAPK cascades in defense responses enables plants to activate various responses simultaneously or coordinately to combat various types of pathogens.</p>
	</sec>
	<sec>
		<st>
			<p>Conclusions</p>
		</st><p>In this study, we demonstrated that three MAPKKKs in <it>N. benthamiana</it> form a linear signaling pathway leading to PCD, implying that the involvement of multiple MAPK cascades in plant defense responses enables plants to exhibit various reactions simultaneously. Further analysis to identify downstream MAPKK and MAPK genes directly phosphorylated by NbMAPKKK&#946; and NbMAPKKK&#947; should help clarify the regulatory mechanisms of cell death involving these MAPKKK genes. Furthermore, to elucidate the mechanisms underlying the sequential activation of each MAPK cascade during plant defense responses, the upstream components or chemical compounds that directly activate these MAPKKKs must be identified.</p>
	</sec>
	<sec>
		<st>
			<p>Methods</p>
		</st>
		<sec>
			<st>
				<p>Plant materials and virus isolate</p>
			</st><p>
				<it>N. benthamiana</it> plants were grown in a growth chamber at 25 &#176;C. To virally induce PCD, plants were inoculated with the binary vector pLi1, which contains the full-length cDNA of the Li1 isolate of plantago asiatica mosaic virus (PlAMV) downstream of the cauliflower mosaic virus 35 S promoter <abbrgrp>
					<abbr bid="B33">33</abbr>
				</abbrgrp>.</p>
		</sec>
		<sec>
			<st>
				<p>Cloning of MAPKKK genes from <it>N. benthamiana</it>
				</p>
			</st><p>To retrieve partial MAPKKK cDNA sequences, a BLAST search was performed using the amino acid sequences of the kinase domains of the <it>Arabidopsis</it> MAPKKK genes <it>AtMEKK1</it>, <it>AtMAPKKK&#947;</it>, and <it>AtMAPKKK&#949;1</it> as queries against the <it>N. benthamiana</it>, <it>N. tabacum</it>, and <it>S. lycopersicum</it> databases of the Gene Index Project at the Computational Biology and Functional Genomics Laboratory Web site (<url>http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/Blast/index.cgi</url>) and the tobacco BY-2 EST clone database of the RIKEN BioResource Center (<url>http://www.brc.riken.go.jp/lab/epd/blast/index.shtml</url>). The consensus nucleotide sequences for the retrieved partial cDNA sequences and query sequences were used to design a pair of specific primers for each of the three MAPKKK genes. Each pair of specific primers was used for RT-PCR amplification of a cDNA fragment from total RNA extracted from <it>N. benthamiana</it> leaves. The RT-PCR products were gel-purified and cloned into the pGEM-T easy vector (Promega, Madison, WI, USA) for sequencing. New primers were then designed based on the regions of the obtained cDNA sequences that were nonhomologous to the query sequences (to prevent nonspecific amplification) and used for specific 5&#8242;- and 3&#8242;-rapid amplification of cDNA ends (RACE) using a GeneRacer Kit (Invitrogen, Carlsbad, CA, USA) according to the standard protocol provided by the manufacturer. The sequences of primers used in this study are listed in Table <tblr tid="T1">1</tblr>. cDNA sequences of these MAPKKK genes were determined from at least three independent clones.</p>
			<table id="T1">
				<title>
					<p>Table 1</p>
				</title>
				<caption>
					<p>
						<b>Primers used in this study</b>
					</p>
				</caption>
				<tgroup align="left" cols="3">
					<colspec align="left" colname="c1" colnum="1" colwidth="1*"/>
					<colspec align="left" colname="c2" colnum="2" colwidth="1*"/>
					<colspec align="left" colname="c3" colnum="3" colwidth="1*"/>
					<thead valign="top">
						<row rowsep="1">
							<entry colname="c1">
								<p>
									<b>Name</b>
								</p>
							</entry>
							<entry colname="c2">
								<p>
									<b>Sequence (5&#8217;-3&#8217;)</b>
								</p>
							</entry>
							<entry colname="c3">
								<p>
									<b>Comments</b>
								</p>
							</entry>
						</row>
					</thead>
					<tbody valign="top">
						<row>
							<entry colname="c1">
								<p>NbTC9992-1F</p>
							</entry>
							<entry colname="c2">
								<p>GCTGTCAAAGAAGTGTCATTA</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for TC9992</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbTC9992-1280R</p>
							</entry>
							<entry colname="c2">
								<p>ACCGTTTATTAATCACTATATTGC</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for TC9992</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-1 F</p>
							</entry>
							<entry colname="c2">
								<p>CTTAATGGGCAAGCAGCTAATC</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-447R</p>
							</entry>
							<entry colname="c2">
								<p>TCAAGATTGTATGTTGTCTGCTC</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-123F</p>
							</entry>
							<entry colname="c2">
								<p>GTTGCAATTAAACAAGTTTCTCTGGA</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for BI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-658R</p>
							</entry>
							<entry colname="c2">
								<p>GGCTGAAGATCATAGTACGG</p>
							</entry>
							<entry colname="c3">
								<p>Specific primer for BI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbTC9992-458R-5RACE</p>
							</entry>
							<entry colname="c2">
								<p>GCTTGTCCATAGCCTTGGTTCTTCCT</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for TC9992</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbTC9992-49R-5RACE</p>
							</entry>
							<entry colname="c2">
								<p>TTTGCCTTCCCCCATCGCCTTGAT</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for TC9992</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbTC9992-F1</p>
							</entry>
							<entry colname="c2">
								<p>GGATTGGAAAGGGGGAACCT</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtMAP3Kb-566F</p>
							</entry>
							<entry colname="c2">
								<p>TCCGCCGGTCATGTCACT</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-199R-5RACE</p>
							</entry>
							<entry colname="c2">
								<p>ACATGGCTGCAGCTGCTTCATATTC</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-91R-nested</p>
							</entry>
							<entry colname="c2">
								<p>TACTATCCTTCTGCATAACTGACTGCAA</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-333F-5RACE</p>
							</entry>
							<entry colname="c2">
								<p>GAGAATCTCTCATCAGCCAGATGTTC</p>
							</entry>
							<entry colname="c3">
								<p>3&#8217;-RACE for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-375F-nested</p>
							</entry>
							<entry colname="c2">
								<p>CAAACCTGTTGGTGGGGTACGAAT</p>
							</entry>
							<entry colname="c3">
								<p>3&#8217;-RACE for BP133312</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-F1</p>
							</entry>
							<entry colname="c2">
								<p>AGACGCGCATAATTCGCATC</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NtBP1333-R1</p>
							</entry>
							<entry colname="c2">
								<p>TGAGCTCTCGTTTGGTAATAAG</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-507R-5RACE</p>
							</entry>
							<entry colname="c2">
								<p>CATCTGCCTCTGTCAACTTTGTTGCA</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for LeBI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-165R-nested</p>
							</entry>
							<entry colname="c2">
								<p>CCTCCTGAGCAATATTCTCCAGAGA</p>
							</entry>
							<entry colname="c3">
								<p>5&#8217;-RACE for LeBI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-482F-3RACE</p>
							</entry>
							<entry colname="c2">
								<p>TGCAACAAAGTTGACAGAGGCAGATG</p>
							</entry>
							<entry colname="c3">
								<p>3&#8217;-RACE for LeBI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-564F-nested</p>
							</entry>
							<entry colname="c2">
								<p>ATGTCGGGAGTATGTGCTGCATCTG</p>
							</entry>
							<entry colname="c3">
								<p>3&#8217;-RACE for LeBI931567</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-F1</p>
							</entry>
							<entry colname="c2">
								<p>CTGAGAAAGTTCTTGCAAACG</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-F2</p>
							</entry>
							<entry colname="c2">
								<p>GAACAGATGAATCAGAAGATG</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-F3</p>
							</entry>
							<entry colname="c2">
								<p>AAAGCACTCCATATAAACACAG</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-R1</p>
							</entry>
							<entry colname="c2">
								<p>GGTATACATCAAGTCCACCAT</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>LeBI9315-R2</p>
							</entry>
							<entry colname="c2">
								<p>GAGGGAGTATGCTCTCATG</p>
							</entry>
							<entry colname="c3">
								<p>Sequencing</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKa-1F</p>
							</entry>
							<entry colname="c2">
								<p>GGGGTACCGAATGCCTGCTTGGTGGGGAA</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#945;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Xh-NbMAPKKKa-1836R</p>
							</entry>
							<entry colname="c2">
								<p>GGCTCGAGTGCTAAAGAATTGGTCTTAGTTTTG</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#945;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKb-1F</p>
							</entry>
							<entry colname="c2">
								<p>CCGGTACCGAATGCATCGATTGCCAGGAATTTTTGC</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>EcV-NbMAPKKKb-1695R</p>
							</entry>
							<entry colname="c2">
								<p>GGGATATCTTTAAAGCCTCTTGCCCAGATTTTG</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKg-1F</p>
							</entry>
							<entry colname="c2">
								<p>GGGGTACCGAATGCGTTGGTGGCAGAACG</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Xh-NbMAPKKKg-1956R</p>
							</entry>
							<entry colname="c2">
								<p>GGCTCGAGTGCTACCTCTCTAGAGATAAACG</p>
							</entry>
							<entry colname="c3">
								<p>Full-length ORF of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKbkinase-F</p>
							</entry>
							<entry colname="c2">
								<p>CCGGTACCGAATGTACTGGGACAAAGGTGATCT</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>EcV-NbMAPKKKbkinase-R</p>
							</entry>
							<entry colname="c2">
								<p>GGGATATCTTTACACAAAAGGATGCTCCAAGA</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKgkinase-F</p>
							</entry>
							<entry colname="c2">
								<p>GGGGTACCGAATGTGGCAAAAAGGGAAGCTTATTG</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Xh-NbMAPKKKgkinase-R</p>
							</entry>
							<entry colname="c2">
								<p>GGCTCGAGTGTTACATAAATCGATGTTCCAATAAC</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Kp-NbMAPKKKekinase-F</p>
							</entry>
							<entry colname="c2">
								<p>GGGGTACCGAATGAAATATATGCTCGGAGATGAG</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#949;2</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Xh-NbMAPKKKekinase-R</p>
							</entry>
							<entry colname="c2">
								<p>GGCTCGAGTGTTATATCCATGGATGTGAAAGTAG</p>
							</entry>
							<entry colname="c3">
								<p>Kinase domain of NbMAPKKK&#949;2</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKb-K381M-F</p>
							</entry>
							<entry colname="c2">
								<p>TTTTGCTGTCATGGAAGTGTCATTACTTGATCA</p>
							</entry>
							<entry colname="c3">
								<p>K&#8201;&#8594;&#8201;M mutant of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKb-K381M-R</p>
							</entry>
							<entry colname="c2">
								<p>ATGACACTTCCATGACAGCAAAAAAGAAACCG</p>
							</entry>
							<entry colname="c3">
								<p>K&#8201;&#8594;&#8201;M mutant of NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKg-K374M-F</p>
							</entry>
							<entry colname="c2">
								<p>CTGGAGCTTTATGTGCGATGATGGAAGTTGAATT ATTACCGGA</p>
							</entry>
							<entry colname="c3">
								<p>K&#8201;&#8594;&#8201;M mutant of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKg-K374M-R</p>
							</entry>
							<entry colname="c2">
								<p>TCCGGTAATAATTCAACTTCCATCATCGCACATAA AGCTCCAG</p>
							</entry>
							<entry colname="c3">
								<p>K&#8201;&#8594;&#8201;M mutant of NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKa-255F</p>
							</entry>
							<entry colname="c2">
								<p>GGTTGTTTTGGGATGTGGGGTCAG</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#945;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKa-393R</p>
							</entry>
							<entry colname="c2">
								<p>CAGTGGGCTCAACCTATTATCGCC</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#945;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKb-1179F</p>
							</entry>
							<entry colname="c2">
								<p>CACAAGGCAGATTTTACATGGTTTG</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKb-1286R</p>
							</entry>
							<entry colname="c2">
								<p>AGCTTGACCGATCCGTTAGCA</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#946;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKg-903F</p>
							</entry>
							<entry colname="c2">
								<p>CCGTGAGTGTAGTGCTCAGGGTAA</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>NbMAPKKKg-984R</p>
							</entry>
							<entry colname="c2">
								<p>TGCCGTAGGCTGCTGTGATG</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for NbMAPKKK&#947;</p>
							</entry>
						</row>
						<row>
							<entry colname="c1">
								<p>Nb18S-193F</p>
							</entry>
							<entry colname="c2">
								<p>ATACGTGCAACAAACCCCGAC</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for Nb18S rRNA</p>
							</entry>
						</row>
						<row rowsep="1">
							<entry colname="c1">
								<p>Nb18S-280R</p>
							</entry>
							<entry colname="c2">
								<p>TGAATCATCGCAGCAACGG</p>
							</entry>
							<entry colname="c3">
								<p>Real-time RT-PCR for Nb18S rRNA</p>
							</entry>
						</row>
					</tbody>
				</tgroup>
			</table><p>ORF and motif analyses were performed using the ORF Finder (<url>http://www.ncbi.nlm.nih.gov/gorf/gorf.html</url>) and CD-Search (<url>http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi</url>) programs, respectively. Phylogenetic analysis was performed using MEGA3.1 based on a multiple alignment created using ClustalW. The MAPKKK gene sequences used in phylogenetic analysis are listed in the GenBank database under the following accession numbers: <it>AtMEKK1</it> (NM_116919), <it>AtMEKK2</it> (NM_116917), <it>AtMEKK3</it> (NM_116916), <it>AtMEKK4</it> (NM_117272), <it>BnMAPKKK&#946;1</it> (AJ010093), <it>AtANP1</it> (NM_100771), <it>AtANP2</it> (NM_104370), <it>AtANP3</it> (NM_111477), <it>NtNPK1</it> (D26601), <it>AtMAPKKK&#947;</it> (NM_126084), <it>AtYODA</it> (AY357949), <it>NbMAPKKK&#945;</it> (AY500155), <it>AtMAPKKK&#945;</it> (NM_179472), <it>AtMAPKKK&#949;1</it> (NM_112199), <it>AtMAPKKK&#949;2</it> (NM_111677), <it>MsOMTK1</it> (AJ575100), <it>BnMAPKKK&#945;1</it> (AJ010091), <it>BnMAPKKK&#949;1</it> (AJ238845), <it>SlMAPKKK&#949;</it> (GU192457), and <it>NbMAPKKK&#949;</it> (GU205153). <it>Homo sapiens HsMEKK1</it> (AF042838) was used as an outgroup.</p>
		</sec>
		<sec>
			<st>
				<p>Construction of plasmids for transient expression of wild-type and mutant MAPKKKs and MAPKKK kinase domains and agroinfiltration</p>
			</st><p>The coding regions of <it>NbMAPKKK&#945;</it>, <it>NbMAPKKK&#946;</it>, and <it>NbMAPKKK&#947;</it> were amplified by RT-PCR using primer pairs Kp-NbMAPKKKa-1F/Xh-NbMAPKKKa-1836R, Kp-NbMAPKKKb-1F/EcV-NbMAPKKKb-1695R, and Kp-NbMAPKKKg-1F/Xh-NbMAPKKKg-1956R, respectively. The kinase domains of <it>NbMAPKKK&#946;</it>, <it>NbMAPKKK&#947;</it>, and NbMAPKKK<it>&#949;2</it> were amplified using primer pairs Kp-NbMAPKKKbkinase-F/EcV-NbMAPKKKbkinase-R, Kp-NbMAPKKKgkinase-F/Xh-NbMAPKKKgkinase-R, and Kp-NbMAPKKKekinase-F/Xh-NbMAPKKKekinase-R, respectively.</p><p>Loss-of-function mutants of NbMAPKKK&#946; and NbMAPKKK&#947; were obtained by substituting methionine for the essential lysine in the ATP-binding site in the kinase domain. These mutants were obtained by site-directed mutagenesis using primers NbMAPKKKb-K381M-F and NbMAPKKKb-K381M-R for NbMAPKKK&#946; and NbMAPKKKg-K374M-F and NbMAPKKKg-K374M-R for NbMAPKKK&#947;. Each PCR-amplified MAPKKK gene fragment was subcloned into the pEarleyGate 203 vector under 35 S promoter <abbrgrp>
					<abbr bid="B34">34</abbr>
				</abbrgrp> via the pENTA entry vector <abbrgrp>
					<abbr bid="B35">35</abbr>
				</abbrgrp> with LR Clonase II Enzyme Mix (Invitrogen). GUS gene was also subcloned into the pEarleyGate 203 vector under the 35 S promoter. These plasmid vectors were transformed into <it>Agrobacterium tumefaciens</it> strain EHA105. Agroinfiltration was performed as previously described <abbrgrp>
					<abbr bid="B27">27</abbr>
				</abbrgrp>.</p>
		</sec>
		<sec>
			<st>
				<p>Construction of VIGS vectors and VIGS</p>
			</st><p>VIGS was performed as described previously using pTV:00 derivatives and pBintra6 <abbrgrp>
					<abbr bid="B17">17</abbr>
				</abbrgrp>. NbMAPKKK&#945; silencing was induced using pTV:<it>NbMAPKKK&#945;</it>
				<abbrgrp>
					<abbr bid="B19">19</abbr>
				</abbrgrp>. For NbMAPKKK&#946; and NbMAPKKK&#947; silencing, the 390-bp KpnI&#8211;PvuII fragment of the 5&#8242;-terminal region of the PCR-amplified full-length NbMAPKKK&#946; ORF and the 576-bp KpnI&#8211;EcoRV fragment of the PCR-amplified full-length NbMAPKKK&#947; ORF were introduced into pTV:00 in the antisense direction to generate pTV:<it>NbMAPKKK&#946;</it> and pTV:<it>NbMAPKKK&#947;</it>, respectively. The NbMAPKKK&#946; ORF was amplified using primers Kp-NbMAPKKKb-1 F and EcV-NbMAPKKKb-1695R, and the NbMAPKKK&#947; ORF was amplified using primers Kp-NbMAPKKKg-1 F and Xh-NbMAPKKKg-1956R.</p>
		</sec>
		<sec>
			<st>
				<p>Real-time RT-PCR</p>
			</st><p>The methods used for total RNA isolation, cDNA synthesis, and quantitative analysis of gene expression were the same as those previously described <abbrgrp>
					<abbr bid="B18">18</abbr>
				</abbrgrp>. Expression of 18 S rRNA was used as the normalizer. The primers used for real-time RT-PCR were NbMAPKKKa-255F and NbMAPKKKa-393R for NbMAPKKK&#945;, NbMAPKKKb-1179F and NbMAPKKKb-1286R for NbMAPKKK&#946;, NbMAPKKKg-903F and NbMAPKKKg-984R for NbMAPKKK&#947;, and Nb18S-193F and Nb280R for Nb18S rRNA.</p>
		</sec>
	</sec>
	<sec>
		<st>
			<p>Abbreviations</p>
		</st><p>HR: Hypersensitive response; MAPK: Mitogen-activated protein kinase; MAPKK: MAPK kinase; MAPKKK: MAPKK kinase; PCD: Programmed cell death; PlAMV: plantago asiatica mosaic virus; Pst: <it>Pseudomonas syringae</it> pv. <it>tomato</it>; TMV: tobacco mosaic virus.</p>
	</sec>
	<sec>
		<st>
			<p>Authors&#8217; contributions</p>
		</st><p>MH, KK, YY and SN designed the experiments. MH and KK performed the experiments and analyzed the data together with KM, YO, YY and SN. TS, KI and YT contributed new reagents and analytic tools. MH, KK and SN wrote the paper. All authors discussed the results and approved the final manuscript.</p>
	</sec>
</bdy>
<bm>
	<ack>
		<sec>
			<st>
				<p>Acknowledgements</p>
			</st><p>We thank Dr. David Baulcombe (University of Cambridge, Cambridge, UK) for tobacco rattle virus vector and silencing suppressor p19 gene. This work supported by grand-in-aid from the Japan Society for the Promotion of Science and, in part, by a Grand-in-aid for JSPS Fellows, and by the Program for Promotion of Basic Research Activities for Innovative Bioscience (PROBRAIN).</p>
		</sec>
	</ack>
	<refgrp><bibl id="B1"><title><p>The plant immune system</p></title><aug><au><snm>Jones</snm><fnm>JD</fnm></au><au><snm>Dangl</snm><fnm>JL</fnm></au></aug><source>Nature</source><pubdate>2006</pubdate><volume>444</volume><issue>7117</issue><fpage>323</fpage><lpage>329</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature05286</pubid><pubid idtype="pmpid" link="fulltext">17108957</pubid></pubidlist></xrefbib></bibl><bibl id="B2"><title><p>Cell death and organ development in plants</p></title><aug><au><snm>Rogers</snm><fnm>HJ</fnm></au></aug><source>Curr Top Dev Biol</source><pubdate>2005</pubdate><volume>71</volume><fpage>225</fpage><lpage>261</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">16344107</pubid></xrefbib></bibl><bibl id="B3"><title><p>Mitogen-activated protein kinase signaling in plants</p></title><aug><au><snm>Rodriguez</snm><fnm>MC</fnm></au><au><snm>Petersen</snm><fnm>M</fnm></au><au><snm>Mundy</snm><fnm>J</fnm></au></aug><source>Annu Rev Plant Biol</source><volume>61</volume><fpage>621</fpage><lpage>649</lpage></bibl><bibl id="B4"><title><p>Mitogen-activated protein kinase cascades in plants: a new nomenclature</p></title><aug><au><cnm>MAPKGroup</cnm></au></aug><source>Trends Plant Sci</source><pubdate>2002</pubdate><volume>7</volume><issue>7</issue><fpage>301</fpage><lpage>308</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S1360-1385(02)02302-6</pubid><pubid idtype="pmpid" link="fulltext">12119167</pubid></pubidlist></xrefbib></bibl><bibl id="B5"><title><p>MAP kinase signalling cascade in Arabidopsis innate immunity</p></title><aug><au><snm>Asai</snm><fnm>T</fnm></au><au><snm>Tena</snm><fnm>G</fnm></au><au><snm>Plotnikova</snm><fnm>J</fnm></au><au><snm>Willmann</snm><fnm>MR</fnm></au><au><snm>Chiu</snm><fnm>WL</fnm></au><au><snm>Gomez-Gomez</snm><fnm>L</fnm></au><au><snm>Boller</snm><fnm>T</fnm></au><au><snm>Ausubel</snm><fnm>FM</fnm></au><au><snm>Sheen</snm><fnm>J</fnm></au></aug><source>Nature</source><pubdate>2002</pubdate><volume>415</volume><issue>6875</issue><fpage>977</fpage><lpage>983</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/415977a</pubid><pubid idtype="pmpid" link="fulltext">11875555</pubid></pubidlist></xrefbib></bibl><bibl id="B6"><title><p>OMTK1, a novel MAPKKK, channels oxidative stress signaling through direct MAPK interaction</p></title><aug><au><snm>Nakagami</snm><fnm>H</fnm></au><au><snm>Kiegerl</snm><fnm>S</fnm></au><au><snm>Hirt</snm><fnm>H</fnm></au></aug><source>J Biol Chem</source><pubdate>2004</pubdate><volume>279</volume><issue>26</issue><fpage>26959</fpage><lpage>26966</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1074/jbc.M312662200</pubid><pubid idtype="pmpid" link="fulltext">15033984</pubid></pubidlist></xrefbib></bibl><bibl id="B7"><title><p>NPK1, an MEKK1-like mitogen-activated protein kinase kinase kinase, regulates innate immunity and development in plants</p></title><aug><au><snm>Jin</snm><fnm>H</fnm></au><au><snm>Axtell</snm><fnm>MJ</fnm></au><au><snm>Dahlbeck</snm><fnm>D</fnm></au><au><snm>Ekwenna</snm><fnm>O</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au><au><snm>Staskawicz</snm><fnm>B</fnm></au><au><snm>Baker</snm><fnm>B</fnm></au></aug><source>Dev Cell</source><pubdate>2002</pubdate><volume>3</volume><issue>2</issue><fpage>291</fpage><lpage>297</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S1534-5807(02)00205-8</pubid><pubid idtype="pmpid" link="fulltext">12194859</pubid></pubidlist></xrefbib></bibl><bibl id="B8"><title><p>MAPKKK&#945; is a positive regulator of cell death associated with both plant immunity and disease</p></title><aug><au><snm>del Pozo</snm><fnm>O</fnm></au><au><snm>Pedley</snm><fnm>KF</fnm></au><au><snm>Martin</snm><fnm>GB</fnm></au></aug><source>EMBO J</source><pubdate>2004</pubdate><volume>23</volume><issue>15</issue><fpage>3072</fpage><lpage>3082</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/sj.emboj.7600283</pubid><pubid idtype="pmcid">514913</pubid><pubid idtype="pmpid" link="fulltext">15272302</pubid></pubidlist></xrefbib></bibl><bibl id="B9"><title><p>Tomato MAPKKK&#949; is a positive regulator of cell-death signaling networks associated with plant immunity</p></title><aug><au><snm>Melech-Bonfil</snm><fnm>S</fnm></au><au><snm>Sessa</snm><fnm>G</fnm></au></aug><source>Plant J</source><pubdate>2010</pubdate><volume>64</volume><issue>3</issue><fpage>379</fpage><lpage>391</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-313X.2010.04333.x</pubid><pubid idtype="pmpid" link="fulltext">21049563</pubid></pubidlist></xrefbib></bibl><bibl id="B10"><title><p>Function of a mitogen-activated protein kinase pathway in N gene-mediated resistance in tobacco</p></title><aug><au><snm>Jin</snm><fnm>H</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Yang</snm><fnm>KY</fnm></au><au><snm>Kim</snm><fnm>CY</fnm></au><au><snm>Baker</snm><fnm>B</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant J</source><pubdate>2003</pubdate><volume>33</volume><issue>4</issue><fpage>719</fpage><lpage>731</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-313X.2003.01664.x</pubid><pubid idtype="pmpid" link="fulltext">12609044</pubid></pubidlist></xrefbib></bibl><bibl id="B11"><title><p>Two MAPK cascades, NPR1, and TGA transcription factors play a role in Pto-mediated disease resistance in tomato</p></title><aug><au><snm>Ekengren</snm><fnm>SK</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Schiff</snm><fnm>M</fnm></au><au><snm>Dinesh-Kumar</snm><fnm>SP</fnm></au><au><snm>Martin</snm><fnm>GB</fnm></au></aug><source>Plant J</source><pubdate>2003</pubdate><volume>36</volume><issue>6</issue><fpage>905</fpage><lpage>917</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-313X.2003.01944.x</pubid><pubid idtype="pmpid" link="fulltext">14675454</pubid></pubidlist></xrefbib></bibl><bibl id="B12"><title><p>Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling</p></title><aug><au><snm>Yoo</snm><fnm>SD</fnm></au><au><snm>Cho</snm><fnm>YH</fnm></au><au><snm>Tena</snm><fnm>G</fnm></au><au><snm>Xiong</snm><fnm>Y</fnm></au><au><snm>Sheen</snm><fnm>J</fnm></au></aug><source>Nature</source><pubdate>2008</pubdate><volume>451</volume><issue>7180</issue><fpage>789</fpage><lpage>795</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature06543</pubid><pubid idtype="pmcid">3488589</pubid><pubid idtype="pmpid" link="fulltext">18273012</pubid></pubidlist></xrefbib></bibl><bibl id="B13"><title><p>Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis</p></title><aug><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant Cell</source><pubdate>2004</pubdate><volume>16</volume><issue>12</issue><fpage>3386</fpage><lpage>3399</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1105/tpc.104.026609</pubid><pubid idtype="pmcid">535880</pubid><pubid idtype="pmpid" link="fulltext">15539472</pubid></pubidlist></xrefbib></bibl><bibl id="B14"><title><p>Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis</p></title><aug><au><snm>Wang</snm><fnm>H</fnm></au><au><snm>Ngwenyama</snm><fnm>N</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Walker</snm><fnm>JC</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant Cell</source><pubdate>2007</pubdate><volume>19</volume><issue>1</issue><fpage>63</fpage><lpage>73</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1105/tpc.106.048298</pubid><pubid idtype="pmcid">1820971</pubid><pubid idtype="pmpid" link="fulltext">17259259</pubid></pubidlist></xrefbib></bibl><bibl id="B15"><title><p>MAPK cascades in plant defense signaling</p></title><aug><au><snm>Zhang</snm><fnm>S</fnm></au><au><snm>Klessig</snm><fnm>DF</fnm></au></aug><source>Trends Plant Sci</source><pubdate>2001</pubdate><volume>6</volume><issue>11</issue><fpage>520</fpage><lpage>527</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S1360-1385(01)02103-3</pubid><pubid idtype="pmpid" link="fulltext">11701380</pubid></pubidlist></xrefbib></bibl><bibl id="B16"><title><p>Role of mitogen-activated protein kinases in plant immunity</p></title><aug><au><snm>Pedley</snm><fnm>KF</fnm></au><au><snm>Martin</snm><fnm>GB</fnm></au></aug><source>Curr Opin Plant Biol</source><pubdate>2005</pubdate><volume>8</volume><issue>5</issue><fpage>541</fpage><lpage>547</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.pbi.2005.07.006</pubid><pubid idtype="pmpid" link="fulltext">16043387</pubid></pubidlist></xrefbib></bibl><bibl id="B17"><title><p>Tobacco rattle virus as a vector for analysis of gene function by silencing</p></title><aug><au><snm>Ratcliff</snm><fnm>F</fnm></au><au><snm>Martin-Hernandez</snm><fnm>AM</fnm></au><au><snm>Baulcombe</snm><fnm>DC</fnm></au></aug><source>Plant J</source><pubdate>2001</pubdate><volume>25</volume><issue>2</issue><fpage>237</fpage><lpage>245</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">11169199</pubid></xrefbib></bibl><bibl id="B18"><title><p>Nucleotide sequence analysis of seven Japanese isolates of Plantago asiatica mosaic virus (PlAMV): a unique potexvirus with significantly high genomic and biological variability within the species</p></title><aug><au><snm>Komatsu</snm><fnm>K</fnm></au><au><snm>Yamaji</snm><fnm>Y</fnm></au><au><snm>Ozeki</snm><fnm>J</fnm></au><au><snm>Hashimoto</snm><fnm>M</fnm></au><au><snm>Kagiwada</snm><fnm>S</fnm></au><au><snm>Takahashi</snm><fnm>S</fnm></au><au><snm>Namba</snm><fnm>S</fnm></au></aug><source>Arch Virol</source><pubdate>2008</pubdate><volume>153</volume><issue>1</issue><fpage>193</fpage><lpage>198</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1007/s00705-007-1078-y</pubid><pubid idtype="pmpid" link="fulltext">17987351</pubid></pubidlist></xrefbib></bibl><bibl id="B19"><title><p>Viral-induced systemic necrosis in plants involves both programmed cell death and the inhibition of viral multiplication, which are regulated by independent pathways</p></title><aug><au><snm>Komatsu</snm><fnm>K</fnm></au><au><snm>Hashimoto</snm><fnm>M</fnm></au><au><snm>Ozeki</snm><fnm>J</fnm></au><au><snm>Yamaji</snm><fnm>Y</fnm></au><au><snm>Maejima</snm><fnm>K</fnm></au><au><snm>Senshu</snm><fnm>H</fnm></au><au><snm>Himeno</snm><fnm>M</fnm></au><au><snm>Okano</snm><fnm>Y</fnm></au><au><snm>Kagiwada</snm><fnm>S</fnm></au><au><snm>Namba</snm><fnm>S</fnm></au></aug><source>Mol Plant Microbe Interact</source><pubdate>2010</pubdate><volume>23</volume><issue>3</issue><fpage>283</fpage><lpage>293</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1094/MPMI-23-3-0283</pubid><pubid idtype="pmpid" link="fulltext">20121450</pubid></pubidlist></xrefbib></bibl><bibl id="B20"><title><p>A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana</p></title><aug><au><snm>Mizoguchi</snm><fnm>T</fnm></au><au><snm>Irie</snm><fnm>K</fnm></au><au><snm>Hirayama</snm><fnm>T</fnm></au><au><snm>Hayashida</snm><fnm>N</fnm></au><au><snm>Yamaguchi-Shinozaki</snm><fnm>K</fnm></au><au><snm>Matsumoto</snm><fnm>K</fnm></au><au><snm>Shinozaki</snm><fnm>K</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>1996</pubdate><volume>93</volume><issue>2</issue><fpage>765</fpage><lpage>769</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.93.2.765</pubid><pubid idtype="pmcid">40129</pubid><pubid idtype="pmpid" link="fulltext">8570631</pubid></pubidlist></xrefbib></bibl><bibl id="B21"><title><p>The protein kinases AtMAP3K&#949;1 and BnMAP3K&#949;1 are functional homologues of S. pombe cdc7p and may be involved in cell division</p></title><aug><au><snm>Jouannic</snm><fnm>S</fnm></au><au><snm>Champion</snm><fnm>A</fnm></au><au><snm>Segui-Simarro</snm><fnm>JM</fnm></au><au><snm>Salimova</snm><fnm>E</fnm></au><au><snm>Picaud</snm><fnm>A</fnm></au><au><snm>Tregear</snm><fnm>J</fnm></au><au><snm>Testillano</snm><fnm>P</fnm></au><au><snm>Risueno</snm><fnm>MC</fnm></au><au><snm>Simanis</snm><fnm>V</fnm></au><au><snm>Kreis</snm><fnm>M</fnm></au><etal/></aug><source>Plant J</source><pubdate>2001</pubdate><volume>26</volume><issue>6</issue><fpage>637</fpage><lpage>649</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-313x.2001.01065.x</pubid><pubid idtype="pmpid" link="fulltext">11489177</pubid></pubidlist></xrefbib></bibl><bibl id="B22"><title><p>The protein kinase genes MAP3K&#949;1 and MAP3K&#949;2 are required for pollen viability in Arabidopsis thaliana</p></title><aug><au><snm>Chaiwongsar</snm><fnm>S</fnm></au><au><snm>Otegui</snm><fnm>MS</fnm></au><au><snm>Jester</snm><fnm>PJ</fnm></au><au><snm>Monson</snm><fnm>SS</fnm></au><au><snm>Krysan</snm><fnm>PJ</fnm></au></aug><source>Plant J</source><pubdate>2006</pubdate><volume>48</volume><issue>2</issue><fpage>193</fpage><lpage>205</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-313X.2006.02863.x</pubid><pubid idtype="pmpid" link="fulltext">16965555</pubid></pubidlist></xrefbib></bibl><bibl id="B23"><title><p>NPK1, a tobacco gene that encodes a protein with a domain homologous to yeast BCK1, STE11, and Byr2 protein kinases</p></title><aug><au><snm>Banno</snm><fnm>H</fnm></au><au><snm>Hirano</snm><fnm>K</fnm></au><au><snm>Nakamura</snm><fnm>T</fnm></au><au><snm>Irie</snm><fnm>K</fnm></au><au><snm>Nomoto</snm><fnm>S</fnm></au><au><snm>Matsumoto</snm><fnm>K</fnm></au><au><snm>Machida</snm><fnm>Y</fnm></au></aug><source>Mol Cell Biol</source><pubdate>1993</pubdate><volume>13</volume><issue>8</issue><fpage>4745</fpage><lpage>4752</lpage><xrefbib><pubidlist><pubid idtype="pmcid">360100</pubid><pubid idtype="pmpid" link="fulltext">8336712</pubid></pubidlist></xrefbib></bibl><bibl id="B24"><title><p>Activation of Ntf4, a tobacco mitogen-activated protein kinase, during plant defense response and its involvement in hypersensitive response-like cell death</p></title><aug><au><snm>Ren</snm><fnm>D</fnm></au><au><snm>Yang</snm><fnm>KY</fnm></au><au><snm>Li</snm><fnm>GJ</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant Physiol</source><pubdate>2006</pubdate><volume>141</volume><issue>4</issue><fpage>1482</fpage><lpage>1493</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1104/pp.106.080697</pubid><pubid idtype="pmcid">1533962</pubid><pubid idtype="pmpid" link="fulltext">16798947</pubid></pubidlist></xrefbib></bibl><bibl id="B25"><title><p>Activation of salicylic acid-induced protein kinase, a mitogen-activated protein kinase, induces multiple defense responses in tobacco</p></title><aug><au><snm>Zhang</snm><fnm>S</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au></aug><source>Plant Cell</source><pubdate>2001</pubdate><volume>13</volume><issue>8</issue><fpage>1877</fpage><lpage>1889</lpage><xrefbib><pubidlist><pubid idtype="pmcid">139126</pubid><pubid idtype="pmpid" link="fulltext">11487699</pubid></pubidlist></xrefbib></bibl><bibl id="B26"><title><p>Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants</p></title><aug><au><snm>Kovtun</snm><fnm>Y</fnm></au><au><snm>Chiu</snm><fnm>WL</fnm></au><au><snm>Tena</snm><fnm>G</fnm></au><au><snm>Sheen</snm><fnm>J</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>2000</pubdate><volume>97</volume><issue>6</issue><fpage>2940</fpage><lpage>2945</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.97.6.2940</pubid><pubid idtype="pmcid">16034</pubid><pubid idtype="pmpid" link="fulltext">10717008</pubid></pubidlist></xrefbib></bibl><bibl id="B27"><title><p>A necrosis-inducing elicitor domain encoded by both symptomatic and asymptomatic Plantago asiatica mosaic virus isolates, whose expression is modulated by virus replication</p></title><aug><au><snm>Komatsu</snm><fnm>K</fnm></au><au><snm>Hashimoto</snm><fnm>M</fnm></au><au><snm>Maejima</snm><fnm>K</fnm></au><au><snm>Shiraishi</snm><fnm>T</fnm></au><au><snm>Neriya</snm><fnm>Y</fnm></au><au><snm>Miura</snm><fnm>C</fnm></au><au><snm>Minato</snm><fnm>N</fnm></au><au><snm>Okano</snm><fnm>Y</fnm></au><au><snm>Sugawara</snm><fnm>K</fnm></au><au><snm>Yamaji</snm><fnm>Y</fnm></au><au><snm>Namba</snm><fnm>S</fnm></au></aug><source>Mol Plant Microbe Interact</source><pubdate>2011</pubdate><volume>24</volume><issue>4</issue><fpage>408</fpage><lpage>420</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1094/MPMI-12-10-0279</pubid><pubid idtype="pmpid" link="fulltext">21190438</pubid></pubidlist></xrefbib></bibl><bibl id="B28"><title><p>Expression of RPS4 in tobacco induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90</p></title><aug><au><snm>Zhang</snm><fnm>Y</fnm></au><au><snm>Dorey</snm><fnm>S</fnm></au><au><snm>Swiderski</snm><fnm>M</fnm></au><au><snm>Jones</snm><fnm>JD</fnm></au></aug><source>Plant J</source><pubdate>2004</pubdate><volume>40</volume><issue>2</issue><fpage>213</fpage><lpage>224</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-313X.2004.02201.x</pubid><pubid idtype="pmpid" link="fulltext">15447648</pubid></pubidlist></xrefbib></bibl><bibl id="B29"><title><p>The transcriptional innate immune response to flg22. Interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis</p></title><aug><au><snm>Navarro</snm><fnm>L</fnm></au><au><snm>Zipfel</snm><fnm>C</fnm></au><au><snm>Rowland</snm><fnm>O</fnm></au><au><snm>Keller</snm><fnm>I</fnm></au><au><snm>Robatzek</snm><fnm>S</fnm></au><au><snm>Boller</snm><fnm>T</fnm></au><au><snm>Jones</snm><fnm>JD</fnm></au></aug><source>Plant Physiol</source><pubdate>2004</pubdate><volume>135</volume><issue>2</issue><fpage>1113</fpage><lpage>1128</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1104/pp.103.036749</pubid><pubid idtype="pmcid">514144</pubid><pubid idtype="pmpid" link="fulltext">15181213</pubid></pubidlist></xrefbib></bibl><bibl id="B30"><title><p>Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae</p></title><aug><au><snm>Tao</snm><fnm>Y</fnm></au><au><snm>Xie</snm><fnm>Z</fnm></au><au><snm>Chen</snm><fnm>W</fnm></au><au><snm>Glazebrook</snm><fnm>J</fnm></au><au><snm>Chang</snm><fnm>HS</fnm></au><au><snm>Han</snm><fnm>B</fnm></au><au><snm>Zhu</snm><fnm>T</fnm></au><au><snm>Zou</snm><fnm>G</fnm></au><au><snm>Katagiri</snm><fnm>F</fnm></au></aug><source>Plant Cell</source><pubdate>2003</pubdate><volume>15</volume><issue>2</issue><fpage>317</fpage><lpage>330</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1105/tpc.007591</pubid><pubid idtype="pmcid">141204</pubid><pubid idtype="pmpid" link="fulltext">12566575</pubid></pubidlist></xrefbib></bibl><bibl id="B31"><title><p>Activation of a stress-responsive mitogen-activated protein kinase cascade induces the biosynthesis of ethylene in plants</p></title><aug><au><snm>Kim</snm><fnm>CY</fnm></au><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Thorne</snm><fnm>ET</fnm></au><au><snm>Yang</snm><fnm>H</fnm></au><au><snm>Fukushige</snm><fnm>H</fnm></au><au><snm>Gassmann</snm><fnm>W</fnm></au><au><snm>Hildebrand</snm><fnm>D</fnm></au><au><snm>Sharp</snm><fnm>RE</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant Cell</source><pubdate>2003</pubdate><volume>15</volume><issue>11</issue><fpage>2707</fpage><lpage>2718</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1105/tpc.011411</pubid><pubid idtype="pmcid">280573</pubid><pubid idtype="pmpid" link="fulltext">14555690</pubid></pubidlist></xrefbib></bibl><bibl id="B32"><title><p>Chloroplast-generated reactive oxygen species are involved in hypersensitive response-like cell death mediated by a mitogen-activated protein kinase cascade</p></title><aug><au><snm>Liu</snm><fnm>Y</fnm></au><au><snm>Ren</snm><fnm>D</fnm></au><au><snm>Pike</snm><fnm>S</fnm></au><au><snm>Pallardy</snm><fnm>S</fnm></au><au><snm>Gassmann</snm><fnm>W</fnm></au><au><snm>Zhang</snm><fnm>S</fnm></au></aug><source>Plant J</source><pubdate>2007</pubdate><volume>51</volume><issue>6</issue><fpage>941</fpage><lpage>954</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-313X.2007.03191.x</pubid><pubid idtype="pmpid" link="fulltext">17651371</pubid></pubidlist></xrefbib></bibl><bibl id="B33"><title><p>A single amino acid in the RNA-dependent RNA polymerase of Plantago asiatica mosaic virus contributes to systemic necrosis</p></title><aug><au><snm>Ozeki</snm><fnm>J</fnm></au><au><snm>Takahashi</snm><fnm>S</fnm></au><au><snm>Komatsu</snm><fnm>K</fnm></au><au><snm>Kagiwada</snm><fnm>S</fnm></au><au><snm>Yamashita</snm><fnm>K</fnm></au><au><snm>Mori</snm><fnm>T</fnm></au><au><snm>Hirata</snm><fnm>H</fnm></au><au><snm>Yamaji</snm><fnm>Y</fnm></au><au><snm>Ugaki</snm><fnm>M</fnm></au><au><snm>Namba</snm><fnm>S</fnm></au></aug><source>Arch Virol</source><pubdate>2006</pubdate><volume>151</volume><issue>10</issue><fpage>2067</fpage><lpage>2075</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1007/s00705-006-0766-3</pubid><pubid idtype="pmpid" link="fulltext">16633739</pubid></pubidlist></xrefbib></bibl><bibl id="B34"><title><p>Gateway-compatible vectors for plant functional genomics and proteomics</p></title><aug><au><snm>Earley</snm><fnm>KW</fnm></au><au><snm>Haag</snm><fnm>JR</fnm></au><au><snm>Pontes</snm><fnm>O</fnm></au><au><snm>Opper</snm><fnm>K</fnm></au><au><snm>Juehne</snm><fnm>T</fnm></au><au><snm>Song</snm><fnm>K</fnm></au><au><snm>Pikaard</snm><fnm>CS</fnm></au></aug><source>Plant J</source><pubdate>2006</pubdate><volume>45</volume><issue>4</issue><fpage>616</fpage><lpage>629</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-313X.2005.02617.x</pubid><pubid idtype="pmpid" link="fulltext">16441352</pubid></pubidlist></xrefbib></bibl><bibl id="B35"><title><p>Significantly low level of small RNA accumulation derived from an encapsidated mycovirus with dsRNA genome</p></title><aug><au><snm>Himeno</snm><fnm>M</fnm></au><au><snm>Maejima</snm><fnm>K</fnm></au><au><snm>Komatsu</snm><fnm>K</fnm></au><au><snm>Ozeki</snm><fnm>J</fnm></au><au><snm>Hashimoto</snm><fnm>M</fnm></au><au><snm>Kagiwada</snm><fnm>S</fnm></au><au><snm>Yamaji</snm><fnm>Y</fnm></au><au><snm>Namba</snm><fnm>S</fnm></au></aug><source>Virology</source><volume>396</volume><issue>1</issue><fpage>69</fpage><lpage>75</lpage></bibl></refgrp>
</bm>
</art>