<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2202-9-110</ui>
   <ji>1471-2202</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Expression of Galpha14 in sweet-transducing taste cells of the posterior tongue</p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>Tizzano</snm>
               <fnm>Marco</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>marco.tizzano@uchsc.edu</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Dvoryanchikov</snm>
               <fnm>Gennady</fnm>
               <insr iid="I3"/>
               <email>GDvoryantchikov1@med.miami.edu</email>
            </au>
            <au id="A3">
               <snm>Barrows</snm>
               <mi>K</mi>
               <fnm>Jennell</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>jennell.barrows@uchsc.edu</email>
            </au>
            <au id="A4">
               <snm>Kim</snm>
               <fnm>Soochong</fnm>
               <insr iid="I4"/>
               <email>skim0026@temple.edu</email>
            </au>
            <au id="A5">
               <snm>Chaudhari</snm>
               <fnm>Nirupa</fnm>
               <insr iid="I3"/>
               <insr iid="I5"/>
               <email>NChaudhari@med.miami.edu</email>
            </au>
            <au id="A6" ca="yes">
               <snm>Finger</snm>
               <mi>E</mi>
               <fnm>Thomas</fnm>
               <insr iid="I1"/>
               <email>tom.finger@uchsc.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Rocky Mountain Taste &amp; Smell Center, Univ. Colorado Denver Sch. Medicine, Aurora CO 80045 USA</p>
            </ins>
            <ins id="I2">
               <p>Dept. Cell &amp; Devel. Biology, Univ. Colorado Denver Sch. Medicine, Aurora CO 80045 USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Physiology and Biophysics, University of Miami Miller School of Medicine, Miami, FL 33136 USA</p>
            </ins>
            <ins id="I4">
               <p>Department of Physiology, Temple University Medical School, 3420 N Broad St, Philadelphia, PA 19140 USA</p>
            </ins>
            <ins id="I5">
               <p>Program in Neurosciences, University of Miami Miller School of Medicine, Miami, FL 33136 USA</p>
            </ins>
         </insg>
         <source>BMC Neuroscience</source>
         <issn>1471-2202</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>110</fpage>
         <url>http://www.biomedcentral.com/1471-2202/9/110</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19014514</pubid>
               <pubid idtype="doi">10.1186/1471-2202-9-110</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>02</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>13</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>13</day>
               <month>11</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Tizzano et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>"Type II"/Receptor cells express G protein-coupled receptors (GPCRs) for sweet, umami (T1Rs and mGluRs) or bitter (T2Rs), as well as the proteins for downstream signalling cascades. Transduction downstream of T1Rs and T2Rs relies on G-protein and PLC&#946;2-mediated release of stored Ca<sup>2+</sup>. Whereas G&#945;gus (gustducin) couples to the T2R (bitter) receptors, which G&#945;-subunit couples to the sweet (T1R2 + T1R3) receptor is presently not known. We utilized RT-PCR, immunocytochemistry and single-cell gene expression profiling to examine the expression of the G&#945;q family (q, 11, 14) in mouse taste buds.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>By RT-PCR, G&#945;14 is expressed strongly and in a taste selective manner in posterior (vallate and foliate), but not anterior (fungiform and palate) taste fields. G&#945;q and G&#945;11, although detectable, are not expressed in a taste-selective fashion. Further, expression of G&#945;14 mRNA is limited to Type II/Receptor cells in taste buds. Immunocytochemistry on vallate papillae using a broad G&#945;q family antiserum reveals specific staining only in Type II taste cells (i.e. those expressing TrpM5 and PLC&#946;2). This staining persists in G&#945;q knockout mice and immunostaining with a G&#945;11-specific antiserum shows no immunoreactivity in taste buds. Taken together, these data show that G&#945;14 is the dominant G&#945;q family member detected. Immunoreactivity for G&#945;14 strongly correlates with expression of T1R3, the taste receptor subunit present in taste cells responsive to either umami or sweet. Single cell gene expression profiling confirms a tight correlation between the expression of G&#945;14 and both T1R2 and T1R3, the receptor combination that forms sweet taste receptors.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>G&#945;14 is co-expressed with the sweet taste receptor in posterior tongue, although not in anterior tongue. Thus, sweet taste transduction may rely on different downstream transduction elements in posterior and anterior taste fields.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Taste buds, the end-organs for gustation, detect and respond to a variety of macronutrient and aversive compounds to generate taste perception. Compounds that evoke bitter taste bind to one or more G protein coupled receptors (GPCRs) of the T2R family of taste receptors <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Amino acids and compounds that elicit umami taste bind to a variety of GPCRs including metabotropic glutamate receptors, mGluR4 and mGluR1, and the heterodimeric taste receptor, T1R1+T1R3 <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Sugars and a variety of other sweeteners bind to the heterodimeric receptor, T1R2+T1R3<abbrgrp><abbr bid="B5">5</abbr><abbr bid="B8">8</abbr></abbrgrp>. Most of these various taste GPCRs appear to all couple to a common transduction pathway that includes the heterotrimeric G protein subunits, G&#946;3 and G&#947;13, a phospholipase C, PLC&#946;2, and a transient receptor potential ion channel, TrpM5 <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>.</p>
         <p>In spite of the detailed exploration of the G&#946;&#947;-triggered signaling, much less is understood of which G&#945; subunits couple to various taste GPCRs, and which downstream signaling pathways they recruit. Taste buds are reported to express a number of different subunits including G&#945;gus (gustducin), G&#945;s, G&#945;i, G&#945;q, G&#945;14, G&#945;15 and two transducin isoforms, G&#945;t1 and G&#945;t2 <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. Apart from G&#945;gus, it remains unknown which of these are expressed in the same cells as taste GPCRs and might be candidate signaling partners. In vitro, the sweet taste receptor, T1R2+T1R3, couples via G&#945;i to cAMP modulation<abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Although G&#945;i subunits are expressed in taste buds<abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, it is unclear which receptors activate them in situ. Biochemical and physiological studies have suggested that bitter taste transduction includes the involvement of G&#945;gus, although the exact mechanism of such involvement remained unclear<abbrgrp><abbr bid="B13">13</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr></abbrgrp>. While G&#945;gus-knockout mice are quite insensitive to bitter tastants, they are also somewhat compromised in their detection of sweet tastants<abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Gustducin is co-expressed with the T1R2+T1R3 sweet receptor in the palate <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> and fungiform papillae<abbrgrp><abbr bid="B25">25</abbr></abbrgrp> but not in the posterior gustatory fields. Furthermore, the direct functional role of G&#945;gus in sweet detection has not been demonstrated. The G&#945;gus, G&#945;i and G&#945;s subunits alter cAMP levels when activated, while members of the G&#945;q family trigger release of stored Ca<sup>2+</sup>. The primary cellular response triggered by tastants appears to be a Ca<sup>2+ </sup>signal. Although much of this signal is produced via the action of G&#946;&#947; subunits<abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, the contribution of the G&#945;q family has not been examined in taste buds.</p>
         <p>Mammalian taste buds are composed of up to 100 cells. Though most mature cells in taste buds have a generally fusiform shape, they can be distinguished into several distinct types based on their functional properties and the expression of diagnostic mRNA and protein markers. Based on ultrastructural and other criteria, cells in rodent taste buds are classified as "Type I", the glial-like or supporting cells, "Type II", the primary receptor cells, and "Type III", the cells that show specialized chemical synapses<abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Type II cells are characterized by the ubiquitous expression of PLC&#946;2 and TrpM5 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Subsets of Type II cells express either T2Rs or T1Rs<abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, an observation that suggested the segregated detection of tastants of the sweet and bitter qualities. Subsequent functional studies have demonstrated the equivalence of cell types identified by expression patterns and cells with particular response profiles. For instance, cells that express NCAM and SNAP25 were shown to be those that display voltage-gated calcium channels<abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. Cells that express TrpM5 or PLC&#946;2 are those that respond to bitter or sweet stimuli<abbrgrp><abbr bid="B29">29</abbr><abbr bid="B31">31</abbr></abbrgrp>. Here, we have used RT-PCR, immunocytochemistry and single-cell gene expression profiling to examine the expression of the G&#945;q family (&#945;q, &#945;11, &#945;14)<abbrgrp><abbr bid="B32">32</abbr></abbrgrp> in mouse taste buds and establish which of these are co-expressed with T1R2 and T1R3, subunits that constitute the sweet taste GPCR. The pattern of expression suggests that G&#945;gus is unlikely to be a signaling partner for T1R2+T1R3. Instead, the sweet receptor subunits consistently are co-expressed with G&#945;14.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>G&#945;q family members are differentially expressed in different taste fields</p>
            </st>
            <p>First, we used end-point RT-PCR to evaluate the expression of G&#945;q family subunits in taste buds to assess which members, if any, of the G&#945;q family (G&#945;q, G&#945;11 and G&#945;14) are expressed in taste buds. We analyzed taste buds obtained from four different oral taste fields (vallate, foliate, fungiform and palate) as well as non-taste lingual and palatal epithelium.</p>
            <p>As shown in Fig. <figr fid="F1">1A</figr>, G&#945;14 is strongly expressed in vallate and foliate taste buds, with somewhat lower expression in the palate. Under parallel conditions, expression of G&#945;14 was negligible in the fungiform field. G&#945;q also was not detected in fungiform papillae, and its mRNA was seen in taste buds from vallate, foliate and palate. Finally, we observed that G&#945;11 appeared to be expressed similarly in taste buds of all taste fields. Of these three G&#945; subunits, G&#945;q and G&#945;11 were detected in non-taste mRNA at roughly similar levels as in taste buds. In contrast, G&#945;14 was expressed in a highly taste-selective manner. We also tested expression of the distantly related subunit, G&#945;15. We detected RT-PCR product for G&#945;15 prominently in the nontaste epithelium samples and very little in vallate taste bud samples (data not shown). Thus, we did not investigate this subunit further. The taste selective expression pattern and apparently high mRNA level of G&#945;14 suggested that it may be the principal G&#945;q family member playing a taste-specific role in murine taste buds.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Of G&#945;q family members only G&#945;14 shows a taste bud-selective pattern</p>
               </caption>
               <text>
                  <p><b>Of G&#945;q family members only G&#945;14 shows a taste bud-selective pattern</b>. <b>A</b>. RT-PCR on isolated taste buds shows that G&#945;14, G&#945;q and G&#945;11 are all expressed in vallate (val), foliate (fo) and palate (pal). Fungiform (fu) taste buds express G&#945;11 but G&#945;14 and G&#945;q are not readily detected. Of these G&#945; subunits, only G&#945;14 is expressed in a taste-selective fashion (i.e. is absent from non-taste lingual epithelium [nt]). Brain (br) cDNA and water in place of cDNA (-) served as positive and negative controls run in parallel for all PCRs. Predicted sizes of products (in basepairs) are to the right. All templates were also analyzed for PLC&#946;2, a gene expressed in all taste buds and for &#946;-actin, expressed in all cells. <b>B</b>. Quantitative RT-PCR shows that only G&#945;14 is prominently expressed in a taste-selective manner. mRNA from three samples of CV taste buds (T = gray bars) and of nontaste lingual epithelium (nt = white bars) were analyzed for expression of G&#945;q, G&#945;11 and G&#945;14. The same samples were also analyzed in parallel for &#946;-actin as a normalization control and PLC&#946;2 as a taste-selective marker.</p>
               </text>
               <graphic file="1471-2202-9-110-1"/>
            </fig>
            <p>To test this, we undertook quantitative RT-PCR experiments to compare expression levels of the G&#945;q family members in taste buds (Fig. <figr fid="F1">1B</figr>). The concentration of G&#945;14 mRNA in vallate taste buds was comparable to that of PLC&#946;2 mRNA. Neither mRNA was expressed in nontaste epithelium. In contrast, G&#945;q mRNA was found at similar concentration in CV taste buds and in nontaste epithelium while G&#945;11 was at much higher concentration in nontaste epithelium than in taste epithelium. Thus, neither G&#945;11 or G&#945;q are expressed in a taste-selective manner. Further, the mRNAs for G&#945;q and G&#945;11 are expressed at 14- and 80-fold lower concentrations respectively than G&#945;14 mRNA. These data support our interpretation from end-point RT-PCR, that the only G&#945; subunit of this family that is likely to have a taste-selective role is G&#945;14.</p>
            <p>Taste buds contain two cell types that have been functionally defined to date, Type II/Receptor cells and Type III/Presynaptic cells. To assess whether G&#945;q, G&#945;11 or G&#945;14 are selectively expressed in these two cell types, we used PLC&#946;2-GFP and GAD-GFP transgenic mice that respectively illuminate Type II and III taste cells <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. Individual GFP-labeled cells from each strain were harvested to produce 3 pools, each of 10 cells, representing Type II and Type III cells respectively. We examined expression of the G&#945; subunits by RT-PCR on amplified RNA from these 6 pools (Fig. <figr fid="F2">2</figr>). G&#945;14 expression was limited to Type II cells and was detected in each of the three pools. In contrast, G&#945;q expression was less prominent, and was found in Type II, Type III and non-taste epithelial cells, consistent with the qRT-PCR data of Fig. <figr fid="F1">1B</figr>. G&#945;11 was only sporadically detected in the pools of identified taste cells, consistent with the low level seen in qRT-PCR with whole vallate taste buds. The absence of G&#945;11 in the isolated non-taste cells may reflect the heterogeneity of the non-taste epithelium, with some regions expressing G&#945;11 and others not. In summary, RT-PCR analyses suggested that G&#945;14, expressed only in taste buds, and only in Type II/Receptor cells within taste buds, was a reasonable candidate for coupling to a taste GPCR.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>G&#945;14 is expressed only in Type II/Receptor cells</p>
               </caption>
               <text>
                  <p><b>G&#945;14 is expressed only in Type II/Receptor cells</b>. Three pools (#1, 2, 3), each containing ten individual GFP(+) taste cells were collected from PLC&#946;2-GFP mice (plc pools) or from GAD-GFP mice (gad pools). Amplified mRNAs from these pools represent Type II and Type III cells respectively and were analyzed by RT-PCR. RNA from a cluster of non-taste epithelial cells (NT) and a taste bud (TB) were amplified and analyzed in parallel. A negative control (-) reaction was run with no cDNA. RT-PCR for PLC&#946;2 (Type II cells), T1R3 (Type II cells) and SNAP25 (Type III cells) <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> confirmed that the pools were not cross-contaminated with cells of the opposing type.</p>
               </text>
               <graphic file="1471-2202-9-110-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Immunoreactivity to G&#945;q-family in G&#945;gus-negative Type II cells</p>
            </st>
            <p>Next, we used an antiserum that recognizes G&#945;q, G&#945;11 and G&#945;14 to perform fluorescent immunocytochemistry on cryosections of taste epithelia. The Gq/11/14 antibody reacted with a subset of taste cells in posterior (vallate and foliate) but not anterior (fungiform and palate) oral taste fields (Fig. <figr fid="F3">3</figr>). Immunoreactive cells in each case were elongate and spindle-shaped, as is typical for mature taste cells. Immunoreactivity appeared to be membrane-associated, largely encircling the taste cell profiles of immunoreactive cells. Relative to the signal in the vallate papilla, immunoreactivity to Gq/11/14 antibody occurred only rarely in cells of taste buds in the soft palate, and was essentially absent in taste buds of the fungiform papillae and pharynx (Fig. <figr fid="F3">3</figr>).</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>G&#945;q-family immunoreactivity in different taste fields</p>
               </caption>
               <text>
                  <p><b>G&#945;q-family immunoreactivity in different taste fields</b>. Inverted grayscale images of single confocal image plane of immunofluorescence showing G&#945;q/11/14-immunoreactivity in different taste fields. Acquisition and display parameters are matched to permit comparison of fluorescence intensity between image sets (A-C), (D-E) and (F-G). The heavy staining is largely membrane-associated and outlines the entire cell. Vallate (A &amp; F) and foliate field (D) taste buds each contain several G&#945;q/11/14-immunoreactive taste cells. Rare immunoreactive taste cells occur in palatal taste buds (B) but essentially no Gq/11/14immunoreactivity is detected in fungiform field taste buds (C &amp; E). Similarly, pharyngeal taste buds exhibit little or no specific immunofluorescence. Scale bar equals 10 &#956;m for panels A-C and 25 &#956;m in D-G.</p>
               </text>
               <graphic file="1471-2202-9-110-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>G&#945;q-family-immunoreactivity is not due to G&#945;q nor G&#945;11</p>
            </st>
            <p>To assess whether the G&#945;q-family immunoreactivity was attributable to G&#945;q, we examined immunoreactivity with the same Gq/11/14 antibody in G&#945;q-KO mice. In vallate taste buds, staining with anti-Gq/11/14 was essentially no different in G&#945;q-KO mice compared to WT controls (Fig. <figr fid="F4">4A, A'</figr>). Staining with anti-G&#945;gus antibody also shows no difference in the G&#945;q-KO compared to WT animals (Fig. <figr fid="F4">4B, B'</figr>) indicating that the G&#945;q-KO did not disrupt expression of other taste-related G-proteins. The robust staining by the Gq/11/14 antibody in G&#945;q-KO mice indicates that the bulk of the staining observed with Gq/11/14 antibody must be attributable to G&#945;11 or G&#945;14. Because the RT-PCR data (see Figs. <figr fid="F1">1</figr> &amp;<figr fid="F2">2</figr>) showed that G&#945;11 is expressed at very low levels, the combined analyses suggest that G&#945;14 is the principal G&#945;q family subunit in Type II (Receptor) cells.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>G&#945;14 subunit expression in vallate papilla</p>
               </caption>
               <text>
                  <p><b>G&#945;14 subunit expression in vallate papilla</b>. Using G&#945;q-null mice and G&#945;11-specific anitserum, we show that the immunoreactivity in taste buds revealed by Gq/11/14 antiserum must be due to G&#945;14. <b>(A) </b>Gq/11/14 immunoreactivity in vallate papilla of (A) WT and (A') G&#945;q null mice. The continued immunoreactivity for Gq/11/14 in G&#945;q-null mice demonstrates that members of the G&#945;q-family other than G&#945;q are responsible for most of the Gq/11/14 antibody immunoreactivity. <b>(B) </b>G&#945;gus immunoreactivity in (B) WT and (B') G&#945;q null mice. Continued immunoreactivity for G&#945;gus shows that other G&#945; expression is not altered in the G&#945;q null animals. Scale bars = 40 &#956;M for A-D. <b>C-F</b>: Micrographs of immunostaining of TrpM5-GFP mice with an antiserum specific for G&#945;11 (C, C', E) or the broad Gq class antiserum (Gq/11/14) which reacts with G&#945;q, G&#945;11 and G&#945;14 (D, D', F). <b>C</b>, <b>C'</b>: Section through taste buds of the vallate papilla stained with G&#945;11-specific antiserum (red). <b>C</b>. shows the combined image of TrpM5-GFP (green) and G&#945;11 (red); <b>C' </b>shows only the red channel of this same image. No specific G&#945;11 staining is evident. This exposure is matched to that of panel E. <b>E</b>. G&#945;11 staining of the cerebellum showing evident immunoreactivity of the molecular layer corresponding to the demonstrated presence of G&#945;11 in Purkinje cell dendrites<abbrgrp><abbr bid="B35">35</abbr><abbr bid="B56">56</abbr></abbrgrp>. <b>D</b>, <b>D'</b>: Sections through taste buds of the vallate papilla stained with Gq/11/14 antiserum (red). <b>D </b>shows the combined image of TrpM5-GFP (green) and Gq/11/14 (red); <b>D' </b>shows only the red channel of this same image. Many taste cells in each taste bud show clear membrane-associated immunoreactivity similar to that shown in Fig. 3. <b>F</b>. Gq/11/14 staining of the cerebellum showing evident immunoreactivity of the molecular layer corresponding to the demonstrated presence of G&#945;11 in Purkinje cell dendrites <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B56">56</abbr></abbrgrp>. Since Purkinje cells express both G&#945;q and G&#945;11, and higher levels of G&#945;q than G&#945;11, immunoreactivity with the broad Gq/11/14 antiserum is much greater than that obtained with the specific G&#945;11 antiserum. Exposure for this panel is 20% of that for panels <b>D</b>, <b>D'</b>. Scale bar in <b>F </b>(50 &#956;m) also applies to panels C, D &amp; E.</p>
               </text>
               <graphic file="1471-2202-9-110-4"/>
            </fig>
            <p>To further test whether G&#945;11 is present in taste buds, we utilized an antiserum directed against the N-terminal region of G&#945;11 which shares no sequence similarity to the N-terminal region of either G&#945;q or G&#945;14. This G&#945;11-specific antiserum does not stain taste buds (Fig. <figr fid="F4">4C&#8211;C'</figr>) although it does stain the cerebellar molecular layer (Fig. <figr fid="F4">4E</figr>) in which G&#945;11 is detectable by immunocytochemistry<abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. These results essentially rule out G&#945;11 as the source of the taste bud immunoreactivity for the Gq/11/14 antibody. Since this Gq/11/14 antibody exhibits staining in G&#945;q knockout mice, we conclude that the staining is attributable to neither G&#945;q nor G&#945;11 leaving only G&#945;14 as the possible source of the immunoreactivity. These results are entirely consistent with our RT-PCR data (above) showing that G&#945;14 mRNA is the predominant G&#945;q family member isoform expressed in a taste-specific manner.</p>
         </sec>
         <sec>
            <st>
               <p>G&#945;q-family-immunoreactivity is in Type II Taste (Receptor) Cells</p>
            </st>
            <p>Taste buds (TBs) comprise at least three different types of mature cells, so we utilized type-specific markers to test whether G&#945;q-family expression correlates with a specific cell type. Type II (receptor) cells express the GPCR taste receptors (T1Rs and T2Rs in different cells), TrpM5 and PLC&#946;2 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Thus, we performed the first set of immunocytochemistry using tissues from TrpM5-GFP mice in which all GFP labeled taste cells express the TrpM5 protein<abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. In vallate taste buds, PLC&#946;2 antibody stained over 92% (25 of 27 cells) of TrpM5-GFP-labeled cells, confirming the identification of Type II cells with these markers. Further, in vallate taste buds, immunoreactivity to PGP9.5 antibody, which stains mostly Type III cells <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>) was detectable only in a small percentage of TrpM5-GFP positive cells (~4%; 1 of 27 cells).</p>
            <p>Next, we compared immunostaining for Gq/11/14 with staining for markers of Type II and Type III taste cells. In vallate and foliate taste buds of TrpM5-GFP mice, the Gq/11/14 antibody stained a subset of TrpM5-GFP cells (Fig. <figr fid="F5">5A</figr>). Nearly all Gq/11/14 positive cells expressed TrpM5-GFP (13/14), i.e. G&#945;q-family protein (presumed G&#945;14) is expressed only in Type II taste cells. We also immunostained the sections for G&#945;gus and viewed them for fluorescence in three colors: GFP (green) for TrpM5, Alexa647 (pseudo-colored blue) for G&#945;gus and Rhodamine RedX (red) for Gq/11/14. Most taste cells that were immunoreactive for Gq/11/14 lacked expression of G&#945;gus (only 4 of 27 cells co-express these G protein alpha subunits; see Table <tblr tid="T1">1</tblr>). In contrast, antiserum to PGP9.5 (Type III cell marker) stained none of the Gq/11/14-positive cells (Fig. <figr fid="F5">5B</figr>). We conclude that G&#945;q-family immunoreactivity is not in Type III cells, but is common in the TrpM5-immunoreactive (Type II) receptor cell population.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Gq/11/14 immunoreactivity in Type II cells</p>
               </caption>
               <text>
                  <p><b>Gq/11/14 immunoreactivity in Type II cells</b>. (A) Co-localization of Gq/11/14 (red), G&#945;gus (blue) in the vallate papilla of a TrpM5-GFP (green) animal. TrpM5 is a marker of Type II taste cells. Gq/11/14 stains about half (14 of 27) of the TrpM5-GFP cells. Usually the G&#945;q-family immunoreactive cells are different from those positive for G&#945;gus (blue). A', A", represent single staining of TrpM5-GFP TBs used to obtain the merged pictures A. The figure in Additional file <supplr sid="S1">1</supplr> shows single plane confocal images from this image set for comparison. (B) PGP9.5 (blue), a marker of Type III cells, does not co-localize with either Gq/11/14 (red) or TrpM5 (green). The figure in Additional file <supplr sid="S2">2</supplr> shows single plane confocal images from this image set for comparison. Scale bar 20 &#956;M.</p>
               </text>
               <graphic file="1471-2202-9-110-5"/>
            </fig>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Gq/11/14 and Gagus staining in vallate taste buds in a TrpM5-GFP mouse.</b> Single confocal image planes from the image shown in Fig. <figr fid="F3">3A</figr>; TrpM5-GFP (<b>B</b>, green), Gagus (<b>D</b>, blue) and Gq/11/14 (<b>F</b>, red), respectively. Co-localization in single plane images of TrpM5-GFP and Gagus (<b>A</b>), TrpM5-GFP and Gq/11/14 (<b>C</b>), Gagus and Gq/11/14 (<b>E</b>) in the vallate papilla. Panel <b>G </b>shows the the z-stack of the combined G&#945;gus and Gq/11/14 images equivalent to text Fig. <figr fid="F3">3A</figr>. TrpM5 is a marker of Type II taste cells. Gq/11/14 stains about half (14 of 27) of the TrpM5-GFP cells. Usually the Gq/11/14 immunoreactive cells are different from those positive for Gagus. Scale bar 20 &#956;M.</p>
               </text>
               <file name="1471-2202-9-110-S1.jpeg">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Gaq/11/14 and PGP9.5 staining in TrpM5-GFP mouse.</b> Single confocal image planes from the image shown in Fig. <figr fid="F3">3B</figr>; TrpM5-GFP (B, green), Gq/11/14 (D, red) and PGP9.5 (F, blue), respectively. Co-localization in single plane images of TrpM5-GFP and Gq/11/14 (A), TrpM5-GFP and PGP9.5 (C), PGP9.5 and Gq/11/14 (E) in the vallate papilla. In G the z-stack of the entire E panel single plane images. PGP9.5, a marker of Type III cells, does not co-localize with either Gq/11/14 or TrpM5. Scale bar 20 &#956;M.</p>
               </text>
               <file name="1471-2202-9-110-S2.jpeg">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>T1R &amp; G-protein co-localization in Taste Buds</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p><b>Immunocytochem</b>.</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>
                           <b>Single Cell RT-PCR</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TrpM5 with</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>%</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>TrpM5 with</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>Gq/11/14</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>14/27</p>
                     </c>
                     <c ca="center">
                        <p>51.9</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;14</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>13/21</p>
                     </c>
                     <c ca="center">
                        <p>61.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>17/27</p>
                     </c>
                     <c ca="center">
                        <p>63.0</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>15/21</p>
                     </c>
                     <c ca="center">
                        <p>71.4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>Gq/11/14 + G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4/27</p>
                     </c>
                     <c ca="center">
                        <p>14.8</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;14 + G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7/21</p>
                     </c>
                     <c ca="center">
                        <p>33.3</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gq/11/14 with</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>G&#945;14 with</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>T1R3(GFP)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30/35</p>
                     </c>
                     <c ca="center">
                        <p>85.7</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>T1R3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>13/14</p>
                     </c>
                     <c ca="center">
                        <p>92.9</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>
                           <b>T1R2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>10/14</p>
                     </c>
                     <c ca="center">
                        <p>71.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>
                           <b>T1R3 + T1R2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>10/14</p>
                     </c>
                     <c ca="center">
                        <p>71.4</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>T1R3(GFP)</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>T1R3+T1R2 with</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(includes T1R1 &amp; TT1R2)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;q</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5/10</p>
                     </c>
                     <c ca="center">
                        <p>50.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>Gq/11/14</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30/41</p>
                     </c>
                     <c ca="center">
                        <p>73.1</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;14</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>10/10</p>
                     </c>
                     <c ca="center">
                        <p>100.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>11/41</p>
                     </c>
                     <c ca="center">
                        <p>26.8</p>
                     </c>
                     <c ca="right">
                        <p>
                           <b>G&#945;gus</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4/10</p>
                     </c>
                     <c ca="center">
                        <p>40.0</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Results from immunocytochemistry are not significantly different (p > 0.05) from data from single cell RT-PCR (Fisher's Exact Test). The immunocytochemical data and RT-PCR data showing co-expression of gustducin with T1Rs is not directly comparable since some cells express only T1R3 and not T1R2+T1R3</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>G&#945;q-family immunoreactivity in T1R3-expressing cells</p>
            </st>
            <p>Type II cells in taste buds express G protein coupled taste receptors for sweet, bitter or umami qualities. The taste receptors for sweet (T1R2 and T1R3) and for bitter (T2Rs) are expressed in separate subsets of Type II cells<abbrgrp><abbr bid="B1">1</abbr><abbr bid="B8">8</abbr></abbrgrp>. In taste membranes, bitter (T2R) taste receptors couple functionally to G&#945;gus <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B21">21</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp>. Yet to date, it is unclear which G&#945; subunits natively couple to the other class of taste receptors, the T1Rs. Because T1R3 appears to be an obligatory subunit in these dimeric receptors, we used T1R3-GFP transgenic mice, to ask whether the G&#945;q family subunits are co-expressed with T1R3. By double-immunostaining (Fig. <figr fid="F6">6</figr>), in vallate papillae we found that the Gq/11/14 antibody stained the majority of T1R3-GFP cells (85.7%; 30 of 35 T1R3-GFP cells; see Table <tblr tid="T1">1</tblr>). In contrast, a smaller fraction of T1R3-GFP cells were strongly positive for G&#945;gus (~26.8%; 11 of 41 T1R3-GFP cells; see Table <tblr tid="T1">1</tblr>) (Fig. <figr fid="F6">6</figr>). Thus G&#945;gus expression does not correlate with T1R3 expression and therefore cannot be an obligatory partner in taste buds in vallate papillae.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>G&#945;q-family immunoreactivity co-localizes with T1R3-GFP</p>
               </caption>
               <text>
                  <p><b>G&#945;q-family immunoreactivity co-localizes with T1R3-GFP</b>. In vallate papilla TBs, the Gq/11/14 antibody (red) stains most of T1R3-GFP (green) cells (30 of 41). Fewer cells are strongly positive for G&#945;gus (blue). The large majority of Gq/11/14-IR cells (30 of 35) exhibit T1R3-GFP. Only about half of G&#945;Gus IR cells show T1R3-GFP expression). The figure in Additional file <supplr sid="S3">3</supplr> shows single plane confocal images from this image set for comparison. Scale bar 20 &#956;M.</p>
               </text>
               <graphic file="1471-2202-9-110-6"/>
            </fig>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p><b>Gq/11/14 and Gagus staining in T1R3-GFP mouse</b>. Single confocal image planes from the image shown in Fig. <figr fid="F5">5</figr>; T1R3-GFP (B, green), Gq/11/14 (D, red) and Gagus (F, blue), respectively. Co-localization in single plane images of TrpM5-GFP and Gq/11/14 (A), TrpM5-GFP and Gagus (C), Gagus and Gq/11/14 (E) in the vallate papilla. The Gq/11/14 antibody stains most of T1R3-GFP cells (30 of 41). Fewer cells are strongly positive for Gagus (blue). The large majority of Gq/11/14-IR cells (30 of 35) exhibit T1R3-GFP. Only about half of Gagus IR cells show T1R3-GFP expression. Scale bar 20 &#956;M.</p>
               </text>
               <file name="1471-2202-9-110-S3.jpeg">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Single-cell RT-PCR shows co-expression of G&#945;14 with T1R2/T1R3</p>
            </st>
            <p>We used transgenic PLC&#946;2-GFP mice to isolate individual GFP-labeled (Type II/Receptor) cells and performed single cell-RT-PCR as an independent test of the expression pattern of G&#945;q-family subunits and sweet receptors (T1R2, T1R3). Because G&#945;11 expression was limited to a low concentration of mRNA (Fig. <figr fid="F1">1B</figr>) and only in a few cells (Fig. <figr fid="F2">2</figr>), we did not include it in this analysis. For this detailed analysis, we collected 21 individual PLC&#946;2-GFP-expressing (i.e. Type II/Receptor) cells and 2 PLC&#946;2-GFP-negative cells. As expected, TrpM5 was expressed in all 21 PLC&#946;2-GFP cells, and was not detected in GFP-negative cells (Fig. <figr fid="F7">7</figr>). The taste receptors, T1R2 and T1R3 were detected in approximately half of GFP-positive cells (10 of 21 cells). All 10 of these T1R2+T1R3-expressing cells also expressed G&#945;14 (Table <tblr tid="T1">1</tblr>). In contrast, G&#945;q was detected in 50%, and G&#945;gus in only 40% of these T1R2+T1R3-expressing cells. In summary, G&#945;14 is always found in presumptive sweet-sensing Type II/Receptor cells. Additionally, G&#945;14 was not detected in the absence of T1R3. Thus, we propose that G&#945;14 may be the principal G&#945; subunit coupled to the sweet receptors.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Single-cell expression profiling on Type II cells</p>
               </caption>
               <text>
                  <p><b>Single-cell expression profiling on Type II cells</b>. <b>A</b>: mRNA was purified from 21 individual PLC&#946;2-GFP cells and two GFP negative cells (# 12 and # 23) and reverse transcribed. Each cDNA was divided into 7 individual tubes and was used to assay the expression of three G&#945; subunits (G&#945;gus, G&#945;q, G&#945;14), sweet receptor subunits (T1R2, T1R3) and TrpM5. &#946;-actin served as a positive control for all samples. All PLC&#946;2-GFP positive cells displayed PCR product for TrpM5. In contrast, the G&#945; subunits and sweet receptors were expressed in only a fraction of PLC&#946;2-GFP cells. <b>B</b>. Venn diagram showing co-localization patterns based on the single cell RT-PCR analysis and previous studies on T2R localization patterns <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. T2Rs do not co-localize with T1Rs and in the vallate papilla, always co-localize with G&#945; Gustducin. In our single cell RT-PCR study, all T1R2+T1R3 (sweet receptor) expressing taste cells express G&#945;14. A subset of these also express G&#945;q. The sweet receptive cells are themselves a subset of the Type II (receptor) taste cells identified by expression of PLC&#946;2 and TrpM5. Another set of TrpM5/PLC&#946;2-expressing cells express the T2R family of bitter receptors. These T2R-expressing cells invariably express G&#945;Gustducin <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>.</p>
               </text>
               <graphic file="1471-2202-9-110-7"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Using the complementary techniques of immunocytochemistry and gene expression profiling via single-cell RT-PCR, we have explored the pattern of expression of the G&#945;q family of heterotrimeric G protein subunits. We show that while G&#945;q and G&#945;11 are expressed at low levels in taste buds, G&#945;14 is expressed in a highly taste bud-selective manner. This observation is consistent with many previous reports of the ubiquitous distribution of G&#945;q and G&#945;11, while G&#945;14 is restricted to a few highly specialized cell types<abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Further, we show that G&#945;14 is limited to Type II taste cells, i.e. those that express taste GPCRs.</p>
         <p>Mammalian taste buds use specialized taste GPCRs (including the T1R and T2R families) to detect bitter, umami and sweet tastants. Both families of taste receptors activate the downstream signalling elements, PLC&#946;2 and IP3R3<abbrgrp><abbr bid="B9">9</abbr><abbr bid="B12">12</abbr><abbr bid="B20">20</abbr><abbr bid="B27">27</abbr><abbr bid="B39">39</abbr></abbrgrp>. The T2R receptors couple to G&#945;gus<abbrgrp><abbr bid="B22">22</abbr><abbr bid="B40">40</abbr></abbrgrp> but the G&#945; subunits activated in situ by the T1R receptors are not yet defined. Whereas G&#945;gus is substantially co-expressed with T1R receptors in the anterior taste fields, such is not the case for posterior taste fields<abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp> where only a fraction of T1R3-expressing taste cells co-express G&#945;gus. Hence, G&#945;gus is unlikely to be the G&#945; subunit associated with the T1R receptors in the posterior tongue. We report here the obligatory co-expression of G&#945;14 with the sweet receptor T1R2+T1R3 in foliate and vallate taste fields. Accordingly, we suggest that sweet transduction in posterior, but not anterior gustatory fields involves G&#945;14. Whether G&#945;14 couples directly to the sweet taste receptor or to other GPCRs intimately associated with sweet detection remains to be determined.</p>
         <p>The different taste receptors are not homogeneous across the taste fields of the tongue but show regional differences<abbrgrp><abbr bid="B25">25</abbr><abbr bid="B41">41</abbr></abbrgrp>. The T1R1+T1R3 umami receptor is much more prevalent in the anterior taste fields (fungiform and palate) than in the posterior lingual fields (foliate and vallate). In posterior lingual taste fields, T1R3 more commonly partners with T1R2 forming a sweet receptor. Our single cell RT-PCR data show that over 70% (10/14) of the T1R3-expressing cells also express T1R2. With in situ hybridization, two groups reported previously that 92%<abbrgrp><abbr bid="B25">25</abbr></abbrgrp> and 98%<abbrgrp><abbr bid="B42">42</abbr></abbrgrp> of the T1R3 expressing cells of the vallate papilla co-express T1R2. The lower percentage of co-localization we report may reflect differences in technique, given the higher sensitivity of single cell RT-PCR over in situ hybridization. Most of the T1R3-positive, non T1R2-expressing cells in our profiling displayed low levels of T1R3 (e.g. cells 8, 10, 11 of Fig. <figr fid="F6">6</figr>) and may not have been detected with in situ hybridization.</p>
         <p>The T1R2+T1R3 heterodimer can functionally couple to a variety of G&#945;i/o subunits in heterologous systems<abbrgrp><abbr bid="B19">19</abbr><abbr bid="B43">43</abbr></abbrgrp>. Since sweeteners activate adenylyl cyclase in vallate taste buds<abbrgrp><abbr bid="B44">44</abbr></abbrgrp>, Margolskee<abbrgrp><abbr bid="B45">45</abbr></abbrgrp> has postulated that the T1R2+T1R3 receptor may couple to G&#945;s. Indeed, Kusakabe et al<abbrgrp><abbr bid="B18">18</abbr></abbrgrp> showed the expression of G&#945;s, G&#945;i2 and G&#945;i3 in vallate taste buds, but not the tight association with sweet receptors. In contrast, our data show clearly that G&#945;14, a member of the G&#945;q family is consistently co-expressed with T1R2+T1R3 in posterior taste buds. Because sweet taste receptors are co-expressed with PLC&#946;2<abbrgrp><abbr bid="B46">46</abbr></abbrgrp>, and mice in which PLC&#946;2 is knocked out show a severe deficit of sweet signaling<abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, it is widely accepted that sweet transduction occurs via G&#946;&#947;-mediated activation of PLC&#946;2. Yet PLC&#946;2 also can be activated robustly by members of the G&#945;q family<abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. Our study is the first demonstration of a consistent association of G&#945;14 (a G&#945;q family member) with taste receptors that activate PLC&#946;2.</p>
         <p>The expression of G&#945;gus in association with the sweet receptor in the palate and fungiform papilla is likely to account for the profound decrease of intake of sucrose and sweeteners in long-term taste behaviours in G&#945;gus knockout mice<abbrgrp><abbr bid="B36">36</abbr><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>. On the basis of these previous results along with our current findings, G&#945;gus knockout would be predicted to affect only the palatal and fungiform taste fields where G&#945;gus is co-expressed with the sweet receptors. Transection of the gustatory nerves innervating only anterior taste fields results in near-total elimination of sweet taste preference in some behavioural assays despite the presence of an intact posterior lingual taste system<abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Thus the loss of sweet-driven taste behaviours reported in G&#945;gus knockouts is likely attributable to loss of function in the sweet-detecting taste buds of the anterior taste fields. Indeed more rigorous behavioural analysis of gustducin null mice reveals substantial residual sweet-guided taste behavior<abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. Electrophysiological analysis of taste nerves of G&#945;gus-null mice reveals a profound loss of sweet-evoked activity in anterior tongue but only partial loss in posterior. This is consistent with our finding that relatively few sweet receptive taste cells also express G&#945;gus. The degree of functional loss as measured by the magnitude of the glossopharyngeal nerve response in G&#945;gus null mice, is, however, greater than would be predicted on the basis of the co-expression patterns<abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. Perhaps G&#945;gus-expressing sweet-receptive cells disproportionately activate gustatory nerve fibers, or act synergistically with other cells within a taste bud to effect activation of the nerve fibers. Indeed, Roper<abbrgrp><abbr bid="B52">52</abbr></abbrgrp> suggests the likelihood of intrabud intercellular communication playing an essential role in transmission of taste information.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The sweet-receptive taste cells of the posterior tongue express G&#945;14 while those in anterior taste buds express G&#945;gus. These findings show that even within a single sensory system, the same receptor may couple with different G-protein alpha subunits in different functional parts of the system. Our results also account for the residual behavioural and neural activity to sweet tastants in G&#945;gus-null animals.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Animals</p>
            </st>
            <p>All experiments were performed under protocols approved by the Animal Care and Use Committees of the CU Denver School of Medicine and the University of Miami School of Medicine. We used three strains of adult transgenic mice in which GFP is expressed from the promoters of T1R3, TRPM5, PLC&#946;2, or GAD1<abbrgrp><abbr bid="B31">31</abbr><abbr bid="B34">34</abbr><abbr bid="B53">53</abbr></abbrgrp>. In taste buds from each of these strains, previous studies have shown that all cells expressing the relevant endogenous proteins also express GFP <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. G&#945;q-deficient mice and littermate controls were obtained from Satya Kunapuli (Temple University, Philadelphia, PA) <abbrgrp><abbr bid="B54">54</abbr></abbrgrp> with permission from Stefan Offermanns (University of Heidelberg, Heidelberg, Germany). This G&#945;q-null line was generated by replacement of sequence coding for amino acids 246&#8211;297 of G&#945;q by the neo gene and is described in detail in Cho et al<abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. The genotype of Gq-null mice was determined by PCR and was confirmed by platelet aggregation assay.</p>
         </sec>
         <sec>
            <st>
               <p>Immunofluorescence</p>
            </st>
            <p>We used a Gq-family antibody that is labelled and sold as anti-G&#945;q/11 (Santa Cruz Biotechnology; sc# 392) although the manufacturer indicates that it likely will react with G&#945;14. The antigenic peptide, VFAAVKDTILQLNLKEYNLV, is located near the C-terminus, is 100% identical between G&#945;q and G&#945;11 and is 90% identical/100% similar in G&#945;14 (all sequences from mouse). In contrast, G&#945;15 is only 45% identical/75% similar in this region. Thus, the antibody likely reacts with G&#945;q, G&#945;11 and G&#945;14, but not G&#945;15. To test the specificity of this broad G&#945;q family antibody, we also used an affinity-purified G&#945;11 specific antiserum (Santa Cruz Biotechnology; sc# 394) directed against an N-terminal peptide (aa 13&#8211;29 from mouse sequence) that lacks any sequence similarity to either G&#945;q or G&#945;14. The cerebellum was used as a positive control tissue for these antisera since Purkinje cells express both G&#945;q and G&#945;11 but not G&#945;14 <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B56">56</abbr></abbrgrp>.</p>
            <p>Mice were perfusion-fixed in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB). Taste tissues (vallate, foliate and fungiform papillae and soft palate) were post-fixed (4&#176;C, 60 min); 14 &#956;m cryosections were washed with phosphate-buffered saline (PBS), blocked with 1% normal goat serum, and incubated with rabbit anti-G&#945;q-family antibody (1:500); at 4&#176;C overnight. The secondary antiserum used was Rhodamine RedTM-X-conjugated AffiniPure&#8482; Fab Fragment goat anti-Rabbit IgG (H+L) (1:100; Jackson ImmunoResearch Lab.; 111-297-003).</p>
            <p>To examine co-expression of the G&#945;q family with other proteins in taste buds, and to avoid cross reactivity of multiple rabbit primary antibodies with a common secondary antibody, we used the Zenon Rabbit IgG Labeling Kit (Invitrogen, Z25308). For this, each primary antibody other than G&#945;q/11/14 was pre-conjugated to Alexa Fluor 647 so that it did not require a secondary antibody for visualization. After the binding of the first primary and secondary antibodies was complete, the primary antibody-Zenon647 complex was applied to the slides for 80 min at RT in the dark, washed in PB with 0.2% Triton X-100 and postfixed in PFA/PB. Slides were then coverslipped with Fluormount-G. Omission of primary antibodies (detected with Rhodamine Red-X or Zenon) resulted in no apparent fluorescent signal. The primary antibodies used as Zenon complexes were rabbit anti-PLC&#946;2 (1:200; Santa Cruz Biotechnology; sc# 206); rabbit anti-G&#945;gus (1:200: Santa Cruz Biotechnology; sc# 395) and rabbit anti-PGP9.5 (Ubiquitin C-terminal hydrolase-L1; 1:200; AbD Serotec; 7863-0504).</p>
            <p>All images were collected with an Olympus Fluoview confocal laser scanning microscope (LSCM) FV300 (Olympus Corporation). For each image, the channels were collected sequentially with single wavelength excitation and then merged to produce the composite image using the software Fluoview v5.0. This avoids the problem of bleed-through of images resulting from side-band excitation of the fluorochromes. Brightness and contrast were adjusted in Adobe Photoshop 7.0. Images for Fig. <figr fid="F3">3</figr> are displayed as negatives to permit visualization of faint fluorescent signal. This was accomplished by using the "Invert" command in Photoshop on the Red channel of the confocal image.</p>
            <p>For quantification of immunocytochemical data, we counted immunoreactive cells from 3 sections through the vallate papilla from 2 different animals. An immunoreactive profile was included if it had an elongate morphology extending at least half the height of the taste bud and included an obvious nucleus. Cell fragments not including a nuclear profile were not included in the sample.</p>
         </sec>
         <sec>
            <st>
               <p>RT-PCR analysis</p>
            </st>
            <p>Adult PLC&#946;2-GFP and GAD-GFP mice were killed by CO<sub>2 </sub>asphyxiation followed by decapitation, the tongue and palate were removed and a protease mixture consisting of 1 mg/ml collagenase, type A, 2.5 mg/ml dispase (both from Roche Products, Indianapolis, IN) and 1 mg/ml trypsin inhibitor (Sigma, St. Louis, MO) in Tyrode buffer was injected. Tyrode buffer consisted of, in mM: 139 NaCl, 5 KCl, 2 CaCl<sub>2</sub>, 1 MgCl<sub>2</sub>, 10 Hepes, 10 glucose, 10 Na pyruvate, and 5 NaHCO<sub>3</sub>; pH 7.2, 318&#8211;323 mOsm. Epithelium was peeled from underlying tissue after 20 min and incubated in Ca/Mg-free Tyrode's solution for 14 min. For Ca-Mg-free Tyrode buffer, CaCl<sub>2 </sub>and MgCl<sub>2 </sub>were replaced with 2 mM each EGTA and BAPTA.</p>
            <p>To avoid contamination of samples with non-taste cells, taste buds from vallate, foliate, fungiform papillae and palate were collected in two stages. First, they were extracted under a stereomicroscope from the epithelium using glass pipettes (inner diameter at tip, 80 &#956;m) and transferred into Tyrode buffer. Next, individual taste buds were identified by GFP fluorescence under under 200&#215; magnification and transferred to lysis buffer (Absolutely Nanoprep kit, Stratagene). Total RNA was purified with DNAse I digestion and first strand cDNA synthesized with Superscript III (Invitrogen, Carlsbad, CA). PCR was performed in 20 &#956;l using cDNA of one taste bud as template per reaction. Positive and negative controls were run in parallel from master mixes. We designed PCR primers using published cDNA sequences for each gene. Because G&#945;q, &#945;11 and &#945;14 are highly homologous, we placed primers in the most divergent regions. Primers are listed in Table <tblr tid="T2">2</tblr>. PCR was performed for 35 cycles. Most primer pairs spanned at least one intron to avoid amplifying genomic DNA. PCR products for all genes were validated by DNA sequencing.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers for RT-PCR</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c cspan="2" ca="center">
                        <p>
                           <b>Protein &amp; Gene</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Accession #</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Forward Primer (5'&#8594;3')</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reverse Primer (5'&#8594;3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Product bp</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Anneal &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G&#945;14</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gna14</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_008137">NM_008137</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>attagctacttcccagagtacaca</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gctcagatcaccctctgtct</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>256</p>
                     </c>
                     <c ca="center">
                        <p>62&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>* tcatgcaacagagggacttg</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>* agggccatgctcaattacac</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>294</p>
                     </c>
                     <c ca="center">
                        <p>60&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G&#945;q</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gnaq</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_008139">NM_008139</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gtcgactacttcccagaatatgat</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>agtccaggacggcaataaat</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>333</p>
                     </c>
                     <c ca="center">
                        <p>62&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>* aacacacaccatccgtcaga</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>* ggcaagcagtggtctctagc</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>229</p>
                     </c>
                     <c ca="center">
                        <p>60&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G&#945;11</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gna11</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_010301">NM_010301</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>agcccaagtcctgagtttga</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>tgccaagtcagagtggagaa</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>236</p>
                     </c>
                     <c ca="center">
                        <p>60&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G&#945;gus</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gnat3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_001081143">NM_001081143</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gcaaccacctccattgttct</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>agaagagcccacagtctttgag</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>286</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PLC&#946;2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Plcb2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_177568">NM_177568</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gagcaaatcgccaagatgat</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ccttgtctgtggtgaccttg</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>163</p>
                     </c>
                     <c ca="center">
                        <p>60&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SNAP25</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Snap25</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_011428">NM_011428</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ggcaataatcaggatggagtag</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>agatttaaccacttcccagca</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>310</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T1R2</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Tas1r2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_031873">NM_031873</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>aagcatcgcctcctactcc</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ggctggcaactcttagaacac</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>114</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T1R3</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Tas1r3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_031872">NM_031872</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gaagcatccagatgacttca</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gggaacagaaggacactgag</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>283</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TrpM5</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Trpm5</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_020277">NM_020277</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gtctggaatcacaggccaac</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gttgatgtgccccaaaaact</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>234</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#946;-actin</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Actb</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NM_007393">NM_007393</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ccctgtgctgctcacc</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gcacgatttccctctcag</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>328</p>
                     </c>
                     <c ca="center">
                        <p>58&#176;C</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Primers marked * (G&#945;14 and G&#945;q) are located closer to the mRNA 3' end and were only used on amplified RNA from pools of GFP-expressing cells (Fig. 2).</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Single-cell RT-PCR</p>
            </st>
            <p>Vallate taste buds were collected from PLC&#946;2-GFP mice (as above), then cells were dissociated by gentle trituration. GFP-labeled single cells were collected each into 60 &#956;l of lysis buffer containing 200 ng of poly-Inosinic acid as a carrier, processed for RNA purification and cDNA synthesis. For preliminary analyses of cell type specific expression (Fig. <figr fid="F2">2</figr>), we collected individual GFP-labeled vallate taste cells, pooled them in lysis buffer and isolated RNA and linear amplified it as previously described <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. The aRNA (amplified RNA) was subjected to reverse transcription and 0.1% of the cDNA was used as template for RT-PCR (40 cycles). For analyses of single cells, mRNA from each cell was reverse transcribed and then each 20 &#956;l single cell cDNA was divided as follows: 5% each for &#946;-actin and TrpM5, 10% each for G&#945;gus and G&#945;14, 20% each for T1R2 and T1R3 and 30% for G&#945;q. PCR was performed in 20 &#956;l for 40 cycles.</p>
         </sec>
         <sec>
            <st>
               <p>Quantitative RT-PCR</p>
            </st>
            <p>Quantitative RT-PCR was carried out as previously described<abbrgrp><abbr bid="B57">57</abbr></abbrgrp> using the same primers as for end point PCR, and SYBR Green PCR mix (Bio-Rad) in a Bio-Rad iQ iCycler. Three independent samples of CV taste buds and of adjacent non-taste epithelium were purified and analyzed in parallel. The concentration of each mRNA was compared to a standard curve generated from a sequence-validated template and calculated using MyiQ software (Bio-Rad). All mRNA concentrations were normalized to &#946;-actin mRNA which was run in parallel.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>MT carried out immunocytochemistry, performed histological analysis and documentation and characterized the G&#945;14 antiserum. GD performed the molecular studies including RT-PCR, quantitative RT-PCR and single cell RT-PCR-based profiling. MT and GD carried out the bulk of the experimental work for this project and contributed equally to the project. SK maintained and genotyped the G&#945;q-null mice, prepared tissue from G&#945;q-KO and paired WT animals for histological analysis. JB assisted with the immunocytochemical preparations and TEF assisted with documentation and analysis. NC and TEF supervised the molecular and histological studies respectively, and were instrumental in the conceptual design and analysis of the data. All authors contributed to writing and editing the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors thank Robert Margolskee (Mt. Siani Medical Ctr.) and Sami Damak (Nestle Research Ctr.) for making the TrpM5-GFP and T1R3-GFP animals available for study. Similarly, the authors thank Satya Kunapuli (Temple Univ.) and Stefan Offermanns (Univ. Heidelberg) for facilitating and permitting use of the G&#945;q-KO mice.</p>
            <p>This work was supported by NIH grants to T.E.F. (P30DC004657; DC007495), N.C. (DC006021; DC006308).</p>
            <p>Aspects of this work were presented at the International Symposium on Olfaction &amp; Taste, San Francisco, CA, July 2008 and published in abstract form in <it>Chem Senses </it><b>2008</b>, <b>38</b>(4) S144. Since the initial submission and acceptance of this manuscript a related paper was published: Shindo Y, Miura H, Carninci P, Kawai J, Hayashizaki Y, Ninomiya Y, Hino A, Kanda T, Kusakabe Y, <b>G alpha14 is a candidate mediator of sweet/umami signal transduction in the posterior region of the mouse tongue</b>: <it>Biochem Biophys Res Commun</it>. <b>2008</b>, Nov 21; <b>376</b>(3): 504&#8211;8. Epub 2008 Sep 16.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>A novel family of mammalian taste receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Adler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Mueller</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Chandrashekar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2000</pubdate>
            <volume>100</volume>
            <issue>6</issue>
            <fpage>693</fpage>
            <lpage>702</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80705-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">10761934</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>T2Rs function as bitter taste receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Chandrashekar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mueller</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Adler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Guo</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2000</pubdate>
            <volume>100</volume>
            <issue>6</issue>
            <fpage>703</fpage>
            <lpage>711</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80706-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">10761935</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>A family of candidate taste receptors in human and mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Matsunami</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Montmayeur</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Buck</snm>
                  <fnm>LB</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>404</volume>
            <issue>6778</issue>
            <fpage>601</fpage>
            <lpage>604</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35007072</pubid>
                  <pubid idtype="pmpid" link="fulltext">10766242</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>A metabotropic glutamate receptor variant functions as a taste receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Chaudhari</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Landin</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>2000</pubdate>
            <volume>3</volume>
            <issue>2</issue>
            <fpage>113</fpage>
            <lpage>119</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/72053</pubid>
                  <pubid idtype="pmpid" link="fulltext">10649565</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Human receptors for sweet and umami taste</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Staszewski</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Durick</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Zoller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Adler</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <issue>7</issue>
            <fpage>4692</fpage>
            <lpage>4696</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.072090199</pubid>
                  <pubid idtype="pmpid" link="fulltext">11917125</pubid>
                  <pubid idtype="pmcid">123709</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>An amino-acid taste receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Nelson</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chandrashekar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2002</pubdate>
            <volume>416</volume>
            <issue>6877</issue>
            <fpage>199</fpage>
            <lpage>202</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature726</pubid>
                  <pubid idtype="pmpid" link="fulltext">11894099</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Cloning and characterization of a novel mGluR1 variant from vallate papillae that functions as a receptor for L-glutamate Stimuli</p>
            </title>
            <aug>
               <au>
                  <snm>San Gabriel</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Uneyama</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yoshie</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Torii</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2005</pubdate>
            <volume>30</volume>
            <issue>Suppl 1</issue>
            <fpage>i25</fpage>
            <lpage>26</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bjh095</pubid>
                  <pubid idtype="pmpid" link="fulltext">15738140</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Mammalian sweet taste receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Nelson</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Chandrashekar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2001</pubdate>
            <volume>106</volume>
            <issue>3</issue>
            <fpage>381</fpage>
            <lpage>390</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(01)00451-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">11509186</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Ggamma13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium</p>
            </title>
            <aug>
               <au>
                  <snm>Huang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Shanker</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Dubauskaite</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>JZ</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Rosenzweig</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Spielman</snm>
                  <fnm>AI</fnm>
               </au>
               <au>
                  <snm>Max</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>1999</pubdate>
            <volume>2</volume>
            <issue>12</issue>
            <fpage>1055</fpage>
            <lpage>1062</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/15981</pubid>
                  <pubid idtype="pmpid" link="fulltext">10570481</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>G protein betagamma complexes in circumvallate taste cells involved in bitter transduction</p>
            </title>
            <aug>
               <au>
                  <snm>Rossler</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Boekhoff</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Tareilus</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Breer</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Freitag</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2000</pubdate>
            <volume>25</volume>
            <issue>4</issue>
            <fpage>413</fpage>
            <lpage>421</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/25.4.413</pubid>
                  <pubid idtype="pmpid" link="fulltext">10944505</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>A transient receptor potential channel expressed in taste receptor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Perez</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Rong</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kozak</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Preuss</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Max</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>2002</pubdate>
            <volume>5</volume>
            <issue>11</issue>
            <fpage>1169</fpage>
            <lpage>1176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nn952</pubid>
                  <pubid idtype="pmpid" link="fulltext">12368808</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Chandrashekar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mueller</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Cook</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2003</pubdate>
            <volume>112</volume>
            <issue>3</issue>
            <fpage>293</fpage>
            <lpage>301</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(03)00071-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12581520</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Bitter taste transduced by PLC-beta(2)-dependent rise in IP(3) and alpha-gustducin-dependent fall in cyclic nucleotides</p>
            </title>
            <aug>
               <au>
                  <snm>Yan</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Sunavala</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Rosenzweig</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dasso</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Brand</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Spielman</snm>
                  <fnm>AI</fnm>
               </au>
            </aug>
            <source>Am J Physiol Cell Physiol</source>
            <pubdate>2001</pubdate>
            <volume>280</volume>
            <issue>4</issue>
            <fpage>C742</fpage>
            <lpage>751</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11245589</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Caicedo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jafri</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2000</pubdate>
            <volume>20</volume>
            <issue>21</issue>
            <fpage>7978</fpage>
            <lpage>7985</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11050118</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Gustducin is a taste-cell-specific G protein closely related to the transducins</p>
            </title>
            <aug>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>McKinnon</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1992</pubdate>
            <volume>357</volume>
            <issue>6379</issue>
            <fpage>563</fpage>
            <lpage>569</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/357563a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">1608467</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Molecular cloning of G proteins and phosphodiesterases from rat taste cells</p>
            </title>
            <aug>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>McKinnon</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Spickofsky</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Danho</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Physiol Behav</source>
            <pubdate>1994</pubdate>
            <volume>56</volume>
            <issue>6</issue>
            <fpage>1157</fpage>
            <lpage>1164</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0031-9384(94)90360-3</pubid>
                  <pubid idtype="pmpid">7878085</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Identification of two alpha-subunit species of GTP-binding proteins, Galpha15 and Galphaq, expressed in rat taste buds</p>
            </title>
            <aug>
               <au>
                  <snm>Kusakabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Tanemura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kameyama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Chiba</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Arai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Emori</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Abe</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1998</pubdate>
            <volume>1403</volume>
            <issue>3</issue>
            <fpage>265</fpage>
            <lpage>272</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0167-4889(98)00062-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">9685675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Comprehensive study on G protein alpha-subunits in taste bud cells, with special reference to the occurrence of Galphai2 as a major Galpha species</p>
            </title>
            <aug>
               <au>
                  <snm>Kusakabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yasuoka</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Asano-Miyoshi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwabuchi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Arai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Emori</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Abe</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2000</pubdate>
            <volume>25</volume>
            <issue>5</issue>
            <fpage>525</fpage>
            <lpage>531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/25.5.525</pubid>
                  <pubid idtype="pmpid" link="fulltext">11015324</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Receptors for bitter, sweet and umami taste couple to inhibitory G protein signaling pathways</p>
            </title>
            <aug>
               <au>
                  <snm>Ozeck</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Brust</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Servant</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Eur J Pharmacol</source>
            <pubdate>2004</pubdate>
            <volume>489</volume>
            <issue>3</issue>
            <fpage>139</fpage>
            <lpage>149</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ejphar.2004.03.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">15087236</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Co-expression of calcium signaling components in vertebrate taste bud cells</p>
            </title>
            <aug>
               <au>
                  <snm>Asano-Miyoshi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Abe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Emori</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Neurosci Lett</source>
            <pubdate>2000</pubdate>
            <volume>283</volume>
            <issue>1</issue>
            <fpage>61</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0304-3940(00)00911-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10729634</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Blocking taste receptor activation of gustducin inhibits gustatory responses to bitter compounds</p>
            </title>
            <aug>
               <au>
                  <snm>Ming</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ninomiya</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <issue>17</issue>
            <fpage>9903</fpage>
            <lpage>9908</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.96.17.9903</pubid>
                  <pubid idtype="pmpid" link="fulltext">10449792</pubid>
                  <pubid idtype="pmcid">22308</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Role of the G-protein subunit alpha-gustducin in taste cell responses to bitter stimuli</p>
            </title>
            <aug>
               <au>
                  <snm>Caicedo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2003</pubdate>
            <volume>23</volume>
            <issue>30</issue>
            <fpage>9947</fpage>
            <lpage>9952</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">14586025</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Transduction of bitter and sweet taste by gustducin</p>
            </title>
            <aug>
               <au>
                  <snm>Wong</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Gannon</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1996</pubdate>
            <volume>381</volume>
            <issue>6585</issue>
            <fpage>796</fpage>
            <lpage>800</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/381796a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">8657284</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Expression of T1Rs and gustducin in palatal taste buds of mice</p>
            </title>
            <aug>
               <au>
                  <snm>Stone</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Barrows</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Finger</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2007</pubdate>
            <volume>32</volume>
            <issue>3</issue>
            <fpage>255</fpage>
            <lpage>262</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bjl053</pubid>
                  <pubid idtype="pmpid" link="fulltext">17229761</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Regional expression patterns of taste receptors and gustducin in the mouse tongue</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Kusakabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Miura</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Shindo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ninomiya</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hino</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2003</pubdate>
            <volume>312</volume>
            <issue>2</issue>
            <fpage>500</fpage>
            <lpage>506</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2003.10.137</pubid>
                  <pubid idtype="pmpid" link="fulltext">14637165</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>"Type III" cells of rat taste buds: immunohistochemical and ultrastructural studies of neuron-specific enolase, protein gene product 9.5, and serotonin</p>
            </title>
            <aug>
               <au>
                  <snm>Yee</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Bottger</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Finger</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Comp Neurol</source>
            <pubdate>2001</pubdate>
            <volume>440</volume>
            <issue>1</issue>
            <fpage>97</fpage>
            <lpage>108</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/cne.1372</pubid>
                  <pubid idtype="pmpid" link="fulltext">11745610</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>IP(3) receptor type 3 and PLCbeta2 are co-expressed with taste receptors T1R and T2R in rat taste bud cells</p>
            </title>
            <aug>
               <au>
                  <snm>Miyoshi</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Abe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Emori</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2001</pubdate>
            <volume>26</volume>
            <issue>3</issue>
            <fpage>259</fpage>
            <lpage>265</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/26.3.259</pubid>
                  <pubid idtype="pmpid" link="fulltext">11287386</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Morphologic characterization of rat taste receptor cells that express components of the phospholipase C signaling pathway</p>
            </title>
            <aug>
               <au>
                  <snm>Clapp</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Stoick</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Comp Neurol</source>
            <pubdate>2004</pubdate>
            <volume>468</volume>
            <issue>3</issue>
            <fpage>311</fpage>
            <lpage>321</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/cne.10963</pubid>
                  <pubid idtype="pmpid" link="fulltext">14681927</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Separate populations of receptor cells and presynaptic cells in mouse taste buds</p>
            </title>
            <aug>
               <au>
                  <snm>DeFazio</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Dvoryanchikov</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Maruyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Chaudhari</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <issue>15</issue>
            <fpage>3971</fpage>
            <lpage>3980</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.0515-06.2006</pubid>
                  <pubid idtype="pmpid" link="fulltext">16611813</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Electrophysiological characterization of voltage-gated currents in defined taste cell types of mice</p>
            </title>
            <aug>
               <au>
                  <snm>Medler</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2003</pubdate>
            <volume>23</volume>
            <issue>7</issue>
            <fpage>2608</fpage>
            <lpage>2617</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12684446</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Mouse taste cells with G protein-coupled taste receptors lack voltage-gated calcium channels and SNAP-25</p>
            </title>
            <aug>
               <au>
                  <snm>Clapp</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Medler</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Damak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>BMC Biol</source>
            <pubdate>2006</pubdate>
            <volume>4</volume>
            <fpage>7</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1741-7007-4-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">16573824</pubid>
                  <pubid idtype="pmcid">1444931</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>G protein diversity: a distinct class of alpha subunits is present in vertebrates and invertebrates</p>
            </title>
            <aug>
               <au>
                  <snm>Strathmann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>MI</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1990</pubdate>
            <volume>87</volume>
            <issue>23</issue>
            <fpage>9113</fpage>
            <lpage>9117</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.87.23.9113</pubid>
                  <pubid idtype="pmpid" link="fulltext">2123549</pubid>
                  <pubid idtype="pmcid">55114</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Breadth of tuning and taste coding in mammalian taste buds</p>
            </title>
            <aug>
               <au>
                  <snm>Tomchik</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Berg</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Chaudhari</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2007</pubdate>
            <volume>27</volume>
            <issue>40</issue>
            <fpage>10840</fpage>
            <lpage>10848</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.1863-07.2007</pubid>
                  <pubid idtype="pmpid" link="fulltext">17913917</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Faithful expression of GFP from the PLCbeta2 promoter in a functional class of taste receptor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Roberts</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Maruyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Berg</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Roper</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chaudhari</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2006</pubdate>
            <volume>31</volume>
            <issue>3</issue>
            <fpage>213</fpage>
            <lpage>219</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bjj021</pubid>
                  <pubid idtype="pmpid" link="fulltext">16394244</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Distinct roles of Galpha(q) and Galpha11 for Purkinje cell signaling and motor behavior</p>
            </title>
            <aug>
               <au>
                  <snm>Hartmann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Blum</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kovalchuk</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Adelsberger</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kuner</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Durand</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Miyata</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Offermanns</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Konnerth</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2004</pubdate>
            <volume>24</volume>
            <issue>22</issue>
            <fpage>5119</fpage>
            <lpage>5130</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.4193-03.2004</pubid>
                  <pubid idtype="pmpid" link="fulltext">15175381</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Coupling of bitter receptor to phosphodiesterase through transducin in taste receptor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Ruiz-Avila</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Wildman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>McKinnon</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Robichon</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Spickofsky</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1995</pubdate>
            <volume>376</volume>
            <issue>6535</issue>
            <fpage>80</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/376080a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">7596440</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Characterization and solubilization of bitter-responsive receptors that couple to gustducin</p>
            </title>
            <aug>
               <au>
                  <snm>Ming</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ruiz-Avila</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <issue>15</issue>
            <fpage>8933</fpage>
            <lpage>8938</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.95.15.8933</pubid>
                  <pubid idtype="pmpid" link="fulltext">9671782</pubid>
                  <pubid idtype="pmcid">21180</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Characterization of G-protein alpha subunits in the Gq class: expression in murine tissues and in stromal and hematopoietic cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Wilkie</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Scherle</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Strathmann</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Slepak</snm>
                  <fnm>VZ</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>MI</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1991</pubdate>
            <volume>88</volume>
            <issue>22</issue>
            <fpage>10049</fpage>
            <lpage>10053</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.88.22.10049</pubid>
                  <pubid idtype="pmpid" link="fulltext">1946421</pubid>
                  <pubid idtype="pmcid">52865</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Immunocytochemical evidence for co-expression of Type III IP3 receptor with signaling components of bitter taste transduction</p>
            </title>
            <aug>
               <au>
                  <snm>Clapp</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Stone</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Kinnamon</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>BMC Neurosci</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <issue>1</issue>
            <fpage>6</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2202-2-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">11346454</pubid>
                  <pubid idtype="pmcid">31433</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Functional interaction between T2R taste receptors and G-protein alpha subunits expressed in taste receptor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Ueda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ugawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamamura</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Imaizumi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shimada</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2003</pubdate>
            <volume>23</volume>
            <issue>19</issue>
            <fpage>7376</fpage>
            <lpage>7380</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12917372</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Putative mammalian taste receptors: a class of taste-specific GPCRs with distinct topographic selectivity</p>
            </title>
            <aug>
               <au>
                  <snm>Hoon</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Adler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Lindemeier</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Battey</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Ryba</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>CS</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <issue>4</issue>
            <fpage>541</fpage>
            <lpage>551</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)80658-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10052456</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>A candidate taste receptor gene near a sweet taste locus</p>
            </title>
            <aug>
               <au>
                  <snm>Montmayeur</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Liberles</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Matsunami</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Buck</snm>
                  <fnm>LB</fnm>
               </au>
            </aug>
            <source>Nat Neurosci</source>
            <pubdate>2001</pubdate>
            <volume>4</volume>
            <issue>5</issue>
            <fpage>492</fpage>
            <lpage>498</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11319557</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The G-protein coupling properties of the human sweet and amino acid taste receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Sainz</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cavenagh</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>LopezJimenez</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Gutierrez</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Battey</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Northup</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Dev Neurobiol</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <issue>7</issue>
            <fpage>948</fpage>
            <lpage>959</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/dneu.20403</pubid>
                  <pubid idtype="pmpid" link="fulltext">17506496</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Adenylate cyclase responses to sucrose stimulation in membranes of pig circumvallate taste papillae</p>
            </title>
            <aug>
               <au>
                  <snm>Naim</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ronen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Striem</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Levinson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zehavi</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Comp Biochem Physiol B</source>
            <pubdate>1991</pubdate>
            <volume>100</volume>
            <issue>3</issue>
            <fpage>455</fpage>
            <lpage>458</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0305-0491(91)90203-P</pubid>
                  <pubid idtype="pmpid">1814673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Molecular mechanisms of bitter and sweet taste transduction</p>
            </title>
            <aug>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2002</pubdate>
            <volume>277</volume>
            <issue>1</issue>
            <fpage>1</fpage>
            <lpage>4</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.R100054200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11696554</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Identification of a phospholipase C beta subtype in rat taste cells</p>
            </title>
            <aug>
               <au>
                  <snm>Rossler</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kroner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Freitag</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Noe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Breer</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Eur J Cell Biol</source>
            <pubdate>1998</pubdate>
            <volume>77</volume>
            <issue>3</issue>
            <fpage>253</fpage>
            <lpage>261</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9860142</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Activation of phospholipase C-beta 2 mutants by G protein alpha q and beta gamma subunits</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Shin</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Hepler</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Gilman</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Rhee</snm>
                  <fnm>SG</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1993</pubdate>
            <volume>268</volume>
            <issue>34</issue>
            <fpage>25952</fpage>
            <lpage>25957</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8245028</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Trpm5 null mice respond to bitter, sweet, and umami compounds</p>
            </title>
            <aug>
               <au>
                  <snm>Damak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rong</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yasumatsu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kokrashvili</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Perez</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Shigemura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Yoshida</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mosinger</snm>
                  <fnm>B</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Glendinning</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Ninomiya</snm>
                  <fnm>Y</fnm>
               </au>
               <etal/>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2006</pubdate>
            <volume>31</volume>
            <issue>3</issue>
            <fpage>253</fpage>
            <lpage>264</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bjj027</pubid>
                  <pubid idtype="pmpid" link="fulltext">16436689</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Contribution of alpha-gustducin to taste-guided licking responses of mice</p>
            </title>
            <aug>
               <au>
                  <snm>Glendinning</snm>
                  <fnm>JI</fnm>
               </au>
               <au>
                  <snm>Bloom</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Onishi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Damak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Spector</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2005</pubdate>
            <volume>30</volume>
            <issue>4</issue>
            <fpage>299</fpage>
            <lpage>316</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bji025</pubid>
                  <pubid idtype="pmpid" link="fulltext">15800219</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>The effect of bilateral sectioning of the chorda tympani and the greater superficial petrosal nerves on the sweet taste in the rat</p>
            </title>
            <aug>
               <au>
                  <snm>Krimm</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Nejad</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>IJ</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Beidler</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Physiol Behav</source>
            <pubdate>1987</pubdate>
            <volume>41</volume>
            <issue>5</issue>
            <fpage>495</fpage>
            <lpage>501</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0031-9384(87)90086-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">3432405</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Taste responses to sweet stimuli in alpha-gustducin knockout and wild-type mice</p>
            </title>
            <aug>
               <au>
                  <snm>Danilova</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Damak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Hellekant</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Chem Senses</source>
            <pubdate>2006</pubdate>
            <volume>31</volume>
            <issue>6</issue>
            <fpage>573</fpage>
            <lpage>580</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/chemse/bjj062</pubid>
                  <pubid idtype="pmpid" link="fulltext">16740645</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Signal transduction and information processing in mammalian taste buds</p>
            </title>
            <aug>
               <au>
                  <snm>Roper</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Pflugers Arch</source>
            <pubdate>2007</pubdate>
            <volume>454</volume>
            <issue>5</issue>
            <fpage>759</fpage>
            <lpage>776</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00424-007-0247-x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17468883</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Detection of sweet and umami taste in the absence of taste receptor T1r3</p>
            </title>
            <aug>
               <au>
                  <snm>Damak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rong</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yasumatsu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kokrashvili</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Varadarajan</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zou</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ninomiya</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Margolskee</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>301</volume>
            <issue>5634</issue>
            <fpage>850</fpage>
            <lpage>853</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1087155</pubid>
                  <pubid idtype="pmpid" link="fulltext">12869700</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Akt activation in platelets depends on Gi signaling pathways</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kunapuli</snm>
                  <fnm>SP</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <issue>6</issue>
            <fpage>4186</fpage>
            <lpage>4195</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M306162200</pubid>
                  <pubid idtype="pmpid" link="fulltext">14623889</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>The roles of alpha IIb beta 3-mediated outside-in signal transduction, thromboxane A2, and adenosine diphosphate in collagen-induced platelet aggregation</p>
            </title>
            <aug>
               <au>
                  <snm>Cho</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Pestina</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Steward</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Coffman</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Gartner</snm>
                  <fnm>TK</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2003</pubdate>
            <volume>101</volume>
            <issue>7</issue>
            <fpage>2646</fpage>
            <lpage>2651</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1182/blood-2002-05-1363</pubid>
                  <pubid idtype="pmpid" link="fulltext">12446460</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Gq protein alpha subunits Galphaq and Galpha11 are localized at postsynaptic extra-junctional membrane of cerebellar Purkinje cells and hippocampal pyramidal cells</p>
            </title>
            <aug>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nakagawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kushiya</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Yamasaki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fukaya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwanaga</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Sakimura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Eur J Neurosci</source>
            <pubdate>2000</pubdate>
            <volume>12</volume>
            <issue>3</issue>
            <fpage>781</fpage>
            <lpage>792</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1460-9568.2000.00959.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10762307</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Biogenic amine synthesis and uptake in rodent taste buds</p>
            </title>
            <aug>
               <au>
                  <snm>Dvoryanchikov</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tomchik</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Chaudhari</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Comp Neurol</source>
            <pubdate>2007</pubdate>
            <volume>505</volume>
            <issue>3</issue>
            <fpage>302</fpage>
            <lpage>313</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/cne.21494</pubid>
                  <pubid idtype="pmpid" link="fulltext">17879273</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
