<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2210-4-8</ui>
   <ji>1471-2210</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Resistance to gemcitabine in a human follicular lymphoma cell line is due to partial deletion of the deoxycytidine kinase gene</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Galmarini</snm>
               <mnm>Mar&#237;a</mnm>
               <fnm>Carlos</fnm>
               <insr iid="I1"/>
               <email>fgalma@rockefeller.univ-lyon1.fr</email>
            </au>
            <au id="A2">
               <snm>Clarke</snm>
               <mi>L</mi>
               <fnm>Marilyn</fnm>
               <insr iid="I2"/>
               <email>johnmack@cancerboard.ab.ca</email>
            </au>
            <au id="A3">
               <snm>Jordheim</snm>
               <fnm>Lars</fnm>
               <insr iid="I1"/>
               <email>jordheim@yahoo.com</email>
            </au>
            <au id="A4">
               <snm>Santos</snm>
               <mi>L</mi>
               <fnm>Cheryl</fnm>
               <insr iid="I2"/>
               <email>johnmack@cancerboard.ab.ca</email>
            </au>
            <au id="A5">
               <snm>Cros</snm>
               <fnm>Emeline</fnm>
               <insr iid="I1"/>
               <email>emelinecros@yahoo.fr</email>
            </au>
            <au id="A6">
               <snm>Mackey</snm>
               <mi>R</mi>
               <fnm>John</fnm>
               <insr iid="I2"/>
               <email>johnmack@cancerboard.ab.ca</email>
            </au>
            <au id="A7">
               <snm>Dumontet</snm>
               <fnm>Charles</fnm>
               <insr iid="I1"/>
               <email>charles.dumontet@chu-lyon.fr</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>INSERM 590 &#8211; Laboratoire de Cytologie Analytique, Facult&#233; de M&#233;decine Rockefeller, Universit&#233; Claude Bernard Lyon 1, Lyon, France</p>
            </ins>
            <ins id="I2">
               <p>Cross Cancer Institute and Department of Oncology, University of Alberta, Alberta, Canada</p>
            </ins>
         </insg>
         <source>BMC Pharmacology</source>
         <issn>1471-2210</issn>
         <pubdate>2004</pubdate>
         <volume>4</volume>
         <issue>1</issue>
         <fpage>8</fpage>
         <url>http://www.biomedcentral.com/1471-2210/4/8</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">15157282</pubid>
               <pubid idtype="doi">10.1186/1471-2210-4-8</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>28</day>
               <month>1</month>
               <year>2004</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>24</day>
               <month>5</month>
               <year>2004</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>24</day>
               <month>5</month>
               <year>2004</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2004</year>
         <collab>Galmarini et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Gemcitabine is an analogue of deoxycytidine with activity against several solid tumors. In order to elucidate the mechanisms by which tumor cells become resistant to gemcitabine, we developed the resistant subline RL-G from the human follicular lymphoma cell line RL-7 by prolonged exposure of parental cells to increasing concentrations of gemcitabine.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p><it>In vitro</it>, the IC<sub>50 </sub>increased from 0.015 &#956;M in parental RL-7 cells to 25 &#956;M in the resistant variant, RL-G. Xenografts of both cell lines developed in nude mice were treated with repeated injections of gemcitabine. Under conditions of gemcitabine treatment which totally inhibited the development of RL-7 tumors, RL-G derived tumors grew similarly to those of untreated animals, demonstrating the <it>in vivo </it>resistance of RL-G cells to gemcitabine. HPLC experiments showed that RL-G cells accumulated and incorporated less gemcitabine metabolites into DNA and RNA than RL-7 cells. Gemcitabine induced an S-phase arrest in RL-7 cells but not in RL-G cells. Exposure to gemcitabine induced a higher degree of apoptosis in RL-7 than in RL-G cells, with poly-(ADP-ribose) polymerase cleavage in RL-7 cells. No modifications of Bcl-2 nor of Bax expression were observed in RL-7 or RL-G cells exposed to gemcitabine. These alterations were associated with the absence of the deoxycytidine kinase mRNA expression observed by quantitative RT-PCR in RL-G cells. PCR amplification of d&#233;soxycytidine kinase gene exons showed a partial deletion of the dCK gene in RL-G cells.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>These results suggest that partial deletion of the dCK gene observed after selection in the presence of gemcitabine is involved with resistance to this agent both <it>in vitro </it>and <it>in vivo</it>.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Gemcitabine is an analogue of deoxycytidine with activity against several solid tumors (reviewed in <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>). Gemcitabine enters the cell via a facilitated nucleoside transport mechanism <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp> and is phosphorylated into gemcitabine 5'-monophosphate (dFd-CMP) by deoxycytidine kinase (dCK) <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. It is then subsequently phosphorylated by other pyrimidine kinases to the active 5'-diphosphate (dFd-CDP) and triphosphate (dFd-CTP) derivatives <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Inactivation of gemcitabine and dFd-CMP occurs by deamination by cytidine deaminase (CDD) and dCMP deaminase, respectively <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Dephosphorylation of dFd-CMP by cytoplasmic 5'-nucleotidase activities can also prevent the production of the active forms <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>.</p>
         <p>Cytotoxic actions of gemcitabine are exerted by the phosphorylated metabolites <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. The active diphosphate metabolite, dFd-CDP, inhibits DNA synthesis indirectly through inhibition of ribonucleotide reductase (RNR) <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. This effect blocks the <it>de novo </it>DNA synthesis pathway and self-potentiates gemcitabine activity by decreasing intracellular concentrations of normal deoxynucleoside triphosphates, thereby favoring further gemcitabine phosphorylation and dFd-CTP incorporation into DNA <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. The other active metabolite, dFd-CTP, is incorporated into the growing DNA strand by replication synthesis after which DNA polymerase is able to add one more nucleotide before DNA polymerisation is terminated <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Inhibition of DNA synthesis leads to growth inhibition or cell death. Gemcitabine can also be incorporated into RNA and inhibit RNA synthesis. While incorporation of gemcitabine metabolites into RNA are concentration-dependent, the extent of RNA synthesis inhibition seems to be cell-specific <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Finally gemcitabine inhibits dCMP deaminase and CTP synthetase activities <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>Various general mechanisms of resistance to gemcitabine have been described (reviewed in <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>). A primary mechanism of resistance may arise from an insufficient intracellular concentration of dFdCTP because of an altered activation/degradation pathway. This may results from inefficient cellular uptake, reduced levels of gemcitabine activation or increased drug degradation. Deficiency of dCK is the most frequent described mechanism of resistance to gemcitabine (for review see <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>). Several authors have described a relation between dCK activity and sensitivity to gemcitabine in cells with an acquired resistance to gemcitabine in cell and animal models <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>. Deficiency of nucleoside transporters in tumour plasma membranes, as well as increased activity of CDD, dCMP deaminase or 5'-nucleotidase enzyme activities have also been suggested as mechanisms of cellular resistance to gemcitabine <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>.</p>
         <p>A second type of resistance mechanism may concern altered interactions with intracellular targets <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Various authors showed a correlation between gemcitabine resistance and a increase in ribonucleotide reductase (RNR) activity <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B21">21</abbr></abbrgrp>. Finally, alterations of apoptosis-regulating genes (principally <it>p53</it>) also appear to be involved in the sensitivity of tumor cells to the cytotoxic effect of gemcitabine <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>.</p>
         <p>In order to elucidate the mechanisms by which tumor cells become resistant to gemcitabine, we developed the resistant subline RL-G from the human follicular lymphoma cell line RL-7 by prolonged exposure of parental cells to increasing concentrations of gemcitabine. Here, we describe the biochemical and molecular characterization of RL-G cells in comparison to the parental RL-7 cells, with particular reference to their differential responses to exposure to gemcitabine. Analysis of the mechanisms of resistance identified deficiency of dCK as the main cause of resistance in RL-G cells <it>in vitro </it>and in mouse xenografts.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>In vitro and in vivo chemosensitivity studies</p>
            </st>
            <p>We have previously shown that RL-G cells were 2,092-fold more resistant than RL-7 cells to gemcitabine (RL-G IC50: 25.1 &#177; 5.0 &#956;M; RL-7 IC50: 0.015 &#177; 0.0006 &#956;M) <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. RL-G cells were also cross resistant to ara-C.</p>
            <p>We determined the effect of gemcitabine on the growth of the RL-7 and RL-G tumors when grown subcutaneously as xenografts in athymic nude mice. Median tumor weights in mg of RL-7 and RL-G xenografts in Swiss nude female mice treated or not with gemcitabine are shown in Figure <figr fid="F1">1</figr>. At day 60 after tumor injection, the RL-7 xenografts treated with gemcitabine were significantly smaller than the control tumors (Student <it>t </it>test, p = 0.04) (Fig. <figr fid="F1">1</figr>). The T/C value for RL-7 xenografts was 0.24. Conversely, no significant differences in tumor size were observed between the treated and control groups of mice xenotransplanted with the RL-G cells. The T/C value for RL-G xenografted mice was 0.98. These results indicate that RL-7 tumors were significantly more sensitive to gemcitabine treatment than the RL-G tumors.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Median tumor weight in mg in nude Swiss female mice xenografted with RL-7 or RL-G cells and treated with gemcitabine (200 mg/Kg i.p. once a week; 6 doses) or untreated</p>
               </caption>
               <text>
                  <p><b>Median tumor weight in mg in nude Swiss female mice xenografted with RL-7 or RL-G cells and treated with gemcitabine (200 mg/Kg i.p. once a week; 6 doses) or untreated. </b>RL-7 control : mice injected with RL-7 cells, untreated; RL-7 Gem : mice injected with RL-7 cells, treated with gemcitabine; RL-G control : mice injected with RL-G cells, untreated; RL-G Gem : mice injected with RL-G cells, treated with gemcitabine.</p>
               </text>
               <graphic file="1471-2210-4-8-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>[<sup>3</sup>H]Gemcitabine uptake, metabolism and incorporation into nucleic acids</p>
            </st>
            <p>To assess whether a nucleoside transport defect was a contributing factor to the gemcitabine resistance of RL-G cells, the initial uptake rates (2&#8211;10 s) of 10 &#956;M [<sup>3</sup>H]gemcitabine by RL-7 and RL-G cells were compared, either in the absence or presence of excess (100-fold) non-radioactive gemcitabine. Both RL-7 and RL-G cells were able to transport [<sup>3</sup>H]gemcitabine with comparable initial uptake rates of 0.81 &#177; 0.28 and 0.5 &#177; 0.22 pmol/10<sup>6 </sup>cells, respectively (Fig. <figr fid="F2">2A</figr>). In the presence of excess non-radioactive gemcitabine, initial uptake rates were decreased by 72% (RL-7) and 65% (RL-G), indicating that the uptake of [<sup>3</sup>H]gemcitabine was mediated by a transporter in both cell lines. The initial uptake rates of 10 &#956;M [<sup>3</sup>H]uridine, a physiologic nucleoside, by RL-7 and RL-G cells were also measured and found to be comparable to those measured with gemcitabine (data not shown). These data suggested that RL-G cells were capable of transporting nucleosides intracellularly and that a transport defect was not involved in the gemcitabine-resistance mechanism.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Comparative uptake of [<sup>3</sup>H]gemcitabine and incorporation into nucleic acids of RL-7 and RL-G cells</p>
               </caption>
               <text>
                  <p><b>Comparative uptake of [<sup>3</sup>H]gemcitabine and incorporation into nucleic acids of RL-7 and RL-G cells. (A) </b>Cells were exposed to [<sup>3</sup>H]gemcitabine for 2&#8211;60 s. <b>(B) </b>Accumulation of [<sup>3</sup>H]gemcitabine in RL-7 and RL-G cells over a 4 h exposure period. Each time point represents the average (&#177; S.D.) of three determinations <b>(C) </b>Incorporation of [<sup>3</sup>H]gemcitabine (pmol/mg) into nucleic acids after a 4-h exposure in two separate experiments.</p>
               </text>
               <graphic file="1471-2210-4-8-2"/>
            </fig>
            <p>Although RL-G cells were capable of inward nucleoside transport, the cells were only able to metabolize [<sup>3</sup>H]gemcitabine in trace amounts over a 4 h exposure period as shown by the lack of measurable phosphorylated metabolites detected by HPLC analysis. Trace amounts of [<sup>3</sup>H]dFdCTP could be detected in some samples if the scale was greatly amplified. In contrast, RL-7 cells accumulated 16.4-fold more [<sup>3</sup>H]gemcitabine-derived compounds than RL-G cells (Fig. <figr fid="F2">2B</figr>). Approximately 90% of the total radioactivity measured in acid extracts of RL-7 cells was recovered as the cytotoxic triphosphate (2.2 &#956;mol/mg protein) and diphosphate (0.98 &#956;mol/mg protein) derivatives with a [<sup>3</sup>H]dFdCTP/[<sup>3</sup>H]dFdCDP ratio of 2.3. ATP/ADP ratios for untreated vs. gemcitabine-treated cells, were 3.6 vs. 2.8 for RL-7, and 3.1 vs. 2.1 for RL-G, respectively. Since gemcitabine has the ability to be incorporated into both DNA and RNA, the amount of [<sup>3</sup>H]gemcitabine present in the nucleic acid extractions was determined. No [<sup>3</sup>H]gemcitabine was detected in the DNA or RNA of RL-G cells as expected (Fig. <figr fid="F2">2C</figr>). In RL-7 cells, the incorporation of [<sup>3</sup>H]gemcitabine was higher in genomic DNA (11.9-fold) than in total RNA (Fig. <figr fid="F2">2C</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Detection of gemcitabine-induced cell cycle perturbations and cell cycle-related events</p>
            </st>
            <p>Flow cytometry of RL-7 and RL-G cells demonstrated a diploid cell population. After 24 h of continuous exposure to gemcitabine, a substantial accumulation of RL-7 cells in G0/G1 phase was observed with a decrease in the G2/M fraction (Table <tblr tid="T2">2</tblr>). At 72 h, a maximal arrest of cells in the S phase fraction (84%) was detected. The G0/G1 fraction dropped dramatically as the cells moved into S phase. Conversely, in RL-G cells gemcitabine treatment slightly arrested the cell cycle in S-phase at the expense of the G2/M fraction (Table <tblr tid="T2">2</tblr>). No G1 phase arrest was observed in this cell line (Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primer sequences used for semi-quantitative PCR assessment of the deoxycytidine kinase gene.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>Exon</p>
                     </c>
                     <c ca="left">
                        <p>Forward Primer 5'-3'</p>
                     </c>
                     <c ca="left">
                        <p>Reverse Primer 5'-3'</p>
                     </c>
                     <c ca="left">
                        <p>Product size</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5'-UTR</p>
                     </c>
                     <c ca="left">
                        <p>AGTCACCGTTTTCCCCTTCT</p>
                     </c>
                     <c ca="left">
                        <p>CTTTGTTCAACACGCCAAAA</p>
                     </c>
                     <c ca="center">
                        <p>206</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>GGCAGGGAGCCTTTTCATTT</p>
                     </c>
                     <c ca="left">
                        <p>CTCCTCTAAACCAAGAGGCT</p>
                     </c>
                     <c ca="center">
                        <p>339</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>CCAGACCTCAGACAATCTGA</p>
                     </c>
                     <c ca="left">
                        <p>CCCAGCTCAGCCATTCATTA</p>
                     </c>
                     <c ca="center">
                        <p>490</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>GTGCCACTGGATTTAGGAGA</p>
                     </c>
                     <c ca="left">
                        <p>GTTGGGAGGCTGGAGTTAAA</p>
                     </c>
                     <c ca="center">
                        <p>358</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="left">
                        <p>AGCGTGAGTAGAGAGACACA</p>
                     </c>
                     <c ca="left">
                        <p>CGCTATCAATACCACCAAGG</p>
                     </c>
                     <c ca="center">
                        <p>439</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="left">
                        <p>CTGCCAGATGAAGTACTGCA</p>
                     </c>
                     <c ca="left">
                        <p>TGTCAGATTCTGAGATTCCG</p>
                     </c>
                     <c ca="center">
                        <p>458</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="left">
                        <p>AGTTACTTATACAGCTGGGG</p>
                     </c>
                     <c ca="left">
                        <p>TATCTGGAACCATTTGGCTGC</p>
                     </c>
                     <c ca="center">
                        <p>180</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Comparison of apoptosis and apoptotic pathways between RL-7 and RL-G cells</p>
            </st>
            <p>Exposure of cells for 24 h and 72 h with gemcitabine caused a proportional increase of annexin-V staining typical of apoptosis in RL-7 cells. However, the amount of apoptotic cells did not increase in the RL-G cell line (Fig. <figr fid="F3">3A</figr>). Poly-(ADP-ribose) polymerase (PARP) cleavage was detected after 72 h of exposure to gemcitabine of RL-7 cells (Fig. <figr fid="F3">3B</figr>). As shown in Figure <figr fid="F3">3C</figr>, no significant modifications of the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein Bax levels were detected after gemcitabine exposure.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Effect of gemcitabine (0.3 &#956;M) on apoptosis and protein expression of PARP and pro- and antiapoptotic members of the Bcl-2/ Bax family</p>
               </caption>
               <text>
                  <p><b>Effect of gemcitabine (0.3 &#956;M) on apoptosis and protein expression of PARP and pro- and antiapoptotic members of the Bcl-2/ Bax family. </b>(A) Flow cytometric detection of the Annexin-V staining in RL-7 and RL-G cells measured at different time intervals after incubation with gemcitabine 0.3 &#956;M (B) PARP cleavage as detected by western blot after gemcitabine treatment at different time intervals (C) Bcl-2 and Bax expression by western blot. RL-7 and RL-G cells were treated with gemcitabine 0.3 &#956;M for 24 and 72 h and subsequently lysed, subjected to SDS-PAGE, and immunoblotted with the corresponding monoclonal antibody as described in Material and Methods. The experiments shown are representative of two performed. C: control.</p>
               </text>
               <graphic file="1471-2210-4-8-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Analysis of factors involved in gemcitabine metabolism and drug targets by quantitative reverse-transcriptase polymerase chain reaction (RT-PCR)</p>
            </st>
            <p>To test whether resistance of RL-G cells to gemcitabine was due to multiple mechanisms, the mRNA levels of several biological parameters (and potential drug targets) involved in gemcitabine metabolism, were analyzed by real time-PCR. According to quantitative RT-PCR results shown in Figure <figr fid="F4">4A</figr>, RL-G cells had no detectable dCK expression compared to RL-7 cells. In contrast, the 5'-nucleotidases, cN-II and dNT-2, were slightly increased in RL-G cells (2-fold). Similarly, expression levels of hENT1 and RNR subunits 1 and 2 were increased in 2.7-, 3.4- and 1.8-fold in RL-G cells, respectively (Figure <figr fid="F4">4B</figr>). hENT2, 5'-nucleotidase dNT1 and DNA POL mRNA were expressed at similar levels in both cell lines. Neither RL-7 cells nor RL-G cells expressed detectable CDD (data not shown).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Analysis of other known mechanisms of resistance to gemcitabine</p>
               </caption>
               <text>
                  <p><b>Analysis of other known mechanisms of resistance to gemcitabine. (A) </b>Quantitative real time RT-PCR analysis of factors implicated in the activation or degradation of gemcitabine in RL-7 and RL-G cells; 18S ribosomal RNA (18S), deoxycytidine kinase (dCK), high Km 5'-nucleotidase (cNII), 5'-3'-nucleotidase (dNT1) and mitochondrial 5'-nucleotidase (dNT2) <b>(B) </b>Quantitative real time PCR analysis of factors implicated in the transport and intracellular targeting of gemcitabine; human equilibrative nucleoside transporter 1 and 2 (ENT1; ENT2), ribonucleotide reductase M1 and M2 subunits (M1, M2) and DNA polymerase &#945; (Pol). RT-PCR of these genes was performed as described in Material and Methods. Results are expressed as % of PCR arbitrary unit expression in RL-G cells related to RL-7 PCR arbitrary unit expression.</p>
               </text>
               <graphic file="1471-2210-4-8-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>PCR analysis of dCK gene</p>
            </st>
            <p>To determine the cellular modification responsible for dCK mRNA down-regulation, we performed a qualitative study of the dCK gene. For this purpose, exons of the dCK gene as well as 5'-untranslated regions were amplified by PCR as described in the methods section. Figure <figr fid="F5">5</figr> shows PCR products obtained using genomic DNA from RL-7 and RL-G cells. In resistant RL-G cells, no amplicons were obtained for regions located before the fourth exon, suggesting a partial deletion of the dCK gene in this cell line. Exons 4, 5, 6 and 7 of the human dCK gene were amplified in both cell lines. These results suggest a genetic modification of the dCK gene in RL-G cells.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Semi-quantitative PCR assesment of exons 2 to 7 of the dCK gene and a 5'-untranscribed region</p>
               </caption>
               <text>
                  <p>Semi-quantitative PCR assesment of exons 2 to 7 of the dCK gene and a 5'-untranscribed region. Genomic DNA and PCR were performed as described in Methods section.</p>
               </text>
               <graphic file="1471-2210-4-8-5"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Our results show that dCK-deficient RL-G lymphoma cells are resistant to gemcitabine both <it>in vitro </it>and <it>in vivo</it>. RL-G cells accumulated only trace amounts of phosphorylated derivatives of [<sup>3</sup>H]gemcitabine compared to their parental counterpart. This lack of accumulation was not due to decreased inward transport of gemcitabine by nucleoside transporters because mRNA expression of nucleoside transporters and the initial uptake rates measured were similar for both cell lines. The lack of [<sup>3</sup>H]gemcitabine nucleotide accumulation and incorporation into nucleic acids in RL-G cells was explained by the lack of dCK expression in these cells.</p>
         <p>A relationship between lack of dCK expression and decreased dFd-CTP accumulation has already been shown by other investigators, both in selected and non-selected cell lines which had various levels of dCK activity, including dCK-deficient lines (reviewed in <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>). The observed cross-resistance of the RL-G cells to other pyrimidine and purine analogues may also be due to dCK deficiency. Other authors have also shown cross-resistance of gemcitabine-resistant cells to other nucleoside analogues due to dCK deficiency <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>In keeping with the <it>in vitro </it>results, the RL-G mouse xenografts were resistant to gemcitabine treatment in contrast to the parental RL-7 tumors. These data are are consistent with the observations reported by other authors. Ruiz van Haperen <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> demonstrated that human ovarian carcinoma A2780 xenografts were highly resistant to gemcitabine, mainly because of a decreased dCK activity. More recently, Blackstock <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> demonstrated that transfection of the <it>dCK </it>gene into HT-29 human colon carcinoma xenografts resulted in increased expression of dCK, enhanced dFd-CTP accumulation and a potentiated <it>in vivo </it>tumor response to gemcitabine. Our results confirm a major role for dCK in <it>in vitro </it>and <it>in vivo </it>resistance to gemcitabine.</p>
         <p>To elucidate why dCK mRNA expression was absent in the resistant cells, we analyzed the dCK gene by PCR. Our data show that the deficiency in dCK mRNA expression as detected by quantitative PCR is due to a partial deletion in the 5'-region of the dCK gene developed during the step-wise selection process with increasing concentrations of gemcitabine. It was previously reported that deletions of exon 3 conferred resistance to pyrimidine nucleoside analogues in a human melanoma cell line <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Deletions of exon 4 and 5 were also related with resistance to ara-C and gemcitabine in leukemic, fibrosarcoma and ovarian cell lines and leukemic blasts from acute myeloid leukemia patients <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. The nature of the deletion mutant seems to be dependent on the nucleoside analogue which was used for establishing resistant cells, although the chemical structures and the molecular targets of these nucleosides are similar.</p>
         <p>It is common to observe the presence of multiple resistance mechanisms when drug resistance is induced artificially <it>in vitro </it>by prolonged exposure <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B30">30</abbr></abbrgrp>. Gemcitabine resistance demonstrated by RL-G cells may involve minor contributions from other resistance mechanisms in addition to dCK deficiency. Previous detailed investigations using the purified ribonucleotide reductase have elucidated the mechanism-based inhibition of this protein by dFd-CDP <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. <it>In vitro </it>data suggests irreversible binding of the R1 subunit as the reasonable target for enzyme inactivation <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Such inhibition of the R1 subunit depends on the availability of dFd-CDP and on the synthesis of new proteins to restore enzyme activity. Thus, an increase in RNR-M1 expression may also have contributed to the resistance phenotype of RL-G cells. However, as indicated earlier, RL-G cells accumulated only trace amounts of phosphorylated derivatives of [<sup>3</sup>H]gemcitabine indicating that the major mechanism of resistance to gemcitabine in these cells involved drug activation.</p>
         <p>RL-G cells also expressed a 2-fold increase of the 5'-nucleotidases cN-II and dNT-2. The role of 5'-nucleotidases in gemcitabine resistance is controversial. We previously observed that total 5'-nucleotidase activity was 14-fold increased in K562 human leukemia cells selected for resistance to gemcitabine <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. In contrast, Schirmer <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> demonstrated that cladribine-resistant HL60 cells expressing high levels of cN-II were not resistant to gemcitabine. In addition, recent <it>in vitro </it>studies with different recombinant 5'-nucleotidases have not shown a direct degradation of dFd-CMP <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Thus, whether increased levels of these two 5'-nucleotidases contribute to gemcitabine resistance observed in our model is not clear.</p>
         <p>In our model, RL-7 cells were more susceptible to gemcitabine-induced apoptosis than RL-G cells, in keeping with previous evidence on the role of gemcitabine as a potent inducer of apoptosis <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The presence of PARP cleavage found in the RL-7 cells demonstrated that apoptosis may involve the caspase-3 pathway. We also analyzed the expression of Bcl-2 and Bax proteins. These two proteins have opposing effects, with Bcl-2 serving to prolong cell survival and Bax acting as an accelerator of apoptosis <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. Our results show no correlation between Bcl-2 and Bax protein levels and the extent of apoptosis in lymphoma cells exposed to gemcitabine. These results are in agreement with the findings of Gazzit <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> who reported that the extent of gemcitabine-induced apoptosis is independent of the levels of Bcl-2 expression. However, we have previously found that in breast cancer cells the extent of apoptosis was correlated with Bcl-2 expression <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, further supporting the cell type dependence of the response of the apoptotic pathway.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>In this human lymphoma model, the <it>in vitro </it>and <it>in vivo </it>resistance to gemcitabine can mainly be attributed to the partial deletion of dCK gene. Therapeutic strategies aiming to overcome dCK deficiency may be useful in enhancing the cytotoxic effects of gemcitabine. In this setting, stimulation of dCK activity can be induced by pre-treating cancer cells with etoposide, other nucleoside analogues or gamma radiation before gemcitabine administration <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. The effect seems to be cell-specific and dependent on the administration scheme and the basal dCK levels. dCK gene-directed therapies may also be useful in enhancing the cytotoxic effects of gemcitabine by affecting the metabolism of the drug <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Another possibility would be to administer mononucleotide prodrugs of gemcitabine <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp> bearing transient phosphate protectors that would deliver the corresponding 5'-mononucleotide inside the cell without requiring dCK activation. This strategy has already shown succesful activity in overcoming ara-C resistance due to dCK deficiency <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Reagents</p>
            </st>
            <p>Gemcitabine (Gemzar<sup>&#174;</sup>) was a kind gift from Eli Lilly (Indianapolis, IN, USA). Stock solutions were prepared in distilled water and fresh dilutions were prepared before each experiment. Dilazep, tri-<it>N</it>-octylamine, 1,1,2-trichlorotrifluoroethane, propidium iodide and MTT were purchased from Sigma-Aldrich (St. Louis, MI, USA). Bradford protein assay solution was purchased from Bio-Rad Laboratories (Ontario, Canada). [<sup>3</sup>H]Gemcitabine (14 Ci/mmol) and [<sup>3</sup>H]uridine (17.7 Ci/mmol) were purchased from Moravek Biochemicals Inc. (Brea, CA, USA). Ecolite&#8482; was purchased from ICN (Costa Mesa, CA, USA). Antibodies against Bax were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA); antibodies against Bcl-2 were purchased from DAKO (Glostrup, Denmark). Peroxidase-conjugated secondary antibodies were purchased from Covalab (Oullins, France). Enhanced chemiluminescence western blot detection reagents (ECL system) were purchased from Amersham (Amersham Corp, Buckinghamshire, UK). Other reagents used were analytical or HPLC grade and commercially available.</p>
         </sec>
         <sec>
            <st>
               <p>Cell lines</p>
            </st>
            <p>The RL-7 cells are derived from a human follicular lymphoma <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. The resistant variant RL-G was developed using step-wise increases of concentration of gemcitabine over a 12 month period. The maximum concentration used during selection was 2 &#956;M. All cells were grown on 25 cm<sup>2 </sup>flasks at 37&#176;C in RPMI containing 10% fetal calf serum, 1% L-glutamine and 2% penicillin-streptomycin in a humidified atmosphere containing 5% CO<sub>2</sub>.</p>
         </sec>
         <sec>
            <st>
               <p>[<sup>3</sup>H]Gemcitabine transport and accumulation</p>
            </st>
            <p>Cellular uptake assays using suspensed cells have been described previously <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B44">44</abbr></abbrgrp>. Assays (10<sup>6 </sup>cells/tube) were conducted at room temperature in transport buffer (20 mM Tris/HCl, 3 mM K<sub>2</sub>HPO<sub>4</sub>, 1 mM MgCl<sub>2</sub>.6H<sub>2</sub>O, 2 mM CaCl<sub>2</sub>, 5 mM glucose and 130 mM NaCl, pH 7.4, 300 &#177; 15 mOsm) at various time intervals. Cell pellets were lysed with 5% Triton X-100 and mixed with Ecolite&#8482; scintillation fluid to measure the cell-associated radioactivity (Beckman LS 6500 scintillation counter; Beckman-Coulter Canada, Mississauga, ON). Initial uptake rates were measured over 2&#8211;10 s and drug accumulation was determined after exposure of cells to 10 &#956;M [<sup>3</sup>H]gemcitabine for 4 h.</p>
         </sec>
         <sec>
            <st>
               <p>Extraction of nucleic acids for [<sup>3</sup>H]Gemcitabine scintillation assay</p>
            </st>
            <p>Exponentially growing RL-7 and RL-G cells were exposed to 10 &#956;M [<sup>3</sup>H]gemcitabine for 4 h at 37&#176;C. Cells were harvested by centrifugation and washed with phosphate-buffered saline. Aliquots (5 &#215; 10<sup>6 </sup>cells) were snap-frozen in liquid nitrogen and stored at -70&#176;C before HPLC analysis and nucleic acid extraction. DNA was isolated using a Wizard genomic DNA kit (Promega Corp., Madison, WI, USA). Total RNA was extracted using an RNA easy kit (Qiagen, Valencia, CA, USA) and treated with RNase-free DNase 1 (Pharmacia Biotech) to remove any DNA contamination. Radioactivity incorporation was determined by scintillation counting. Experiments were performed in duplicate.</p>
            <sec>
               <st>
                  <p>HPLC analysis</p>
               </st>
               <p>Cell pellets (prepared as described above) were extracted with 10% trichloroacetic acid on ice for 15 min and centrifuged to remove cell the protein precipitate. The acidic extract was neutralized with 2 volumes of tri-<it>N</it>-octylamine/1,1,2-trichlorotrifluoroethane (1:4) and the aqueous layer passed through a 0.22 &#956;m filter before injection onto a Partisil SAX 10 column (250 &#215; 4.6 mm internal diameter). The resolution of the nucleotides was achieved using a gradient (0%A-80%B) and based on a method described by Gandhi <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Buffer A, 10 mM, pH 2.9; buffer B, 750 mM ammonium phosphate, pH 4.5. The flow rate of the eluent was 1.5 mL/min and was monitored by UV absorbance (260 nm). Fractions were also collected for radioactivity measurements on a scintillation counter.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>RNA extraction, RT-PCR and quantitative PCR</p>
            </st>
            <p>The level of mRNA expression of metabolic factors involved in gemcitabine resistance was assessed by quantitative real time RT-PCR, performed in a LightCycler detection system (Roche, Mannheim, Germany) as previously described <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Briefly, cDNA (5 &#956;l) was mixed with primers (300 nM each), LightCycler-FastStart DNA Master SYBR Green I (Roche) (hENT1, hENT2, CDD, RNR-M1, RNR-M2 and DNA POL) or LightCycler-FastStart DNA master hybridization probes (Roche) (18S, dCK, cNII, dNT-1 and dNT-2), and probes (130 nM; if necessary) in a total volume of 20 &#956;l. These reactions were prepared in duplicate. Primers and probes sequences for hENT1, dCK, CDD, cNII, dNT-1, RNR-M2 and DNA POL are published elsewhere <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Primers for hENT2 were as follows: for: atgagaacgggattcccagtag ; rev: gctctgattccggctcctt. Primers for RNR-M1 were as follows: for: gcagctgagagaggtgcttt; rev: aatggttgtagaattaagaatagc. Primers and probes for dNT-2 were as follows: for: catcagcatttgggagtcaa; rev: cgacacaatctgctccagaa; probe: 5'-fam-cgtcttcatctgcacaagcccca-tamra. All samples were analyzed in three separate experiments.</p>
            <p>For each sample (RL-7 or RL-G cell lines) and the calibrator (K562 cell line), the relative amount of a target gene and a reference gene (18S) were determined. Crossing point values (C<sub>t</sub>), which are the PCR cycle numbers at which the accumulated fluorescent signal in each reaction crosses a threshold above background, were obtained with the LightCycler software 3.5 (Roche) using the second derivative maximum method. (C<sub>t</sub>) values are a function of the amplification efficiency of the respective PCR. These data were then exported into the RelQuant software (Roche) as *.txt files. This software provides efficiency-corrected, calibrator-normalized quantification results. Results are expressed as the target/reference ratio of the sample divided by the target/reference ratio of the calibrator and therefore are corrected for sample inhomogenities and detection-caused variances. The efficiency-corrected quantification performed by Relquant is based on relative standard curves describing the PCR efficiencies of each target and the reference gene. The relative standard curves are determined and are used for each analysis.</p>
            <p>Ratio results obtained with the RelQuant software were considered as final relative PCR arbitrary units. Results were then expressed as % of PCR arbitrary units in RL-G cells related to RL-7 cells PCR arbitrary unit expression.</p>
         </sec>
         <sec>
            <st>
               <p>DNA extraction and PCR assay for the dCK gene</p>
            </st>
            <p>Genomic DNA was prepared with a phenol/chloroform extraction method <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. The coding sequence of the 7 last exons of the human dCK gene were amplified in a final reaction volume of 25 &#956;l using PCR primers (Table <tblr tid="T1">1</tblr>), <it>Taq </it>DNA polymerase (Invitrogen) and 250 ng of genomic DNA. The PCR program profile was: 10 min at 94 &#176;C followed by 50 cycles of 30 sec at 94 &#176;C, 30 sec at 60 &#176;C and 30 sec at 72 &#176;C. The PCR products were separated on agarose gel 1,5% using low molecular DNA weight (Invitrogen) as marker of size.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Analysis of flow cytometric cell cycle distribution before and after exposure to gemcitabine (0.3 &#956;M) <sup><it>a</it></sup>.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>RL-7</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>RL-G</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Control</p>
                     </c>
                     <c ca="left">
                        <p>24 h</p>
                     </c>
                     <c ca="left">
                        <p>72 h</p>
                     </c>
                     <c ca="left">
                        <p>Control</p>
                     </c>
                     <c ca="left">
                        <p>24 h</p>
                     </c>
                     <c ca="left">
                        <p>72 h</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G1</p>
                     </c>
                     <c ca="left">
                        <p>53.2 &#177; 9.0</p>
                     </c>
                     <c ca="left">
                        <p>63.3 &#177; 1.5</p>
                     </c>
                     <c ca="left">
                        <p>15.0 &#177; 1.4</p>
                     </c>
                     <c ca="left">
                        <p>39.7 &#177; 7.5</p>
                     </c>
                     <c ca="left">
                        <p>38.2 &#177; 6.4</p>
                     </c>
                     <c ca="left">
                        <p>40.9 &#177; 2.6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>39.2 &#177; 3.0</p>
                     </c>
                     <c ca="left">
                        <p>36.5 &#177; 1.3</p>
                     </c>
                     <c ca="left">
                        <p>84.7 &#177; 1.4</p>
                     </c>
                     <c ca="left">
                        <p>46.3 &#177; 10.6</p>
                     </c>
                     <c ca="left">
                        <p>50.3 &#177; 8.5</p>
                     </c>
                     <c ca="left">
                        <p>51.6 &#177; 1.4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G2/M</p>
                     </c>
                     <c ca="left">
                        <p>7.4 &#177; 6.1</p>
                     </c>
                     <c ca="left">
                        <p>0.3 &#177; 0.1</p>
                     </c>
                     <c ca="left">
                        <p>0.2 &#177; 0.3</p>
                     </c>
                     <c ca="left">
                        <p>13.8 &#177; 3.2</p>
                     </c>
                     <c ca="left">
                        <p>11.2 &#177; 2.2</p>
                     </c>
                     <c ca="left">
                        <p>7.2 &#177; 1.4</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup><it>a </it></sup>The reported values (mean &#177; SD, n = 3) are expressed as percentage of total cells.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Flow cytometric detection of cell cycle and apoptosis</p>
            </st>
            <p>For analysis of DNA content and cell cycle distribution, RL-7 and RL-G cells were treated with gemcitabine 0.3 &#956;M for 24 h and 72 h. After drug-exposure, 10<sup>6 </sup>cells/ml were resuspended in 2 ml of propidium iodide solution (50 &#956;l/ml), incubated at 4&#176;C overnight and then analyzed by flow cytometry. For apoptosis determination, we used the Annexin-V-Fluos Staining Kit (Boehringer Mannheim, Gmbh, Germany) as recommended by manufacturers. Flow cytometry was performed on a FACScalibur (Becton Dickinson, San Jose, CA, USA). For determination of the apoptotic fraction, analysis was performed using CellQuest&#8482; software (Becton Dickinson, San Jose, CA, USA). Cell cycle distribution and DNA ploidy status were calculated after exclusion of cell doublets and aggregates on a FL2-area/FL2-width dot plot using Modfit LT 2.0&#8482; software (Verity Software Inc, Topsham, ME, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Western Blots</p>
            </st>
            <p>Protein expression was determined by western blot analysis in untreated RL-7 and RL-G cells and after 24 h incubation with gemcitabine 0.3 &#956;M. Briefly, protein was extracted from cells with cold lysis buffer (20 mM Tris-HCL pH 6.8, 1 mM MgCl2, 2 mM EGTA, 0.5% NP40, STI 1 mg/ml, leupeptin 100 &#956;g/ml, aprotinin 100 &#956;g/ml, benzamidine 30 mg/ml, TPCK 1 mg/ml and PMSK 5 mg/ml). Cell lysates were resolved by 12% SDS-PAGE, and transferred onto a nitro-cellulose membrane (Hybond-ECL, Amersham Corp, Buckinghamshire, UK). The blots were incubated with the appropriate dilution of primary antibody, followed by incubation with peroxidase-conjugated secondary antibody. Protein signals were detected by chemiluminiscence and exposure to Kodak film (Eastman Kodak Company, Rochester, NY, USA). Horizontal scanning densitometry was performed on western blots by utilizing acquisition into Adobe PhotoShop (Apple, Cupertino, CA, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Animal studies</p>
            </st>
            <p>Experiments were performed in 4 week-old female athymic nude mice (IFFA-CREDO, L'Arbresle, France). The animals were kept in conventional housing. Access to food and water was not restricted. RL-7 and RL-G xenografts were developed in groups of five mice. Each animal (average body weight 25 g before injection) received a subcutaneous injection in the right flank area containing 10<sup>6 </sup>RL-7 or RL-G cells in serum-free RPMI 1640 (day 0). After 24 h, gemcitabine was given intraperitoneally at a dose of 200 mg/kg once a week (6 doses; 3 consecutive weeks followed by 1 resting week) in the treated group. Initial drug toxicity studies were performed in non-tumor bearing mice at these doses and no major toxicities were observed (weight loss &lt;10%).</p>
            <p>The mice were inspected daily for s.c. tumor development and evaluation of clinical condition, and once tumor development occurred, tumor size was determined by caliper measurements while monitoring changes in animal weight twice a week. Animals were euthanized when their total tumor burden reached approximately 5,000 mg (15% of body weigth) to avoid animal discomfort or if clinical conditions may anticipate the potential for animal suffering.</p>
            <p>The endpoints for assessing tumor activity were as follows: (a) tumor weight (mg) = (A &#215; B<sup>2</sup>)/2, where A and B are the tumor length and width (in mm), respectively; (b) tumor growth inhibition = T/C, where T is the weight of treated tumor and C is the weight of control group, both evaluated at 60 days after injection. All studies involving mice were performed under Institutional Review Board-approved protocol.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>List of abbreviations used</p>
         </st>
         <p>dFdC, gemcitabine; hENT1, human equilibrative nucleoside transporter 1; dCK, deoxycytidine kinase; CDD, cytidine deaminase; 5 NT, 5'-nucleotidase; RNR-M1, ribonucleotide reductase subunit M1; RNR-M2, ribonucleotide reductase subunit M2; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide; IC<sub>50</sub>, inhibitory concentration 50; DNA POL, DNA polymerase &#945;.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>CMG participated in the design and coordination of the study and carried out flow cytometric detection of cell cycle and apoptosis, western blots and animal studies. MLC participated in the design and coordination of the study and carried out [<sup>3</sup>H]Gemcitabine transport and accumulation assay, extraction of nucleic acids for [<sup>3</sup>H]Gemcitabine scintillation assay, HPLC analysis. LJ performed the DNA extraction and PCR assay for the dCK gene. CLS performed the [<sup>3</sup>H]Gemcitabine transport and accumulation assay, extraction of nucleic acids for [<sup>3</sup>H]Gemcitabine scintillation assay and HPLC analysis. EC carried out RNA extraction, RT-PCR and quantitative PCR. JRM participated in the design of the study and coordinated the [<sup>3</sup>H]Gemcitabine transport and accumulation assay, extraction of nucleic acids for [<sup>3</sup>H]Gemcitabine scintillation assay and HPLC analysis. CD participated in the design of the study and developed the RL-G cell line. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported in part by the Ligue Contre le Cancer du Rh&#244;ne, the Fondation de France and the National Cancer Institute of Canada.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Nucleoside analogues and nucleobases in cancer treatment</p>
            </title>
            <aug>
               <au>
                  <snm>Galmarini</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Lancet Oncol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <fpage>415</fpage>
            <lpage>424</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1470-2045(02)00788-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">12142171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Functional nucleoside transporters are required for gemcitabine influx and manifestation of toxicity in cancer cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Mani</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Selner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mowles</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Belt</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Crawford</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Cass</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1998</pubdate>
            <volume>58</volume>
            <fpage>4349</fpage>
            <lpage>4357</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9766663</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Differential transport of cytosine-containing nucleosides by recombinant human concentrative nucleoside transporter protein hCNT1</p>
            </title>
            <aug>
               <au>
                  <snm>Graham</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Leithoff</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Coe</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Mowles</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Cass</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Nucleosides Nucleotides Nucleic Acids</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>415</fpage>
            <lpage>434</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10772724</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Kinetic studies on 2',2'-difluorodeoxycytidine (Gemcitabine) with purified human deoxycytidine kinase and cytidine deaminase</p>
            </title>
            <aug>
               <au>
                  <snm>Bouffard</snm>
                  <fnm>DY</fnm>
               </au>
               <au>
                  <snm>Laliberte</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Momparler</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>1993</pubdate>
            <volume>45</volume>
            <fpage>1857</fpage>
            <lpage>1861</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0006-2952(93)90444-2</pubid>
                  <pubid idtype="pmpid">8494545</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Preclinical characteristics of gemcitabine</p>
            </title>
            <aug>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gandhi</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Anticancer Drugs</source>
            <pubdate>1995</pubdate>
            <volume>6 Suppl 6</volume>
            <fpage>7</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8718419</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Forced expression of cytidine deaminase confers resistance to cytosine arabinoside and gemcitabine</p>
            </title>
            <aug>
               <au>
                  <snm>Neff</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Blau</snm>
                  <fnm>CA</fnm>
               </au>
            </aug>
            <source>Exp Hematol</source>
            <pubdate>1996</pubdate>
            <volume>24</volume>
            <fpage>1340</fpage>
            <lpage>1346</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8862446</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Cross-resistance in the 2',2'-difluorodeoxycytidine (gemcitabine)-resistant human ovarian cancer cell line AG6000 to standard and investigational drugs</p>
            </title>
            <aug>
               <au>
                  <snm>Bergman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Giaccone</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>van Moorsel</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Mauritz</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Noordhuis</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Eur J Cancer</source>
            <pubdate>2000</pubdate>
            <volume>36</volume>
            <fpage>1974</fpage>
            <lpage>1983</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0959-8049(00)00246-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">11000580</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Lack of cross-resistance with gemcitabine and cytarabine in cladribine-resistant HL60 cells with elevated 5'-nucleotidase activity</p>
            </title>
            <aug>
               <au>
                  <snm>Schirmer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stegmann</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Geisen</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Konwalinka</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Exp Hematol</source>
            <pubdate>1998</pubdate>
            <volume>26</volume>
            <fpage>1223</fpage>
            <lpage>1228</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9845378</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>2',2'-Difluoro-deoxycytidine (gemcitabine) incorporation into RNA and DNA of tumour cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Ruiz van Haperen</snm>
                  <fnm>VW</fnm>
               </au>
               <au>
                  <snm>Veerman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Vermorken</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>1993</pubdate>
            <volume>46</volume>
            <fpage>762</fpage>
            <lpage>766</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0006-2952(93)90566-F</pubid>
                  <pubid idtype="pmpid">8363650</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Inhibition of ribonucleotide reduction in CCRF-CEM cells by 2',2'-difluorodeoxycytidine</p>
            </title>
            <aug>
               <au>
                  <snm>Heinemann</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>YZ</fnm>
               </au>
               <au>
                  <snm>Chubb</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hertel</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Grindey</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Mol Pharmacol</source>
            <pubdate>1990</pubdate>
            <volume>38</volume>
            <fpage>567</fpage>
            <lpage>572</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2233693</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Gemcitabine: metabolism, mechanisms of action, and self-potentiation</p>
            </title>
            <aug>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>YZ</fnm>
               </au>
               <au>
                  <snm>Heinemann</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Grunewald</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gandhi</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Semin Oncol</source>
            <pubdate>1995</pubdate>
            <volume>22</volume>
            <fpage>3</fpage>
            <lpage>10</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7481842</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>2'-Deoxy-2'-methylenecytidine and 2'-deoxy-2',2'-difluorocytidine 5'-diphosphates: potent mechanism-based inhibitors of ribonucleotide reductase</p>
            </title>
            <aug>
               <au>
                  <snm>Baker</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Banzon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bollinger</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Stubbe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Samano</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Robins</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Lippert</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Jarvi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Resvick</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Med Chem</source>
            <pubdate>1991</pubdate>
            <volume>34</volume>
            <fpage>1879</fpage>
            <lpage>1884</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2061926</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Action of 2',2'-difluorodeoxycytidine on DNA synthesis</p>
            </title>
            <aug>
               <au>
                  <snm>Huang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Chubb</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hertel</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Grindey</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1991</pubdate>
            <volume>51</volume>
            <fpage>6110</fpage>
            <lpage>6117</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1718594</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Gemcitabine: a modulator of intracellular nucleotide and deoxynucleotide metabolism</p>
            </title>
            <aug>
               <au>
                  <snm>Heinemann</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Schulz</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Issels</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Semin Oncol</source>
            <pubdate>1995</pubdate>
            <volume>22</volume>
            <fpage>11</fpage>
            <lpage>18</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7481839</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Nucleoside analogues: mechanisms of drug resistance and reversal strategies</p>
            </title>
            <aug>
               <au>
                  <snm>Galmarini</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Leukemia</source>
            <pubdate>2001</pubdate>
            <volume>15</volume>
            <fpage>875</fpage>
            <lpage>890</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.leu.2402114</pubid>
                  <pubid idtype="pmpid">11417472</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Drug resistance to cytotoxic nucleoside analogues</p>
            </title>
            <aug>
               <au>
                  <snm>Jordheim</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Galmarini</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Curr Drug Targets</source>
            <pubdate>2003</pubdate>
            <volume>4</volume>
            <fpage>443</fpage>
            <lpage>460</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12866659</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Determinants of resistance to 2',2'-difluorodeoxycytidine (gemcitabine)</p>
            </title>
            <aug>
               <au>
                  <snm>Bergman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Drug Resistance Updates</source>
            <pubdate>2002</pubdate>
            <volume>5</volume>
            <fpage>19</fpage>
            <lpage>33</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1368-7646(02)00002-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">12127861</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Development and molecular characterization of a 2',2'-difluorodeoxycytidine-resistant variant of the human ovarian carcinoma cell line A2780</p>
            </title>
            <aug>
               <au>
                  <snm>Ruiz van Haperen</snm>
                  <fnm>VW</fnm>
               </au>
               <au>
                  <snm>Veerman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Boven</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Stegmann</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Hermsen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vermorken</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1994</pubdate>
            <volume>54</volume>
            <fpage>4138</fpage>
            <lpage>4143</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8033147</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Common resistance mechanisms to deoxynucleoside analogues in variants of the human erythroleukaemic line K562</p>
            </title>
            <aug>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fabianowska-Majewska</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mantincic</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Callet Bauchu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tigaud</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Gandhi</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Lepoivre</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Rolland</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Wyczechowska</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Fang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Gazzo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Voorn</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Vanier-Viornery</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>MacKey</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Br J Haematol</source>
            <pubdate>1999</pubdate>
            <volume>106</volume>
            <fpage>78</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2141.1999.01509.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10444166</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The role of deoxycytidine kinase in gemcitabine cytotoxicity</p>
            </title>
            <aug>
               <au>
                  <snm>van der Wilt</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Kroep</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Bergman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Loves</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Alvarez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Talianidis</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>van Groeningen</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Adv Exp Med Biol</source>
            <pubdate>2000</pubdate>
            <volume>486</volume>
            <fpage>287</fpage>
            <lpage>290</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11783501</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Overexpression of ribonucleotide reductase as a mechanism of resistance to 2,2-difluorodeoxycytidine in the human KB cancer cell line</p>
            </title>
            <aug>
               <au>
                  <snm>Goan</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yen</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1999</pubdate>
            <volume>59</volume>
            <fpage>4204</fpage>
            <lpage>4207</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10485455</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Expression of a non-functional p53 affects the sensitivity of cancer cells to gemcitabine</p>
            </title>
            <aug>
               <au>
                  <snm>Galmarini</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Clarke</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Falette</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Puisieux</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2002</pubdate>
            <volume>97</volume>
            <fpage>439</fpage>
            <lpage>445</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.1628</pubid>
                  <pubid idtype="pmpid" link="fulltext">11802204</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Sensitization of ara-C-resistant lymphoma cells by a pronucleotide analogue</p>
            </title>
            <aug>
               <au>
                  <snm>Galmarini</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Clarke</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Jordheim</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Perigaud</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gosselin</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Cros</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Dumontet</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2003</pubdate>
            <volume>107</volume>
            <fpage>149</fpage>
            <lpage>154</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.11339</pubid>
                  <pubid idtype="pmpid" link="fulltext">12925971</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Cross-resistance of the gemcitabine resistant human ovarian cancer cell line AG6000 to standard and investigational drugs</p>
            </title>
            <aug>
               <au>
                  <snm>Bergman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Ruiz van Haperen</snm>
                  <fnm>VW</fnm>
               </au>
               <au>
                  <snm>Veerman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kuiper</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Adv Exp Med Biol</source>
            <pubdate>1998</pubdate>
            <volume>431</volume>
            <fpage>587</fpage>
            <lpage>590</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9598133</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Decreased resistance to gemcitabine (2',2'-difluorodeoxycitidine) of cytosine arabinoside-resistant myeloblastic murine and rat leukemia cell lines: role of altered activity and substrate specificity of deoxycytidine kinase</p>
            </title>
            <aug>
               <au>
                  <snm>Bergman</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Pinedo</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Jongsma</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Brouwer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ruiz van Haperen</snm>
                  <fnm>VW</fnm>
               </au>
               <au>
                  <snm>Veerman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Leyva</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>1999</pubdate>
            <volume>57</volume>
            <fpage>397</fpage>
            <lpage>406</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-2952(98)00318-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">9933028</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Tumor uptake and elimination of 2',2'-difluoro-2'-deoxycytidine (gemcitabine) after deoxycytidine kinase gene transfer: correlation with in vivo tumor response</p>
            </title>
            <aug>
               <au>
                  <snm>Blackstock</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Lightfoot</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Case</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Tepper</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Mukherji</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>BS</fnm>
               </au>
               <au>
                  <snm>Swarts</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Hess</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>Clin Cancer Res</source>
            <pubdate>2001</pubdate>
            <volume>7</volume>
            <fpage>3263</fpage>
            <lpage>3268</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11595723</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Deletion mutants of human deoxycytidine kinase mRNA in cells resistant to antitumor cytosine nucleosides</p>
            </title>
            <aug>
               <au>
                  <snm>Obata</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Endo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Uchida</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sasaki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Jpn J Cancer Res</source>
            <pubdate>2001</pubdate>
            <volume>92</volume>
            <fpage>793</fpage>
            <lpage>798</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11473731</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>High incidence of alternatively spliced forms of deoxycytidine kinase in patients with resistant acute myeloid leukemia</p>
            </title>
            <aug>
               <au>
                  <snm>Veuger</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Honders</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Landegent</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Willemze</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Barge</snm>
                  <fnm>RM</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2000</pubdate>
            <volume>96</volume>
            <fpage>1517</fpage>
            <lpage>1524</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10942400</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Resistance to 1-beta-D-arabinofuranosylcytosine in human T-lymphoblasts mediated by mutations within the deoxycytidine kinase gene</p>
            </title>
            <aug>
               <au>
                  <snm>Owens</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Shewach</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Ullman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mitchell</snm>
                  <fnm>BS</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1992</pubdate>
            <volume>52</volume>
            <fpage>2389</fpage>
            <lpage>2393</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1568208</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Mechanisms of uptake and resistance to troxacitabine, a novel deoxycytidine nucleoside analogue, in human leukemic and solid tumor cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Gourdeau</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Clarke</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Ouellet</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Mowles</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Selner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Richard</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mackey</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Jolivet</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lafreniere</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Cass</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2001</pubdate>
            <volume>61</volume>
            <fpage>7217</fpage>
            <lpage>7224</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11585758</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Ribonucleotide reductases: radical enzymes with suicidal tendencies</p>
            </title>
            <aug>
               <au>
                  <snm>Stubbe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>van der Donk</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Chem Biol</source>
            <pubdate>1995</pubdate>
            <volume>2</volume>
            <fpage>793</fpage>
            <lpage>801</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/1074-5521(95)90084-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">8807812</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Cytosolic and mitochondrial deoxyribonucleotidases: activity with substrate analogs, inhibitors and implications for therapy</p>
            </title>
            <aug>
               <au>
                  <snm>Mazzon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rampazzo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Scaini</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Gallinaro</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Karlsson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meier</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Balzarini</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reichard</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bianchi</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>2003</pubdate>
            <volume>66</volume>
            <fpage>471</fpage>
            <lpage>479</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-2952(03)00290-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">12907246</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Bcl-2 and the regulation of programmed cell death</p>
            </title>
            <aug>
               <au>
                  <snm>Reed</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>1994</pubdate>
            <volume>124</volume>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.124.1.1</pubid>
                  <pubid idtype="pmpid" link="fulltext">8294493</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Cytosol-to-membrane redistribution of Bax and Bcl-X(L) during apoptosis</p>
            </title>
            <aug>
               <au>
                  <snm>Hsu</snm>
                  <fnm>YT</fnm>
               </au>
               <au>
                  <snm>Wolter</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Youle</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>3668</fpage>
            <lpage>3672</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.94.8.3668</pubid>
                  <pubid idtype="pmpid" link="fulltext">9108035</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Bim: a novel member of the Bcl-2 family that promotes apoptosis</p>
            </title>
            <aug>
               <au>
                  <snm>O'Connor</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Strasser</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>O'Reilly</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Hausmann</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Adams</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Cory</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Embo J</source>
            <pubdate>1998</pubdate>
            <volume>17</volume>
            <fpage>384</fpage>
            <lpage>395</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/emboj/17.2.384</pubid>
                  <pubid idtype="pmpid">9430630</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Bcl-2 overexpression is associated with resistance to paclitaxel, but not gemcitabine, in multiple myeloma cells</p>
            </title>
            <aug>
               <au>
                  <snm>Gazitt</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Rothenberg</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Hilsenbeck</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Fey</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Montegomrey</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Int J Oncol</source>
            <pubdate>1998</pubdate>
            <volume>13</volume>
            <fpage>839</fpage>
            <lpage>848</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9735415</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Activation of deoxycytidine kinase by inhibition of DNA synthesis in human lymphocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Csapo</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Sasvari-Szekely</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Spasokoukotskaja</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Talianidis</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Staub</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>2001</pubdate>
            <volume>61</volume>
            <fpage>191</fpage>
            <lpage>197</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-2952(00)00534-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">11163333</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Activation of deoxycytidine kinase by gamma-irradiation and inactivation by hyperosmotic shock in human lymphocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Csapo</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Keszler</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Safrany</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Spasokoukotskaja</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Talianidis</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Staub</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sasvari-Szekely</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>2003</pubdate>
            <volume>65</volume>
            <fpage>2031</fpage>
            <lpage>2039</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-2952(03)00182-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12787883</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Activation of deoxycytidine kinase during inhibition of DNA synthesis by 2-chloro-2'-deoxyadenosine (Cladribine) in human lymphocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Sasvari-Szekely</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Spasokoukotskaja</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Szoke</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Csapo</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Turi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Szanto</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Staub</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>1998</pubdate>
            <volume>56</volume>
            <fpage>1175</fpage>
            <lpage>1179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0006-2952(98)00108-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">9802328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Treatment of normal and malignant cells with nucleoside analogues and etoposide enhances deoxycytidine kinase activity</p>
            </title>
            <aug>
               <au>
                  <snm>Spasokoukotskaja</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sasvari-Szekely</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Keszler</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Albertioni</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Staub</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Eur J Cancer</source>
            <pubdate>1999</pubdate>
            <volume>35</volume>
            <fpage>1862</fpage>
            <lpage>1867</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0959-8049(99)00223-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10674004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Synthesis and study of a new series of phosphoramidate derivatives as mononucleotide prodrugs</p>
            </title>
            <aug>
               <au>
                  <snm>Egron</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Perigaud</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gosselin</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Aubertin</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Imbach</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Nucleosides Nucleotides Nucleic Acids</source>
            <pubdate>2001</pubdate>
            <volume>20</volume>
            <fpage>751</fpage>
            <lpage>754</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1081/NCN-100002422</pubid>
                  <pubid idtype="pmpid">11563108</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Prodrugs of Ara-CMP and Ara-AMP with a S-acyl-2-thioethyl (SATE) biolabile phosphate protecting group: synthesis and biological evaluation</p>
            </title>
            <aug>
               <au>
                  <snm>Bazzanini</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Manfredini</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Durini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Groschel</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Cinatl</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Balzarini</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Clercq</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Imbach</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Perigaud</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gosselin</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Nucleosides Nucleotides</source>
            <pubdate>1999</pubdate>
            <volume>18</volume>
            <fpage>971</fpage>
            <lpage>972</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10432722</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Growth inhibition of human lymphoma cell lines by the marine products, dolastatins 10 and 15</p>
            </title>
            <aug>
               <au>
                  <snm>Beckwith</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Urba</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Longo</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>1993</pubdate>
            <volume>85</volume>
            <fpage>483</fpage>
            <lpage>488</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8445676</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Molecular identification of the equilibrative NBMPR-sensitive (es) nucleoside transporter and demonstration of an equilibrative NBMPR- insensitive (ei) transport activity in human erythroleukemia (K562) cells</p>
            </title>
            <aug>
               <au>
                  <snm>Boleti</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Coe</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Cass</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Neuropharmacology</source>
            <pubdate>1997</pubdate>
            <volume>36</volume>
            <fpage>1167</fpage>
            <lpage>1179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0028-3908(97)00136-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">9364472</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Separation of 1-beta-D-arabinofuranosylcytosine 5'-triphosphate and 9-beta-D-arabinofuranosyl-2-fluoroadenine 5'-triphosphate in human leukemia cells by high-performance liquid chromatography</p>
            </title>
            <aug>
               <au>
                  <snm>Gandhi</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Danhauser</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>J Chromatogr</source>
            <pubdate>1987</pubdate>
            <volume>413</volume>
            <fpage>293</fpage>
            <lpage>299</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0378-4347(87)80242-6</pubid>
                  <pubid idtype="pmpid">3558682</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>A non-organic and non-enzymatic extraction method gives higher yields of genomic DNA from whole-blood samples than do nine other methods tested</p>
            </title>
            <aug>
               <au>
                  <snm>Lahiri</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Bye</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nurnberger</snm>
                  <fnm>J. I., Jr.</fnm>
               </au>
               <au>
                  <snm>Hodes</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Crisp</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Biochem Biophys Methods</source>
            <pubdate>1992</pubdate>
            <volume>25</volume>
            <fpage>193</fpage>
            <lpage>205</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0165-022X(92)90014-2</pubid>
                  <pubid idtype="pmpid">1494032</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

