<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2210-3-15</ui>
   <ji>1471-2210</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Enhanced &#946;<sub>2</sub>-adrenergic receptor (&#946;<sub>2</sub>AR) signaling by adeno-associated viral (AAV)-mediated gene transfer</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Jones</snm>
               <mi>M</mi>
               <fnm>Stacie</fnm>
               <insr iid="I1"/>
               <email>JonesStacieM@uams.edu</email>
            </au>
            <au id="A2">
               <snm>Hiller</snm>
               <fnm>F Charles</fnm>
               <insr iid="I2"/>
               <email>HillerFCharles@uams.edu</email>
            </au>
            <au id="A3">
               <snm>Jacobi</snm>
               <mi>E</mi>
               <fnm>Sandie</fnm>
               <insr iid="I3"/>
               <email>JacobiSandraE@uams.edu</email>
            </au>
            <au id="A4">
               <snm>Foreman</snm>
               <mi>K</mi>
               <fnm>Susan</fnm>
               <insr iid="I4"/>
               <email>ForemanSusanK@uams.edu</email>
            </au>
            <au id="A5">
               <snm>Pittman</snm>
               <mi>M</mi>
               <fnm>Laura</fnm>
               <insr iid="I4"/>
               <email>laurap81@yahoo.com</email>
            </au>
            <au id="A6">
               <snm>Cornett</snm>
               <mi>E</mi>
               <fnm>Lawrence</fnm>
               <insr iid="I5"/>
               <email>CornettLawrenceE@uams.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Departments of Pediatrics and Physiology and Biophysics University of Arkansas for Medical Sciences Arkansas Children's Hospital Little Rock, Arkansas, USA 72202</p>
            </ins>
            <ins id="I2">
               <p>Department of Internal Medicine University of Arkansas for Medical Sciences John L. McClellan Veteran's Administration Hospital Little Rock, Arkansas, USA 72205</p>
            </ins>
            <ins id="I3">
               <p>Department of Internal Medicine University of Arkansas for Medical Sciences Little Rock, Arkansas, USA 72205</p>
            </ins>
            <ins id="I4">
               <p>Department of Pediatrics University of Arkansas for Medical Sciences Arkansas Children's Hospital Little Rock, Arkansas, USA 72202</p>
            </ins>
            <ins id="I5">
               <p>Departments of Physiology and Biophysics and Internal Medicine University of Arkansas for Medical Sciences Little Rock, Arkansas, USA 72205</p>
            </ins>
         </insg>
         <source>BMC Pharmacology</source>
         <issn>1471-2210</issn>
         <pubdate>2003</pubdate>
         <volume>3</volume>
         <issue>1</issue>
         <fpage>15</fpage>
         <url>http://www.biomedcentral.com/1471-2210/3/15</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">14656380</pubid>
               <pubid idtype="doi">10.1186/1471-2210-3-15</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>19</day>
               <month>8</month>
               <year>2003</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>04</day>
               <month>12</month>
               <year>2003</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>04</day>
               <month>12</month>
               <year>2003</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2003</year>
         <collab>Jones et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>&#946;<sub>2</sub>-Adrenergic receptors (&#946;<sub>2</sub>AR) play important regulatory roles in a variety of cells and organ systems and are important therapeutic targets in the treatment of airway and cardiovascular disease. Prolonged use of &#946;-agonists results in tolerance secondary to receptor down-regulation resulting in reduced therapeutic efficiency. The purpose of this work is to evaluate the signaling capabilities of the &#946;<sub>2</sub>AR expressed by a recombinant adeno-associated viral (AAV) vector that also included an enhanced green fluorescent protein (EGFP) gene (AAV-&#946;<sub>2</sub>AR/EGFP).</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>By epifluorescence microscopy, ~40% of infected HEK 293 cells demonstrated EGFP expression. &#946;<sub>2</sub>AR density measured with [<sup>3</sup>H]dihydroalprenolol ([<sup>3</sup>H]DHA) increased either 13- or 77-fold in infected cells compared to mock infected controls depending on the culture conditions used. The [<sup>3</sup>H]DHA binding was to a single receptor population with a dissociation constant of 0.42 nM, as would be expected for wild-type &#946;<sub>2</sub>AR. Agonist competition assays with [<sup>3</sup>H]DHA showed the following rank order of potency: isoproterenol>epinephrine> norepinephrine, consistent with &#946;<sub>2</sub>AR interaction. Isoproterenol-stimulated cyclic AMP levels were 5-fold higher in infected cells compared to controls (314 &#177; 43 vs. 63.4 &#177; 9.6 nmol/dish; n = 3). Receptor trafficking demonstrated surface expression of &#946;<sub>2</sub>AR with vehicle treatment and internalization following isoproterenol treatment.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>We conclude that HEK 293 cells infected with AAV-&#946;<sub>2</sub>AR/EGFP effectively express &#946;<sub>2</sub>AR and that increased expression of these receptors results in enhanced &#946;<sub>2</sub>AR signaling. This method of gene transfer may provide an important means to enhance function in <it>in vivo </it>systems.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="refman"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The &#946;<sub>2</sub>-adrenergic receptor (&#946;<sub>2</sub>AR) is a member of the guanine nucleotide regulatory protein (G-protein) coupled receptor superfamily that mediates the effects of the catecholamines epinephrine and norepinephrine. &#946;<sub>2</sub>ARs are widely expressed in a variety of tissues including the airways of the lung and the cardiovascular system. &#946;<sub>2</sub>ARs mediate airway smooth muscle relaxation, increase ciliary motility, improve ion transport across epithelium, and reduce inflammatory cell mediator release. In the cardiovascular system, &#946;<sub>2</sub>ARs regulate vascular tone and enhance chronotropic effects on cardiac muscle <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>Investigators have previously used viral gene transfer and transgenic animal models to demonstrate that physiologic responsiveness to catecholamines can be enhanced by increasing &#946;<sub>2</sub>AR expression. Over-expression of &#946;<sub>2</sub>AR has been shown to have beneficial effects in the failing heart. Transgenic over-expression of &#946;<sub>2</sub>AR and &#946;-adrenergic receptor kinase 1 (&#946;ARK1) inhibitor in cardiac muscle results in improvement in cardiac contractile function caused by changes in &#946;<sub>2</sub>AR activation and signaling <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Adenoviral-mediated gene transfer of &#946;<sub>2</sub>AR to failing rabbit cardiac myocytes <abbrgrp><abbr bid="B5">5</abbr></abbrgrp> and <it>ex vivo</it> to adult rat hearts <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> results in restoration of &#946;<sub>2</sub>AR signaling in cardiac muscle. Likewise, adenoviral-mediated &#946;<sub>2</sub>AR gene delivery to rat carotid arteries leads to enhanced vasorelaxation in response to isoproterenol when compared to control animals <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
         <p>Transgenic over-expression of &#946;<sub>2</sub>AR in airway smooth muscle using a smooth muscle-specific promoter is associated with protection against methacholine-induced bronchoconstriction <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Similarly, targeted over-expression of &#946;<sub>2</sub>AR in mouse airway epithelium using a Clara cell-specific promoter results in reduced airway responsiveness to both methacholine and ozone <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. These data in airway epithelium confirmed the importance of airway relaxation mediated through airway epithelial &#946;<sub>2</sub>AR <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Transgenic over-expression of &#946;<sub>2</sub>AR in type II alveolar cells results in enhanced alveolar fluid clearance <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Furthermore, adenoviral-mediated over-expression of &#946;<sub>2</sub>AR in human lung epithelial cells (A549) is associated with enhanced fluid clearance and responsiveness to endogenous catecholamines <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>The application of &#946;<sub>2</sub>AR gene transfer to a variety of cell types is especially appealing in light of the myriad of important physiological functions of &#946;<sub>2</sub>AR. The strategy of our work is to develop a useful gene delivery model for increased expression of the &#946;<sub>2</sub>AR utilizing an adeno-associated viral (AAV) vector. While other viral vectors have proven useful in &#946;<sub>2</sub>AR gene transfer in animal models, we have chosen to use AAV due to its long term potential as a gene delivery system for use in humans. We have developed a recombinant AAV containing the &#946;<sub>2</sub>AR and enhanced green fluorescent protein (EGFP). The purpose of this study is to evaluate the signaling capabilities of the expressed &#946;<sub>2</sub>AR. Our findings demonstrate that expression of &#946;<sub>2</sub>AR can be significantly increased in infected cells and that the expressed receptors serve to enhance physiologic responsiveness to adrenergic agonists.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Efficiency of gene delivery in HEK 293 cells</p>
            </st>
            <p>A recombinant adeno-associated viral (rAAV) vector was designed to include tandem cassettes encoding the human &#946;<sub>2</sub>AR and enhanced green fluorescent protein (EGFP) genes and was designated AAV-&#946;<sub>2</sub>AR/EGFP (Figure <figr fid="F1">1</figr>). To evaluate for efficiency of viral unit transfer into AAV-&#946;<sub>2</sub>AR/EGFP infected cells, the detection of EGFP was used as a surrogate or screening marker for &#946;<sub>2</sub>AR expression. HEK 293 cells were visualized using epifluorescence microscopy. Approximately 40% of cells infected with AAV-&#946;<sub>2</sub>AR/EGFP (200 transducing units/cell) demonstrated green fluorescence (Figure <figr fid="F2">2</figr>), while mock infected cells lacked EGFP expression (data not shown). These results indicate that HEK 293 cells are readily infected with a recombinant AAV and that the EGFP cassette was expressed.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Recombinant AAV structures</p>
               </caption>
               <text>
                  <p>Recombinant AAV structures. A. In wild-type AAV, the rep region encodes products required for AAV DNA replication. The lip and cap regions encode the virion capsid proteins. The internal terminal repeats (ITR) are required in <it>cis </it>for AAV packaging and integration into host DNA. B. AAV-&#946;<sub>2</sub>AR/EGFP represents the complete recombinant vector with tandem &#946;<sub>2</sub>AR and EGFP cassettes driven by separate CMV promoters.</p>
               </text>
               <graphic file="1471-2210-3-15-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Analysis of EGFP expression in infected HEK 293 cells</p>
               </caption>
               <text>
                  <p>Analysis of EGFP expression in infected HEK 293 cells. Cells were cultured in 10% FBS and were infected with AAV-&#946;<sub>2</sub>AR/EGFP and screened for EGFP expression as a surrogate marker of &#946;<sub>2</sub>AR expression efficiency. Using epifluorescence microscopy to compare phase contrast (A) and green fluorescence (<it>B</it>), EGFP expression was observed in ~40% of cells present, as seen in this representative image. This experiment was performed 5 times with similar results. Scale bar, 10 &#956;M.</p>
               </text>
               <graphic file="1471-2210-3-15-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Pharmacologic specificity of recombinant &#946;<sub>2</sub>-adrenergic receptors</p>
            </st>
            <p>To determine the pharmacologic characteristics of the recombinant &#946;<sub>2</sub>AR, we used HEK 293 cells because of their low endogenous expression of &#946;<sub>2</sub>AR. We first sought to determine the characteristics of the expressed receptor in saturation binding experiments. [<sup>3</sup>H]dihydroalprenolol ([<sup>3</sup>H]DHA) binding to membranes prepared from AAV-&#946;<sub>2</sub>AR/EGFP-infected HEK 293 cells was to a single, saturable site that displayed high affinity as shown in a representative Scatchard plot (Figure <figr fid="F3">3</figr>). Separate experiments with four different membrane preparations established a binding site concentration (B<sub>max</sub>) of 5.05 &#177; 1.0 pmol/mg protein (n = 4) and a dissociation constant (<it>K</it><sub>d</sub>) of 0.42 &#177; 0.1 nM (n = 4). These findings demonstrate [<sup>3</sup>H]DHA binding to a single population of receptors with affinity expected for wild-type &#946;<sub>2</sub>AR <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Saturation binding of [<sup>3</sup>H]DHA to membranes prepared from HEK 293 cells cultured in 10% FBS and infected with AAV-&#946;<sub>2</sub>AR/EGFP</p>
               </caption>
               <text>
                  <p>Saturation binding of [<sup>3</sup>H]DHA to membranes prepared from HEK 293 cells cultured in 10% FBS and infected with AAV-&#946;<sub>2</sub>AR/EGFP. Membranes were incubated at 30&#176;C for 20 minutes with increasing concentrations of [<sup>3</sup>H]DHA. Non-specific binding was defined with 0.1 &#956;M (-)-propranolol. <it>Inset</it>: Direct plot showing total binding (closed circles), nonspecific binding (closed triangles), and specific binding (open circles). These data were representative of four separate experiments.</p>
               </text>
               <graphic file="1471-2210-3-15-3"/>
            </fig>
            <p>The specificity of [<sup>3</sup>H]DHA binding was examined in competition binding assays using various adrenergic agonists (Figure <figr fid="F4">4</figr>). In five separate experiments, the rank order potency of agonist binding to membranes prepared from HEK 293 cells infected with AAV-&#946;<sub>2</sub>AR/EGFP was isoproterenol (<it>K</it><sub>i </sub>= 1.9 &#177; 0.7 &#956;M) > epinephrine (<it>K</it><sub>i </sub>= 5.7 &#177; 2.5 &#956;M) > norepinehrine (K<sub>i </sub>= 22.8 &#177; 7.7 &#956;M) (n = 5). This rank order potency is consistent with a &#946;<sub>2</sub>AR interaction.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Adrenergic agonist competition with [<sup>3</sup>H]DHA binding to membranes prepared from HEK293 cells cultured in 10% FBS that had been infected with AAV-&#946;<sub>2</sub>AR/EGFP</p>
               </caption>
               <text>
                  <p>Adrenergic agonist competition with [<sup>3</sup>H]DHA binding to membranes prepared from HEK293 cells cultured in 10% FBS that had been infected with AAV-&#946;<sub>2</sub>AR/EGFP. Membranes were incubated at 30&#176;C for 20 minutes with [<sup>3</sup>H]DHA and increasing concentrations of either (-)-isoproterenol (circles), (-)-epinephrine (squares), or (-)-norepinephrine (triangles). These data were representative of four separate experiments.</p>
               </text>
               <graphic file="1471-2210-3-15-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Increased &#946;<sub>2</sub>AR expression in AAV-&#946;<sub>2</sub>AR/EGFP infected HEK 293 cells</p>
            </st>
            <p>HEK 293 cells express low levels of &#946;<sub>2</sub>AR <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. To determine the capability of AAV-&#946;<sub>2</sub>AR/EGFP to increase &#946;<sub>2</sub>AR expression in HEK 293 cells, ligand binding assays were employed in AAV-&#946;<sub>2</sub>AR/EGFP infected and mock-infected cells grown in DMEM supplemented with 10% FBS. Mock infected HEK 293 cells demonstrated specific binding of [<sup>3</sup>H]DHA to a single saturable site at a level of 39 &#177; 11 fmol/10<sup>6 </sup>cells. &#946;<sub>2</sub>AR levels were significantly (p &lt; 0.001) increased in AAV-&#946;<sub>2</sub>AR/EGFP infected cells to 501 &#177; 82 fmol/10<sup>6 </sup>cells, representing a 13-fold increase in &#946;<sub>2</sub>AR expression levels when comparing AAV-&#946;<sub>2</sub>AR/EGFP infected cells to mock-infected cells (Figure <figr fid="F5">5</figr>). To further assess the role of serum source on &#946;<sub>2</sub>AR expression in infected HEK 293 cells, we conducted similar studies using 5% CS. In cells cultured in DMEM with 5% CS, background &#946;<sub>2</sub>AR expression was lower than in cells grown in 10% FBS, with mock-infected cells showing &#946;<sub>2</sub>AR levels of 5.5 &#177; 3.4 fmol/10<sup>6 </sup>cells. &#946;<sub>2</sub>AR levels were significantly increased (p &lt; 0.001) in AAV-&#946;<sub>2</sub>AR/EGFP infected cells to 428 &#177; 95 fmol/10<sup>6 </sup>cells, representing a 77-fold increase in &#946;<sub>2</sub>AR levels when comparing AAV-&#946;<sub>2</sub>AR/EGFP infected cells to mock-infected cells grown in 5% CS (Figure <figr fid="F5">5</figr>). This dramatic increase in receptor expression when comparing cells grown in 5% CS to those grown in 10% FBS was due to differences in baseline &#946;<sub>2</sub>AR expression in mock-infected cells. Interestingly, the absolute level of &#946;<sub>2</sub>AR expression after AAV-&#946;<sub>2</sub>AR/EGFP infection was not different between culture conditions. Overall, these results indicate that &#946;<sub>2</sub>AR levels can be significantly increased in HEK293 cells infected with AAV-&#946;<sub>2</sub>AR/EGFP, but that there may be an upper limit for membrane expression of &#946;<sub>2</sub>AR in this cell line.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>&#946;<sub>2</sub>AR expression in infected vs. control HEK 293 cells</p>
               </caption>
               <text>
                  <p>&#946;<sub>2</sub>AR expression in infected vs. control HEK 293 cells. HEK 293 cells were cultured in DMEM with either 5% CS or 10% FBS then either mock infected (control) or infected with AAV-&#946;<sub>2</sub>AR/EGFP. Cells were harvested and incubated at 30&#176;C for 20 minutes with a saturating concentration of [<sup>3</sup>H]DHA to determine &#946;<sub>2</sub>AR levels as described in Methods. Non-specific binding was defined with 0.1 &#956;M (-)-propranolol. Values are the means &#177; S.E. from five different experiments.</p>
               </text>
               <graphic file="1471-2210-3-15-5"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Enhanced cAMP signaling in infected HEK 293 cells</p>
            </st>
            <p>Binding of agonist to the &#946;<sub>2</sub>AR results in adenylyl cyclase activation and conversion of ATP to cyclic AMP <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. To evaluate the ability of the recombinant &#946;<sub>2</sub>AR to activate early receptor signaling pathways, isoproterenol-stimulated cyclic AMP accumulation was measured in HEK 293 cells infected with AAV-&#946;<sub>2</sub>AR/EGFP (Figure <figr fid="F6">6</figr>). Cells were treated with the phosphodiesterase inhibitor, IBMX, at the time of isoproterenol treatment to maximize the cyclic AMP signal. In mock-infected (control) cells, cyclic AMP accumulation was 4.83 &#177; 0.42 nmoles/dish in the absence of isoproterenol and 63.4 &#177; 9.6 nmoles/dish in the presence of isoproterenol, representing a 13-fold increase in cyclic AMP accumulation in isoproterenol-treated, mock infected cells. In AAV-&#946;<sub>2</sub>AR/EGFP infected cells, cyclic AMP accumulation increased from 4.69 &#177; 0.84 nmoles/dish in the absence of isoproterenol stimulation to 314 &#177; 43 nmoles/dish in the presence of isoproterenol, representing a 67 fold increase in cyclic AMP accumulation. The increase in cyclic AMP production in AAV-&#946;<sub>2</sub>AR/EGFP infected cells was significantly different from control, mock infected cells (p &lt; 0.05). These data indicate that in addition to binding agonists with the expected pharmacologic specificity, the recombinant &#946;<sub>2</sub>AR was capable of interacting with downstream intracellular signaling proteins to stimulate cyclic AMP accumulation.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Isoproterenol-stimulated cyclic AMP production in HEK 293 cells cultured in 10% FBS and infected with AAV-&#946;<sub>2</sub>AR/EGFP</p>
               </caption>
               <text>
                  <p>Isoproterenol-stimulated cyclic AMP production in HEK 293 cells cultured in 10% FBS and infected with AAV-&#946;<sub>2</sub>AR/EGFP. HEK 293 cells were either mock infected (control) or infected with AAV-&#946;<sub>2</sub>AR/EGFP. Four days later, the cells were incubated with 250 &#956;M IBMX and either 10 &#956;M (-)-isoproterenol or vehicle for 15 min at 37&#176;C, and cyclic AMP was measured as described in <it>Materials and Methods</it>. Values are the means &#177; S.E. from three separate experiments.</p>
               </text>
               <graphic file="1471-2210-3-15-6"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Intracellular trafficking of recombinant &#946;<sub>2</sub>AR in infected HEK 293 cells</p>
            </st>
            <p>Previous reports indicate that ligand-induced trafficking of the &#946;<sub>2</sub>AR begins in the early endosome <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. Through further intracellular signaling, the internalized &#946;<sub>2</sub>AR is then either recycled to the plasma membrane or is committed to a degradation pathway terminating in the lysosome <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. To determine if the recombinant &#946;<sub>2</sub>AR expressed from AAV-&#946;<sub>2</sub>AR/EFGP retains receptor trafficking in HEK 293 cells, receptor distribution was assessed using a polyclonal antibody to the cytoplasmic tail of the &#946;<sub>2</sub>AR labeled with a Texas Red fluorochrome. Recombinant receptors were localized to the cell surface after treatment with vehicle alone, with minimal evidence for intracellular distribution (Figures <figr fid="F7">7</figr>, Panel A). Following isoproterenol treatment for 20 minutes, recombinant &#946;<sub>2</sub>AR were observed to move from the cell surface to small, punctate intracellular vesicles with minimal surface expression noted (Figure <figr fid="F7">7</figr>, Panel B). Following isoproterenol treatment for 24 hours, recombinant &#946;<sub>2</sub>AR were noted to traffick to both large and small, perinuclear vesicles as would be expected for wild-type receptors following prolonged agonist exposure (Figure <figr fid="F7">7</figr>, Panel C). Additionally, images obtained after 24 hour agonist treatment suggest that some receptors were located on the plasma membrane possibly due to efficient recycling mechanisms as is seen with native &#946;<sub>2</sub>AR <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> or due to the abundance of expressed &#946;<sub>2</sub>AR. These results indicate that agonist induced trafficking of recombinant &#946;<sub>2</sub>AR remains intact with ligand-induced internalization of receptor but with retention of some cell surface expression, even after prolonged agonist exposure. These results further suggest that an added benefit of recombinant &#946;<sub>2</sub>AR expression is persistence of &#946;<sub>2</sub>AR on the cell surface in the continuing presence of agonist.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Analysis of &#946;<sub>2</sub>AR trafficking in AAV-&#946;<sub>2</sub>AR/EGFP infected HEK 293 cells</p>
               </caption>
               <text>
                  <p>Analysis of &#946;<sub>2</sub>AR trafficking in AAV-&#946;<sub>2</sub>AR/EGFP infected HEK 293 cells. Cells were cultured in 10% FBS and treated with either vehicle (<it>A</it>), 10 &#956;M isoproterenol for 20 minutes (<it>B</it>) or 10 &#956;M isoproterenol for 24 hr (<it>C</it>) and analyzed via epifluorescence microscopy using polyclonal antibody to the cytoplasmic tail of &#946;<sub>2</sub>AR. Mock infected HEK 293 cells demonstrated no &#946;<sub>2</sub>AR staining (data not shown). Recombinant &#946;<sub>2</sub>AR showed predominantly surface staining in the presence of vehicle (<it>A</it>). Following 20 minute isoproterenol treatment, recombinant &#946;<sub>2</sub>AR were sequestered internally (<it>B</it>). Following 24 hour isoproterenol treatment, recombinant &#946;<sub>2</sub>AR demonstrated trafficking to large, perinuclear vesicles with some &#946;<sub>2</sub>AR demonstrated on the surface (<it>C</it>). This experiment was performed 3 times with identical results. Scale bar, 10 &#956;M.</p>
               </text>
               <graphic file="1471-2210-3-15-7"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In this study, we have developed and tested a model for the delivery of the genes encoding the &#946;<sub>2</sub>AR and enhanced green fluorescent protein to cultured cells. We have demonstrated that utilization of a recombinant AAV vector provides an effective means of gene delivery without evidence of cell toxicity four days after infection. We have also shown that expressed recombinant &#946;<sub>2</sub>AR have pharmacologic and functional properties characteristic of wild type &#946;<sub>2</sub>AR but with enhanced expression and signaling. These findings provide a new model for the study of &#946;<sub>2</sub>AR expression in tissue that is efficient and serves as a framework for study in physiologically relevant tissue (<it>e.g</it>, airway cells or lung tissue).</p>
         <p>The role of gene transfer in the treatment of disease is evolving and shows promise in many disorders <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Transfer of the &#946;<sub>2</sub>AR gene to cardiac, vascular, and airway epithelial tissue has been accomplished using adenoviral vectors <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B12">12</abbr></abbrgrp>. Similarly, adenoviral-mediated transfer of the &#946;-adrenergic receptor kinase 1 (&#946;ARK1) inhibitor gene, important in controlling &#946;<sub>2</sub>AR activation and signaling, has been performed in cardiac myocytes <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Enhanced expression of &#946;<sub>2</sub>AR or signaling pathway components in cardiac tissue has resulted in improvements in cardiac function <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, while over-expression of &#946;<sub>2</sub>AR in vasculature results in enhanced vasorelaxation <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Similarly, adenoviral-mediated transfer of the &#946;<sub>2</sub>AR gene to airway epithelium improved fluid clearance and response to catecholamines <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. For &#946;<sub>2</sub>AR gene delivery, we have chosen to utilize an adeno-associated viral vector. The AAV system provides several advantages over other viral vectors including: 1) its ability to transduce both dividing and non-dividing cells; 2) its broad tropism; 3) its ability to integrate into the host genome; 4) its status as a nonpathogenic virus; and 5) its lack of induction of a cell-mediated immune response <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. One important limitation to the use of AAV vectors for gene transfer is the size constraint in gene packaging, limited to 4.7 kb, the size of the AAV genome. Because the &#946;<sub>2</sub>AR is a relatively small, intronless gene it is well-suited for AAV vector delivery. Our system is the first to use AAV to enhance &#946;<sub>2</sub>AR expression thus providing a model that has applicability toward our ultimate target, human disease.</p>
         <p>Our investigation has focused at present on both the development of an efficient recombinant AAV system to deliver the &#946;<sub>2</sub>AR gene to cultured cells and functional testing to determine that the &#946;<sub>2</sub>AR expressed following infection of HEK 293 cells with AAV-&#946;<sub>2</sub>AR/EGFP has properties characteristic of wild-type &#946;<sub>2</sub>AR but with the ability to significantly enhance signaling and impart improved responsiveness to hormone. HEK 293 cells were chosen for study because of their ease of culture, low endogenous &#946;<sub>2</sub>AR expression, and prior utility in other studies of &#946;<sub>2</sub>AR function <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Four days after infection, up to 40% of infected cells expressed EGFP, and &#946;<sub>2</sub>AR levels were increased significantly compared to mock infected cells. Cells cultured in 10% FBS demonstrated a 13-fold increase in receptor expression, while those cultured in 5% CS demonstrated a 77-fold increase. This difference was due to higher receptor expression in mock-infected (control) cells when cultured in 10% FBS with the absolute level of receptor expression being equivalent despite growth media conditions. Ligand binding studies demonstrated that recombinant &#946;<sub>2</sub>AR represented a single population of receptors with pharmacological properties that were identical to wild-type &#946;<sub>2</sub>AR. These studies also suggest that an upper limit for membrane expression of recombinant receptors may have been reached in HEK 293 cells.</p>
         <p>It has been long recognized that epinephrine and norepinephrine acting through &#946;<sub>2</sub>AR modulate a variety of important cellular and tissue functions <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Although these effects may be beneficial to the host, prolonged use of agonist agents has been associated with detrimental effects through the well-known phenomenon of tachyphylaxis or tolerance <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. Tachyphylaxis results from a culmination of molecular events including receptor desensitization, sequestration and down-regulation <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Thus, we have asked an important, physiologically relevant question. Can over-expression of &#946;<sub>2</sub>AR using an AAV-mediated delivery system reduce &#946;<sub>2</sub>AR tachyphylaxis? We hypothesized that this could occur through three possible mechanisms: 1) through addition of increased numbers of &#946;<sub>2</sub>AR to the cell, 2) through enhanced recycling, and/or 3) through reduced receptor down-regulation.</p>
         <p>The use of fluorescent microscopy to monitor trafficking of receptors in cells can provide further insight related to the fate of the &#946;<sub>2</sub>AR following agonist activation. In stable transfection models, &#946;<sub>2</sub>AR have been shown to sequester to the intracellular environment within minutes after agonist activation and co-localize with transferrin-containing compartments, characteristic of recycling endosomes <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B17">17</abbr></abbrgrp>. Using a &#946;<sub>2</sub>AR-GFP fusion gene, Kallal and Benovic demonstrated that with prolonged agonist treatment, &#946;<sub>2</sub>AR co-localize with dextran-labeled compartments, characteristic of lysosomes <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Our initial studies confirm that recombinant &#946;<sub>2</sub>ARs localize to the plasma membrane prior to agonist treatment and efficiently sequester to intracellular vesicles following agonist treatment. Our findings also indicate persistence of receptor expression on the cell surface following ligand-induced activation and intracellular trafficking. Persistence of surface expression may provide a physiologic advantage for the cell or tissue by supplying addition receptors for ligand binding.</p>
         <p>Adeno-associated viral vector mediated gene transfer has been successful in human trials <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B21">21</abbr></abbrgrp> and is the subject of ongoing research. Genes delivered by AAV vectors include factor IX and factor VIII for hemophilia, the cystic fibrosis transmembrane reductance regulator (CFTR) for cystic fibrosis, and glial cell line-derived neurotrophic factor (GDNF) and glutamic acid decarboxylase for Parkinson's disease. The ability to efficiently deliver &#946;<sub>2</sub>AR to airway tissue has the potential to enhance bronchodilation, improve fluid and ion transport and reduce airway inflammation. These functions may have particular relevance in diseases of airway hyperresponsiveness such as asthma or chronic obstructive pulmonary disease. Transfer of the &#946;<sub>2</sub>AR gene to cardiac muscle and the vasculature can improve chronotropic function, reduce dilation and enhance vasorelaxation <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B20">20</abbr></abbrgrp>. For relevance in therapeutic delivery for humans, studies related to long-term gene expression, episomal expression or DNA integration, and potential adverse effects must be addressed.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>In summary, this study has demonstrated that &#946;<sub>2</sub>AR expressed in HEK 293 cells infected with AAV-&#946;<sub>2</sub>AR/EGFP demonstrate enhanced expression and signaling. This system provides a useful, well-characterized model for future study of &#946;<sub>2</sub>AR regulation and function. Future studies utilizing AAV-&#946;<sub>2</sub>AR/GFP should include <it>in vitro </it>studies assessing the destiny of endogenous receptors in cells infected with recombinant AAV-&#946;<sub>2</sub>AR/EGFP. These studies should be conducted in physiologically relevant cell types such as airway smooth muscle or epithelium. Using AAV to enhance &#946;<sub>2</sub>AR delivery and signaling should also be studied in animal models of airway hyperresponsiveness to assess the physiologic impact of AAV vector mediated &#946;<sub>2</sub>AR over-expression.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Recombinant AAV preparation</p>
            </st>
            <p>A recombinant adeno-associated viral (rAAV) vector was designed to include tandem cassettes encoding the human &#946;<sub>2</sub>AR and enhanced green fluorescent protein (EGFP) genes and was designated AAV-&#946;<sub>2</sub>AR/EGFP (Figure <figr fid="F1">1</figr>). Cassettes containing the &#946;<sub>2</sub>AR and EFGP genes, both driven by CMV promoters, were cloned into pAV53-LR, a plasmid vector containing the internal terminal repeats (ITRs) from AAV (provided by Dr. Juinyan Dong, Medical University of South Carolina, Charleston, SC). Briefly, the &#946;<sub>2</sub>AR gene was PCR-amplified from human genomic DNA using a forward primer (5'CATATA<ul>AAGCTT-</ul>CAGCCAGTGCGCTTACCTGC3') engineered with a <it>Hind</it>III site (underlined) upstream of the ATG, and a reverse primer (5'CATATA<ul>GGATCC</ul>GTTTAGTGTTCTGTTGGGCGG3') engineered with a <it>BamH</it>I site (underlined) downstream of the stop codon. The PCR fragment was subcloned into pCEP4 vector (<aff id="AFF1">Invitrogen</aff>, Carlsbad, CA) using <it>Hind</it>III and <it>BamH</it>I sites. The pCEP4 vector provided the CMV promoter and SV40 polyA tail adenlyation signal. The &#946;<sub>2</sub>AR moiety was released with <it>Sal</it>I and subcloned into the <it>Xho</it>I site of pAV53-LR. To track infection levels using a surrogate marker gene, the EGFP gene cassette was inserted into the AAV-&#946;<sub>2</sub>AR vector. The EGFP gene was obtained from PCR amplification of pEGFP-C1 plasmid (Clontech) using a forward primer (5'CATATA<ul>GCATGC</ul>CCGTATTACCGCCATG-CATTAG3') and a reverse primer (5'CATATA<ul>GCATGC</ul>GCCGATTTCGGCCTATTGG-TTA3') both engineered with <it>Sph</it>I sites (underlined). The EGFP insert was subcloned into the multiple cloning site of the AAV-&#946;<sub>2</sub>AR vector using the <it>Sph</it>I site. The final recombinant vector, designated AAV-&#946;<sub>2</sub>AR/EGFP, has a total length of 4,691 base pairs encoding the &#946;<sub>2</sub>AR and EGFP genes both driven by separate CMV promoters and containing separate polyadenylation signal sequences. Cassette orientation and sequence were determined using automated DNA sequencing. The AAV-&#946;<sub>2</sub>AR /EGFP vector was sent to the University of North Carolina Virus Vector Core Facility (Chapel Hill, NC) for viral production. Stock preparations used in experiments ranged from 1.0&#8211;3.5 &#215; 10<sup>10 </sup>transducing units/ml.</p>
         </sec>
         <sec>
            <st>
               <p>Cell culture and infection</p>
            </st>
            <p>The human embryonic kidney cell line, HEK 293, was used for all experiments. HEK 293 cells were grown in DMEM supplemented with 10% fetal bovine (FBS). Supplemental studies assessing the role of growth media on receptor expression were conducted using 5% calf serum (CS) in place of FBS. HEK 293 cells at a cell density of 0.25 &#215; 10<sup>6 </sup>cells/well in 6 well plates were transduced by addition of AAV-&#946;<sub>2</sub>AR/EGFP (200 transducing units/cell in 1 ml of media per well). Approximately 16 hrs after initial viral application, 1 ml of growth media was added to each well. Assays to determine &#946;<sub>2</sub>AR expression levels and function were performed on day 4 following infection.</p>
         </sec>
         <sec>
            <st>
               <p>Ligand binding assays to determine receptor specificity</p>
            </st>
            <p>Partially purified membrane preparations were obtained from AAV-&#946;<sub>2</sub>AR/EGFP infected HEK 293 cells, cultured in DMEM with 10% FBS, by differential centrifugation as previously described <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Briefly, cells were washed with ice-cold phosphate-buffered saline (PBS) and scraped into ice-cold PBS with a rubber policeman. The cells were centrifuged at 250 &#215; g for 5 minutes, resuspended in assay buffer (50 mM pH 7.4 Tris-HCl, 2 mM MgCl<sub>2</sub>) and homogenized with a glass-glass homogenizer followed by sonication (5&#8211;10 second bursts at setting 6) with a Tekmar Model AS1 Sonic Disrupter. The nuclei were removed by centifugation at 600 &#215; g for 10 minutes. Membranes were obtained from the resulting supernatant by centrifugation at 30,000 &#215; g for 15 minutes, then resuspended in assay buffer and centrifuged again. The final pellets were resuspended in assay buffer, aliquoted, and stored at -80&#176;C. Protein concentrations of membrane preparations were determined by the method of Bradford <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> using bovine serum albumin as the standard. [<sup>3</sup>H]Dihydroalprenolol (DHA) (Dupont-NEN, Boston, MA; specific activity = 120 Ci/mmole) was used to identify &#946;<sub>2</sub>AR as previously described <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. In saturation experiments, aliquots of HEK 293 cell membranes (final concentration in assay tube = 70 &#956;g/ml) were incubated with 7 different concentrations of [<sup>3</sup>H]DHA ranging from approximately 0.05 to 5 nM. In competition experiments, membrane aliquots were incubated with approximately 1 nM [<sup>3</sup>H]DHA and increasing concentrations of the competitors isoproterenol, epinephrine, and norepinehrine (range 10<sup>-9 </sup>to 10<sup>-4 </sup>moles/liter). Nonspecific binding was defined with 0.1 &#956;M (-)-propranolol. Data from saturation experiments were analyzed using LIGAND <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Inhibition constants were calculated using the method of Cheng and Prusoff <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Ligand binding assays to establish the effects of &#946;-agonists on &#946;<sub>2</sub>AR expression</p>
            </st>
            <p>The effects of &#946;-agonist treatment on &#946;<sub>2</sub>AR expression were determined by growing AAV-&#946;<sub>2</sub>AR/EGFP infected HEK 293 cells in DMEM containing 10% FBS. To determine the impact of a less enriched media on &#946;<sub>2</sub>AR expression, infected HEK 293 cells were also cultured in DMEM with 5% CS. [<sup>3</sup>H]DHA was used in ligand binding assays to determine &#946;<sub>2</sub>AR levels as previously described <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Approximately 1.2 &#215; 10<sup>6 </sup>cells/ml were incubated in triplicate with a single saturating concentration of [<sup>3</sup>H]DHA (~5 nM). Nonspecific binding was defined with 0.1 &#956;M (-)-propranalol.</p>
         </sec>
         <sec>
            <st>
               <p>Cyclic AMP determination</p>
            </st>
            <p>Both AAV-&#946;<sub>2</sub>AR/EGFP infected and mock-infected HEK 293 cells were cultured in DMEM with 10% FBS then in serum-free media overnight. For cyclic AMP determination, cells were then treated either with vehicle or 10 &#956;M isoproterenol and the phosphodiesterase inhibitor, isobutylmethylxanthine (IBMX, 250 &#956;M), for 10 minutes. Cellular cyclic AMP levels were determined by radioimmunoassay using the Biotrak CAMP Assay System (Amersham Life Sciences, Arlington Heights, IL).</p>
         </sec>
         <sec>
            <st>
               <p>Fluorescence microscopy and receptor trafficking</p>
            </st>
            <p>For fluorescence microscopy, HEK 293 cells were cultured in DMEM with 10% FBS at a density of 2.5 &#215; 10<sup>5 </sup>cells/well on glass coverslips, infected with AAV-&#946;<sub>2</sub>AR/EGFP and treated on day 4 with vehicle or 10 &#956;M isoproterenol for 24 hrs at 37&#176;C. Cells were fixed with 1% paraformaldehyde at the designated time intervals. Efficiency of cell infection was evaluated through imaging of green fluorescence as an indicator of EGFP expression. &#946;<sub>2</sub>ARs were detected with a rabbit polyclonal antibody specific to the cytoplasmic tail of the human &#946;<sub>2</sub>AR (1:500 dilution; Bethyl Laboratories, Montgomery, TX) and Texas Red-labeled (red fluorescence) goat anti-rabbit IgG antibody (1:200 dilution; T2767; Molecular Probes, Eugene, OR) as previously described <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Fluorescence imaging was then performed with a Zeiss Axiovert digital deconvolution microscope (Carl Zeiss, Inc., Thornwood, NY). For EGFP expression, cells were visualized using epifluorescence microscopy with a 100&#215; oil objective. For &#946;<sub>2</sub>AR detection, images were collected using a 100&#215; oil objective in Z-stacks then digital deconvolution was performed using AxioVision 3.1 (Carl Zeiss, Inc.). Images were then converted to tagged-image files (tiff) for comparison.</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>Data are presented as the mean &#177; S.E.M. Comparisons between groups were made by using one-way analysis of variance (ANOVA) with Newman-Keuls post hoc testing. The 0.05 level of probability was accepted as significant. Computations were performed using the SigmaStat software package (Jandel Scientific, San Rafael, CA).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' Contributions</p>
         </st>
         <p>SMJ carried out the immunofluorescence assays, participated in study design and project oversight and drafted the manuscript. FCH participated in study design. SEJ conducted vector cloning, sequencing and cyclic AMP assays. SKF conducted western blot and ligand binding assays. LMP participated in immunofluorescence and western blot assays. LEC conceived the study and participated in its design and coordination. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are grateful to Dr. Richard Kurten, Director of the Digitial and Confocal Microscopy Facility, Department of Physiology and Biophysics, University of Arkansas for Medical Sciences, for advice during the use of the facilities in the University of Arkansas for Medical Sciences Digital and Confocal Microscopy Laboratory that is supported by NIH Grants 1 P20 RR 16460 and PAR-98-092, 1-R24 CA82899.</p>
            <p>This work was supported by National Institute of Allergy and Infectious Disease Grant 1K23-AI-01818 (SM Jones), American Heart Association Grant 9960280Z (SM Jones), a grant from the Arkansas Biosciences Institute (LE Cornett) and the Davidson C. Roy Trust to the UAMS Foundation (FC Hiller).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Adrenergic receptor signal transduction and regulation</p>
            </title>
            <aug>
               <au>
                  <snm>Hein</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kobilka</snm>
                  <fnm>BK</fnm>
               </au>
            </aug>
            <source>Neuropharmacology</source>
            <pubdate>1995</pubdate>
            <volume>34</volume>
            <fpage>357</fpage>
            <lpage>366</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0028-3908(95)00018-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">7566466</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Mechanisms of beta-adrenergic receptor regulation in lungs and its implications for physiological responses</p>
            </title>
            <aug>
               <au>
                  <snm>Nijkamp</snm>
                  <fnm>FP</fnm>
               </au>
               <au>
                  <snm>Engels</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Henricks</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Van Oosterhout</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Physiol Rev</source>
            <pubdate>1992</pubdate>
            <volume>72</volume>
            <fpage>323</fpage>
            <lpage>367</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1313586</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Control of myocardial contractile function by the level of b-adrenergic receptor kinase 1 in gene-targeted mice</p>
            </title>
            <aug>
               <au>
                  <snm>Rockman</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Choi</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Akhter</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Jaber</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Giros</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Caron</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1998</pubdate>
            <volume>273</volume>
            <fpage>18180</fpage>
            <lpage>18184</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.273.29.18180</pubid>
                  <pubid idtype="pmpid" link="fulltext">9660778</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Cardiac function in mice overexpressing the b-adrenergic receptor kinase or a bARK inhibitor</p>
            </title>
            <aug>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Rockman</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Samama</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Bond</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Milano</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1995</pubdate>
            <volume>268</volume>
            <fpage>1350</fpage>
            <lpage>1353</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7761854</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Restoration of b-adrenergic signaling in failing cardiac ventricular myocytes via adenoviral-mediated gene transfer</p>
            </title>
            <aug>
               <au>
                  <snm>Akhter</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Skaer</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Kypson</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>McDonald</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Peppel</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Glower</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>12100</fpage>
            <lpage>12105</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">23716</pubid>
                  <pubid idtype="pmpid" link="fulltext">9342369</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.22.12100</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Ex vivo adenovirus-mediated gene transfer to the adult rat heart</p>
            </title>
            <aug>
               <au>
                  <snm>Kypson</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Peppel</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Akhter</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Lilly</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Glower</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>J Thorac Cardiovasc Surg</source>
            <pubdate>1998</pubdate>
            <volume>115</volume>
            <fpage>623</fpage>
            <lpage>630</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9535450</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Enhanced vasorelaxation by overexpression of b2-adrenergic receptors in large arteries</p>
            </title>
            <aug>
               <au>
                  <snm>Gaballa</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Peppel</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Aguirre</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dolber</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Pennock</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Mol Cell Cardiol</source>
            <pubdate>1998</pubdate>
            <volume>30</volume>
            <fpage>1037</fpage>
            <lpage>1045</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmcc.1998.0668</pubid>
                  <pubid idtype="pmpid" link="fulltext">9618244</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Transgenic overexpression of beta(2)-adrenergic receptors in airway smooth muscle alters myocyte function and ablates bronchial hyperreactivity</p>
            </title>
            <aug>
               <au>
                  <snm>McGraw</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Forbes</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Kramer</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Witte</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Fortner</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Paul</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Liggett</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1999</pubdate>
            <volume>274</volume>
            <fpage>32241</fpage>
            <lpage>32247</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.274.45.32241</pubid>
                  <pubid idtype="pmpid" link="fulltext">10542262</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Transgenic overexpression of b2-adrenergic receptors in airway epithelial cells decreases bronchoconstriction</p>
            </title>
            <aug>
               <au>
                  <snm>McGraw</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Forbes</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Mak</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Witte</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Carrigan</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Leikauf</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Liggett</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Am J Physiol Lung Cell Mol Physiol</source>
            <pubdate>2000</pubdate>
            <volume>279</volume>
            <fpage>L379</fpage>
            <lpage>L389</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10926562</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Respiratory epithelium inhibits bronchial smooth muscle tone</p>
            </title>
            <aug>
               <au>
                  <snm>Flavahan</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Aarhus</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Rimele</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Vanhoutte</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>J Appl Physiol</source>
            <pubdate>1985</pubdate>
            <volume>58</volume>
            <fpage>834</fpage>
            <lpage>838</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3980388</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Targeted transgenic expression of beta(2)-adrenergic receptors to type II cells increases alveolar fluid clearance</p>
            </title>
            <aug>
               <au>
                  <snm>McGraw</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Fukuda</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>James</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Forbes</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Woo</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Lingrel</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Witte</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Matthay</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Liggett</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Am J Physiol Lung Cell Mol Physiol</source>
            <pubdate>2001</pubdate>
            <volume>281</volume>
            <fpage>L895</fpage>
            <lpage>L903</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11557593</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>beta(2)-adrenergic receptor overexpression increases alveolar fluid clearance and responsiveness to endogenous catecholamines in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Dumasius</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sznajder</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Azzam</snm>
                  <fnm>ZS</fnm>
               </au>
               <au>
                  <snm>Boja</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mutlu</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Maron</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Factor</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Circ Res</source>
            <pubdate>2001</pubdate>
            <volume>89</volume>
            <fpage>907</fpage>
            <lpage>914</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11701618</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Expression of functional beta 2-adrenergic receptors in a rat airway epithelial cell line (SPOC1) and cell density-dependent induction by glucocorticoids</p>
            </title>
            <aug>
               <au>
                  <snm>Cao</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>McGraw</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>TT</fnm>
               </au>
               <au>
                  <snm>Dicker-Brown</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hiller</snm>
                  <fnm>FC</fnm>
               </au>
               <au>
                  <snm>Cornett</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>Exp Lung Res</source>
            <pubdate>2000</pubdate>
            <volume>26</volume>
            <fpage>421</fpage>
            <lpage>435</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/01902140050130347</pubid>
                  <pubid idtype="pmpid">11033766</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Ligand-regulated internalization and recycling of human b2-adrenergic receptors between the plasma membrane and endosomes containing transferrin receptors</p>
            </title>
            <aug>
               <au>
                  <snm>von Zastrow</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kobilka</snm>
                  <fnm>BK</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1992</pubdate>
            <volume>267</volume>
            <fpage>3530</fpage>
            <lpage>3538</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1371121</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Update on current concepts of the molecular basis of beta2-adrenergic receptor signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Liggett</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2002</pubdate>
            <volume>110</volume>
            <fpage>S223</fpage>
            <lpage>S227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2002.129945</pubid>
                  <pubid idtype="pmpid" link="fulltext">12464928</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Antagonist-dependent and -independent steps in the mechanism of adrenergic receptor internalization</p>
            </title>
            <aug>
               <au>
                  <snm>von Zastrow</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kobilka</snm>
                  <fnm>BK</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1994</pubdate>
            <volume>269</volume>
            <fpage>18448</fpage>
            <lpage>18452</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7518433</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Visualization of agonist-induced sequestration and down-regulation of a green fluorescent protein-tagged b2-adrenergic receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Kallal</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gagnon</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Penn</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Benovic</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1998</pubdate>
            <volume>273</volume>
            <fpage>322</fpage>
            <lpage>328</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.273.1.322</pubid>
                  <pubid idtype="pmpid" link="fulltext">9417083</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>A kinase-regulated PDZ-domain interaction controls endocytic sorting of the b2-adrenergic receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Cao</snm>
                  <fnm>TT</fnm>
               </au>
               <au>
                  <snm>Deacon</snm>
                  <fnm>HW</fnm>
               </au>
               <au>
                  <snm>Reczek</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bretscher</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>von Zastrow</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1999</pubdate>
            <volume>401</volume>
            <fpage>286</fpage>
            <lpage>290</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/45816</pubid>
                  <pubid idtype="pmpid" link="fulltext">10499588</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Gene therapy for acute diseases</p>
            </title>
            <aug>
               <au>
                  <snm>Factor</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Mol Ther</source>
            <pubdate>2001</pubdate>
            <volume>4</volume>
            <fpage>515</fpage>
            <lpage>524</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/mthe.2001.0504</pubid>
                  <pubid idtype="pmpid" link="fulltext">11735335</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Cardiac function in genetically engineered mice with altered adrenergic receptor signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Rockman</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Lefkowitz</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Am J Physiol</source>
            <pubdate>1997</pubdate>
            <volume>272</volume>
            <fpage>H1553</fpage>
            <lpage>H1559</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9139936</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Adeno-associated virus vectors for therapeutic gene transfer</p>
            </title>
            <aug>
               <au>
                  <snm>Stilwell</snm>
                  <fnm>JL and Samulski,RJ</fnm>
               </au>
            </aug>
            <source>Biotechniques</source>
            <pubdate>2003</pubdate>
            <volume>34</volume>
            <fpage>148</fpage>
            <lpage>159</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12545552</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Regular inhaled beta-agonist treatment in bronchial asthma</p>
            </title>
            <aug>
               <au>
                  <snm>Sears</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Print</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Lake</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>QQ</fnm>
               </au>
               <au>
                  <snm>Flannery</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Yates</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Lucas</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Herbison</snm>
                  <fnm>GP</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1990</pubdate>
            <volume>336</volume>
            <fpage>1391</fpage>
            <lpage>1396</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0140-6736(90)93098-A</pubid>
                  <pubid idtype="pmpid">1978871</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Adverse effects of beta-agonists</p>
            </title>
            <aug>
               <au>
                  <snm>Sears</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2002</pubdate>
            <volume>110</volume>
            <fpage>S322</fpage>
            <lpage>S328</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2002.129966</pubid>
                  <pubid idtype="pmpid" link="fulltext">12464943</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Novel beta2-adrenergic receptor signaling pathways</p>
            </title>
            <aug>
               <au>
                  <snm>Benovic</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Allergy Clin Immunol</source>
            <pubdate>2002</pubdate>
            <volume>110</volume>
            <fpage>S229</fpage>
            <lpage>S235</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mai.2002.129370</pubid>
                  <pubid idtype="pmpid" link="fulltext">12464929</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding</p>
            </title>
            <aug>
               <au>
                  <snm>Bradford</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>1976</pubdate>
            <volume>72</volume>
            <fpage>248</fpage>
            <lpage>254</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/abio.1976.9999</pubid>
                  <pubid idtype="pmpid" link="fulltext">942051</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Ligand: a versatile computerized approach for characterization of ligand-binding systems</p>
            </title>
            <aug>
               <au>
                  <snm>Munson</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Rodbard</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Anal Biochem</source>
            <pubdate>1980</pubdate>
            <volume>107</volume>
            <fpage>220</fpage>
            <lpage>239</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0003-2697(80)90515-1</pubid>
                  <pubid idtype="pmpid">6254391</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Cheng</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Prusoff</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Biochem Pharmacol</source>
            <pubdate>1973</pubdate>
            <volume>22</volume>
            <fpage>3099</fpage>
            <lpage>3108</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0006-2952(73)90196-2</pubid>
                  <pubid idtype="pmpid">4202581</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>EGF receptor downregulation depends on a trafficking motif in the distal tyrosine kinase domain</p>
            </title>
            <aug>
               <au>
                  <snm>Jones</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Foreman</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Shank</snm>
                  <fnm>BB</fnm>
               </au>
               <au>
                  <snm>Kurten</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Am J Physiol Cell Physiol</source>
            <pubdate>2002</pubdate>
            <volume>282</volume>
            <fpage>C420</fpage>
            <lpage>C433</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11832327</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
