<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2199-9-59</ui>
   <ji>1471-2199</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Validation of internal control for gene expression study in soybean by quantitative real-time PCR</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Jian</snm>
               <fnm>Bo</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>jianbo1007@yahoo.com</email>
            </au>
            <au id="A2">
               <snm>Liu</snm>
               <fnm>Bin</fnm>
               <insr iid="I2"/>
               <email>bin.liu@bio.ntnu.no</email>
            </au>
            <au id="A3">
               <snm>Bi</snm>
               <fnm>Yurong</fnm>
               <insr iid="I1"/>
               <email>yrbi@lzu.edu.cn</email>
            </au>
            <au id="A4">
               <snm>Hou</snm>
               <fnm>Wensheng</fnm>
               <insr iid="I2"/>
               <email>houwsh@caas.net.cn</email>
            </au>
            <au id="A5">
               <snm>Wu</snm>
               <fnm>Cunxiang</fnm>
               <insr iid="I2"/>
               <email>wucx@mail.caas.net.cn</email>
            </au>
            <au id="A6" ca="yes">
               <snm>Han</snm>
               <fnm>Tianfu</fnm>
               <insr iid="I2"/>
               <email>hantf@mail.caas.net.cn</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>School of Life Sciences, Lanzhou University, Lanzhou, Gansu 730000, PR China</p>
            </ins>
            <ins id="I2">
               <p>The National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI), Institute of Crop Sciences, The Chinese Academy of Agricultural Sciences, Beijing 100081, PR China</p>
            </ins>
         </insg>
         <source>BMC Molecular Biology</source>
         <issn>1471-2199</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>59</fpage>
         <url>http://www.biomedcentral.com/1471-2199/9/59</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18573215</pubid>
               <pubid idtype="doi">10.1186/1471-2199-9-59</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>06</day>
               <month>11</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>23</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>23</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Jian et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Normalizing to housekeeping gene (HKG) can make results from quantitative real-time PCR (qRT-PCR) more reliable. Recent studies have shown that no single HKG is universal for all experiments. Thus, a suitable HKG should be selected before its use. Only a few studies on HKGs have been done in plants, and none in soybean, an economically important crop. Therefore, the present study was conducted to identify suitable HKG(s) for normalization of gene expression in soybean.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>All ten HKGs displayed a wide range of Ct values in 21 sample pools, confirming that they were variably expressed. GeNorm was used to determine the expression stability of the HGKs in seven series sets. For all the sample pools analyzed, the stability rank was <it>ELF1B</it>, <it>CYP2 </it>> <it>ACT11 </it>> <it>TUA </it>> <it>ELF1A </it>> <it>UBC2 </it>> <it>ACT2/7 </it>> <it>TUB </it>> <it>G6PD </it>> <it>UBQ10</it>. For different tissues under the same developmental stage, the rank was <it>ELF1B</it>, <it>CYP2 </it>> <it>ACT2/7 </it>> <it>UBC2 </it>> <it>TUA </it>> <it>ELF1A </it>> <it>ACT11 </it>> <it>TUB </it>> <it>G6PD </it>> <it>UBQ10</it>. For the developmental stage series, the stability rank was <it>ACT2/7</it>, <it>TUA </it>> <it>ELF1A </it>> <it>UBC2 </it>> <it>ELF1B </it>> <it>TUB </it>> <it>CYP2 </it>> <it>ACT11 </it>> <it>G6PD </it>> <it>UBQ10</it>. For photoperiodic treatments, the rank was <it>ACT11</it>, <it>ELF1B </it>> <it>CYP2 </it>> <it>TUA </it>> <it>ELF1A </it>> <it>UBC2 </it>> <it>ACT2/7 </it>> <it>TUB </it>> <it>G6PD </it>> <it>UBQ10</it>. For different times of the day, the rank was <it>ELF1A</it>, <it>TUA </it>> <it>ELF1B </it>> <it>G6PD </it>> <it>CYP2 </it>> <it>ACT11 </it>> <it>ACT2/7 </it>> <it>TUB </it>> <it>UBC2 </it>> <it>UBQ10</it>. For different cultivars and leaves on different nodes of the main stem, the ten HKGs' stability did not differ significantly. &#916;Ct approach and 'Stability index' were also used to analyze the expression stability in all 21 sample pools. Results from &#916;Ct approach and geNorm indicated that <it>ELF1B </it>and <it>CYP2 </it>were the most stable HKGs, and <it>UBQ10 </it>and <it>G6PD </it>the most variable ones. Results from 'Stability index' analysis were different, with <it>ACT11 </it>and <it>CYP2 </it>being the most stable HKGs, and <it>ELF1A </it>and <it>TUA </it>the most variable ones.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our data suggests that HKGs are expressed variably in soybean. Based on the results from geNorm and &#916;Ct analysis, <it>ELF1B </it>and <it>CYP2 </it>could be used as internal controls to normalize gene expression in soybean, while <it>UBQ10 </it>and <it>G6PD </it>should be avoided. To achieve accurate results, some conditions may require more than one HKG to be used for normalization.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Gene expression analysis is becoming much more prevalent since it promotes our understanding of biological processes. Compared with the traditional methods for transcript analysis including Northern blot, RNase protection analysis, <it>in situ </it>hybridization and semi-RT-PCR, the fluorescence-based qRT-PCR has recently been considered as the most reliable method for the detection of mRNA <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> because of its high sensitivity, no post-PCR processing <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, and wide dynamic range <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>, which allows a straightforward comparison between RNAs that differ widely in their abundance. Furthermore, it is easy to use, allows high throughput production of data and eliminates the need for radioactive isotopes <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Moreover, it is especially suitable when only a small number of cells are available. Although qRT-PCR is frequently used due to these advantages, some disadvantages may include variations between samples which may differ in the amount and quality of starting material, RNA preparation, cDNA synthesis, dilutions and pipetting<abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Normalizing a target gene to the HKGs makes qRT-PCR reliable by minimizing the variations.</p>
         <p>The HKGs, which are referred to as internal controls or reference genes, are presumed to have constant expression level among different tissues and at all developmental stages, regardless of the experimental conditions or treatments. Additionally, the HKG and target gene should have similar transcript levels to avoid analytical problems <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Commonly used HKGs are cellular maintenance genes, which regulate basic and ubiquitous cellular functions <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, such as components of the cytoskeleton (actins), glycolytic pathway (glyceraldehyde-3-phosphate dehydrogenase (GAPDH)), protein folding (cyclophilin), synthesis of ribosome subunits (rRNA), electron transporter (succinate dehydrogenase complex, SDH), protein degradation (ubiquitin), etc. These genes are supposed to have constant expression levels between different samples, and are frequently used as a normalizer without proper validation. However, recent studies show that the transcriptional levels of these HKGs are not always stable, and that no single HKG has a constant level under all experimental conditions <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>. A recent study even suggests that such a 'foolproof' gene does not exist <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. The reason for this expression variability may be that the HKGs not only take part in the basic cell metabolism but also participate in other cellular process <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Therefore, selecting a suitable HKG(s) which has a constant expression level in certain experimental conditions for normalization is crucial for getting accurate results in gene expression studies.</p>
         <p>Recently, many procedures have been constructed to find the best suitable HKG(s) in a set of samples, such as geNorm <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>, NormFinder <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, &#916;Ct approach <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and 'Stability index' <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. For example, using geNorm, <it>YWHAZ</it>, <it>GAPD </it>and <it>SDHA </it>were found to be the most stable HKGs across the examined embryonic stages in bovine pre-implantation embryos, while the commonly used <it>ACTB </it>was variably expressed <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. By comparing the expression results of the non-stimulated tissues and leucocytes from Atlantic salmon (Salmo salar L.) using the Normfinder program, it was shown that <it>EF1-alpha </it>was the most stably expressed gene <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Using the &#916;Ct approach, <it>GAPDH </it>was found to be the most suitable HKG for expression studies in reticulocytes while the commonly used <it>B2M </it>should be avoided <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. <it>UBQ </it>and <it>TUA </it>were selected as reference genes to normalize gene expression in a single female poplar hybrid clone (<it>P. trichocarpa </it>&#215; <it>P. deltoidies</it>) using the 'Stability index' <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Nevertheless, many studies on HKGs selection refer to human or animal tissue. As far as is known, only a few have been focused on plants such as rice <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>, poplar <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, potato <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> and <it>Arabidopsis thaliana </it><abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Moreover, there is no report on soybean (<it>Glycine max </it>[L.] Merr.), a very important crop and a model plant in the early studies of photoperiodism <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>.</p>
         <p>Photoperiod controls several responses throughout the plant life cycle, such as germination <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, flowering induction <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>, post-flowering development <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>, maturity, dormancy <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, and yield formation <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. The photoperiodic control of flowering in <it>Arabidopsis</it>, a long-day (LD) plant, is a hot topic attracting many scientists to enter this field and helping to better understand the processes involved <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. However, there is little known about the mechanism in soybean, a typical short-day (SD) plant. Thus, the understanding of some key genes' expression patterns will help illuminate the mechanism involved in this process. Different cultivars of soybean may have different sensitivity to photoperiod; studies of the expression pattern of key genes in the photoperiodic pathway may also help elucidate what leads to the varietal difference.</p>
         <p>In the present study, the expression profiles of ten HKGs, including <it>ACT11</it>, <it>ACT2/7</it>, <it>TUA</it>, <it>TUB</it>, <it>UBC2</it>, <it>CYP2</it>, <it>G6PD</it>, <it>ELF1A</it>, <it>ELF1B </it>and <it>UBQ10</it>, were studied during the development of <it>Zigongdongdou </it>(ZGGG), a late-maturing soybean (<it>Glycine max </it>[L.] Merr) cultivar, under LD and SD conditions. The expression patterns of the ten HKGs were also detected in soybean cultivar Heihe No. 27 (HH27), Zhonghuang No. 24 (ZH24) and Suinong No. 14 (SN14). GeNorm, &#916;Ct approach and 'Stability index' were used to assess the value of ten HKGs as suitable internal control(s) for soybean gene expression studies.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Expression profiling of HKGs</p>
            </st>
            <p>A qRT-PCR assay, based on SYBR Green detection, was designed for the transcriptional profiling of ten commonly used HKGs (<it>ACT11</it>, <it>ACT2</it>, <it>G6PD</it>, <it>ELF1B</it>, <it>UBC2</it>, <it>ELF1A</it>, <it>TUB</it>, <it>TUA</it>, <it>CYP2 </it>and <it>UBQ10</it>) in soybean. In order to select a reliable set of HKGs, all PCR assays were done in triplicate. To make the comparison among each PCR run reliable, all the Ct values were determined at the threshold fluorescence value of 0.2, and three fixed PCR reactions were performed in every PCR run to make the data from each PCR run comparable. The Ct value was used to analyze the transcriptional levels of HKGs. This approach was a simplified way to give an overview of the abundance of the genes in the samples <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. The ten HKGs showed a relatively wide range of Ct values from the lowest mean Ct value (18.22) in <it>CYP2</it>, to the highest (23.50) in <it>ELF1A </it>in all tested sample pools in soybean. Individual HKGs had different expression levels across all the sample pools tested. <it>ACT11 </it>and <it>CYP2 </it>showed the smallest gene expression variation (below 4 cycles), while <it>ACT2/7</it>, <it>ELF1A</it>, <it>TUB </it>and <it>TUA </it>had the highest expression variation (above 6 cycles) as shown in Figure <figr fid="F1">1</figr>. The wide expression range of the ten tested HKGs confirmed that no single HKG had a constant expression under these conditions in soybean. Obviously, it is necessary to select a suitable HKG to normalize gene expression under a certain condition.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>The transcriptional profiles of individual HKGs in absolute Ct values over all RNA samples</p>
               </caption>
               <text>
                  <p><b>The transcriptional profiles of individual HKGs in absolute Ct values over all RNA samples</b>. The tissues used for this analysis were listed in Table 4. The number indicated the corresponding sample.</p>
               </text>
               <graphic file="1471-2199-9-59-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>GeNorm analysis</p>
            </st>
            <p>Gene expression stability (M) of these ten HKGs in various tissue samples under different conditions was measured by geNorm as described by Vandesompele <it>et al</it>. <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. This approach relies on the principle that the expression ratio of two ideal HKGs is constant in all the samples, independent of the experimental conditions and cell-types. Genes with the lowest M have the most stable expression, while the highest M value indicates the least stable expression <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. We analyzed data under seven sets. As shown in Figure <figr fid="F2">2A</figr>, when all the 21 samples were taken together, the average expression stability value (M) of <it>ELF1B </it>and <it>CYP2 </it>was lowest, and that of <it>UBQ10 </it>was highest, suggesting that <it>ELF1B </it>and <it>CYP2 </it>had the most stable expression and that <it>UBQ10 </it>was expressed most variably. The results remained very similar in the different tissues under the same developmental stage series, with the lowest M value for <it>ELF1B </it>and <it>CYP2 </it>(Figure <figr fid="F2">2B</figr>). <it>UBQ10 </it>remained the least stable gene, while <it>ACT2/7 </it>and <it>TUA </it>were the ones with the lowest M, indicating that they were stably expressed in the developmental series of soybean (Figure <figr fid="F2">2C</figr>). In the photoperiodic treatment, <it>ACT11 </it>and <it>ELF1B </it>were the most stable genes, while <it>UBQ10 </it>still was the most variable one (Figure <figr fid="F2">2D</figr>). In the different cultivar series, the M value was least for <it>UBC2 </it>and <it>TUB </it>followed by <it>ELF1B</it>, <it>TUA</it>, <it>ELF1A</it>, <it>ACT11</it>, while <it>ACT2/7 </it>was the least stable HKG (Figure <figr fid="F2">2E</figr>). In the different time of the day series, <it>ELF1A </it>and <it>TUA </it>were expressed much more stably than the other eight HKGs, while <it>UBQ10 </it>continued to be the most variable one (Figure <figr fid="F2">2F</figr>). Since the HKGs <it>UBQ10 </it>and <it>ACT11 </it>showed variable expression profiles in a semi-RT-PCR comparison of the unifoliate leaves and a leaf mixture containing all the leaves (data not shown), the transcriptional expression of the ten HKGs was studied in this series. Results from geNorm analysis showed <it>UBC2 </it>and <it>ACT2/7 </it>were the least variable ones among the ten tested HKGs, while <it>UBQ10 </it>was still the most variable one. However, the difference of M value between the less stable HKGs (<it>ACT11</it>, <it>ELF1A</it>, <it>G6PD </it>and <it>TUA</it>) was minimal (Figure <figr fid="F2">2G</figr>).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Average expression stability and ranking of ten HKGs as calculated by geNorm</p>
               </caption>
               <text>
                  <p><b>Average expression stability and ranking of ten HKGs as calculated by geNorm</b>. Expression stability and ranking of ten HKGs calculated with geNorm in all 21 sample pools (A), different tissues at the same developmental stage (B), developmental series (C), photoperiod treatments (D), different cultivar (E), different time of the day series (F), leaves located on different nodes on the main stem (G). A lower average expression stability M indicates more stable expression.</p>
               </text>
               <graphic file="1471-2199-9-59-2"/>
            </fig>
            <p>For some experimental setups, using a single HKG for normalization is appropriate <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, while, for other ones, there may be no single HKG suitable as a reliable internal control <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Therefore, the requirement of two or more HKGs for accurate normalization is necessary. The optimal number of HKGs necessary for reliable normalization is defined by a normalization factor (NF) which is determined by the geNorm software. The pairwise variations V<sub>n</sub>/V<sub>n+1 </sub>between two sequential normalization factors (NF<sub>n </sub>and NF<sub>n+1</sub>) are used to determine the necessity of adding the next HKG for reliable normalization <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. As shown in Figure <figr fid="F3">3(D,E,F,G)</figr>, the two most stable HKGs were found to be optimal for the accurate normalization with a pairwise variation value much lower than the cut-off value of 0.15 suggested in <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. It was apparent that the addition of the third HKG for normalization would have no significant effect on pairwise variation in the four series as shown in Figure <figr fid="F3">3A</figr>. When all 21 samples were taken together, the pairwise variation V<sub>2/3 </sub>was higher than 0.15 (0.203), as was V<sub>3/4 </sub>(0.174). This indicated the addition of the fourth HKG was necessary to normalize gene expression. This situation was similar for the series with different tissues under the same developmental stage. The pairwise variation V<sub>2/3 </sub>and V<sub>3/4 </sub>were 0.185 and 0.181, respectively, both higher than 0.15 (Figure <figr fid="F3">3B</figr>). When looking at the developmental stages, the pairwise variation V<sub>2/3 </sub>was 0.177, while V<sub>3/4 </sub>was 0.133, so the three HKGs (<it>ELF1A</it>, <it>ACT2/7 </it>and <it>TUA</it>) were sufficient for accurate normalization. When evaluating all the pairwise variation, the least stable HKG was <it>UBQ10 </it>followed by <it>G6PD </it>as they significantly increased the pairwise variation during the whole assay by increasing the V value as shown in Figure <figr fid="F3">3</figr>.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Determination of the optimal number of HKG for normalization by pairwise variation using geNorm</p>
               </caption>
               <text>
                  <p><b>Determination of the optimal number of HKG for normalization by pairwise variation using geNorm</b>. Pairwise variation (V) to determine the optimal number of HKG(s) for accurate normalization in all 21 sample pools (A), different tissues at the same developmental stage (B), developmental series (C), photoperiod treatment (D), different cultivars (E), different time of the day series (F), leaves on different nodes on the main stem (G).</p>
               </text>
               <graphic file="1471-2199-9-59-3"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>'Stability index' assay</p>
            </st>
            <p>A 'Stability index' assay was first used to select suitable internal controls during the development of poplar <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In the current study, the expression stability rank of the ten HKGs in soybean was detected according to the 'Stability index'. As shown in Table <tblr tid="T1">1</tblr>, when all 21 sample pools were taken together, <it>ACT11 </it>had the lowest stability index and was the most stable HKG. The expression stability rank was as follows: <it>ACT11 </it>> <it>CYP2 </it>> <it>UBC2 </it>> <it>ELF1B </it>> <it>ACT2/7 </it>> <it>G6PD </it>> <it>UBQ10 </it>> <it>TUB </it>> <it>TUA </it>> <it>ELF1A</it>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Summary of statistics measuring stability of HKG expression</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="center">
                        <p>Gene</p>
                     </c>
                     <c ca="center">
                        <p>Mean Ct<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>StdDev<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Slope<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>Intercept<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>CV%<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>Stability index<sup>f</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT11</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>18.63</p>
                     </c>
                     <c ca="center">
                        <p>0.74</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>20.97</p>
                     </c>
                     <c ca="center">
                        <p>3.57</p>
                     </c>
                     <c ca="center">
                        <p>0.11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>CYP2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>18.22</p>
                     </c>
                     <c ca="center">
                        <p>1.09</p>
                     </c>
                     <c ca="center">
                        <p>0.02</p>
                     </c>
                     <c ca="center">
                        <p>18.46</p>
                     </c>
                     <c ca="center">
                        <p>5.99</p>
                     </c>
                     <c ca="center">
                        <p>0.13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBC2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>21.91</p>
                     </c>
                     <c ca="center">
                        <p>1.17</p>
                     </c>
                     <c ca="center">
                        <p>0.03</p>
                     </c>
                     <c ca="center">
                        <p>21.91</p>
                     </c>
                     <c ca="center">
                        <p>5.33</p>
                     </c>
                     <c ca="center">
                        <p>0.16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1B</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>23.50</p>
                     </c>
                     <c ca="center">
                        <p>1.21</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c ca="center">
                        <p>24.01</p>
                     </c>
                     <c ca="center">
                        <p>5.16</p>
                     </c>
                     <c ca="center">
                        <p>0.24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT2/7</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>22.82</p>
                     </c>
                     <c ca="center">
                        <p>1.42</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c ca="center">
                        <p>23.33</p>
                     </c>
                     <c ca="center">
                        <p>6.21</p>
                     </c>
                     <c ca="center">
                        <p>0.28</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G6PD</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>22.91</p>
                     </c>
                     <c ca="center">
                        <p>1.68</p>
                     </c>
                     <c ca="center">
                        <p>0.04</p>
                     </c>
                     <c ca="center">
                        <p>22.45</p>
                     </c>
                     <c ca="center">
                        <p>7.34</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBQ10</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>22.85</p>
                     </c>
                     <c ca="center">
                        <p>1.53</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                     <c ca="center">
                        <p>22.14</p>
                     </c>
                     <c ca="center">
                        <p>6.68</p>
                     </c>
                     <c ca="center">
                        <p>0.43</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUB</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>21.77</p>
                     </c>
                     <c ca="center">
                        <p>1.74</p>
                     </c>
                     <c ca="center">
                        <p>0.09</p>
                     </c>
                     <c ca="center">
                        <p>22.80</p>
                     </c>
                     <c ca="center">
                        <p>7.99</p>
                     </c>
                     <c ca="center">
                        <p>0.72</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>21.47</p>
                     </c>
                     <c ca="center">
                        <p>1.42</p>
                     </c>
                     <c ca="center">
                        <p>0.12</p>
                     </c>
                     <c ca="center">
                        <p>22.86</p>
                     </c>
                     <c ca="center">
                        <p>6.63</p>
                     </c>
                     <c ca="center">
                        <p>0.80</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1A</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>19.25</p>
                     </c>
                     <c ca="center">
                        <p>1.43</p>
                     </c>
                     <c ca="center">
                        <p>0.12</p>
                     </c>
                     <c ca="center">
                        <p>20.58</p>
                     </c>
                     <c ca="center">
                        <p>7.45</p>
                     </c>
                     <c ca="center">
                        <p>0.90</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Data based on analysis of raw Ct value. Genes were ordered, top to bottom, from those tending to show the highest stability to those showing the lowest, based on the stability index. <sup>b</sup>StdDev among all the tissue samples tested. <sup>c</sup>Slope of regression of gene means. <sup>d</sup>Intercepts were also given for the estimated regression lines. <sup>e</sup>Coefficient of variation (CV) (StdDev divided by mean multiplied by 100). <sup>f</sup>Stability index was the product of CV and slope (multiplication of columns 4 and 6). Genes with the lowest stability index usually provide the best control.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>&#916;Ct analysis</p>
            </st>
            <p>The &#916;Ct approach was employed by Silver et al.<abbrgrp><abbr bid="B15">15</abbr></abbrgrp> to select the most suitable HKG in reticulocytes. If the &#916;Ct value between two HKGs does not change when analyzed in all the samples, it means either both genes have stable expression patterns or they are co-regulated among those samples. However, the fluctuation in &#916;Ct means that at least one of them was variably expressed. Introduction of a third, fourth, or fifth gene into the comparisons will provide more information on which pairs show less variability and hence which gene(s) has stable expression among the samples tested. It is easy for large panels of genes to be compared with one another and then selected or eliminated on the basis of &#916;Ct. Ultimately, an appropriate HKG can be selected for a particular experimental system <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
            <p>The expression stability of HKGs was measured by the &#916;Ct value and standard deviation (StdDev) in the present study as described in <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Taking all ten HKGs into account and comparing all the possible combinations, their expression stability was determined. As shown in Additional File <supplr sid="S1">1</supplr>, Figure <figr fid="F4">4A</figr> and <figr fid="F4">4B</figr>, when <it>ELF1B </it>and <it>CYP2 </it>were compared with the other nine HKGs in their respective gene panels, the mean StdDev was 1.00 and 1.04, respectively, indicating that <it>ELF1B </it>was the most stable one among the ten HKGs analyzed in all the 21 sample pools, followed by <it>CYP2</it>. In contrast, when <it>UBQ10 </it>and <it>G6PD </it>were compared to the other nine HKGs in their respective gene panels, they tended to be associated with the greatest amount of deviation in &#916;Ct value (the mean StdDev was 1.84 and 1.50, respectively), which meant that <it>UBQ10</it>, followed by <it>G6PD</it>, were the least stable HKGs in all the 21 samples tested. <it>UBQ10 </it>should be avoided when doing gene expression analysis because of its high deviation in &#916;Ct value when compared to the other nine HKGs (the greatest amount was 2.44 to <it>TUB</it>, and the least was 1.47 to <it>UBC2</it>). <it>ELF1A</it>, <it>ACT11</it>/<it>TUA</it>, <it>TUB</it>/<it>ACT2/7 </it>and <it>UBC2 </it>all showed intermediate levels of &#916;Ct deviation (the mean StdDev was 1.06, 1.07, 1.07, 1.08, 1.08, 1.15, 1.50 and 1.84, respectively), indicating intermediate stability. Overall rankings were as follows: <it>ELF1B</it>, <it>CYP2</it>, <it>ELF1A</it>, <it>ACT11</it>/<it>TUA</it>, <it>TUB</it>/<it>ACT2/7</it>, <it>UBC2</it>, <it>G6PD</it>, and finally <it>UBQ10</it>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional File 1</p>
               </title>
               <text>
                  <p><b>HKG comparisons</b>. Mean &#916;Ct values were given for the mean difference between the genes over the 21 sample pools. SteDev was given for the variation in Ct values over the 21 sample pools.</p>
               </text>
               <file name="1471-2199-9-59-S1.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>&#916;Ct method for HKG selection</p>
               </caption>
               <text>
                  <p><b>&#916;Ct method for HKG selection</b>. &#916;Ct variability in HKG comparisons were shown as medians (lines), 25th percentile to the 75th percentile (boxes) and ranges (whiskers) for all the 21 sample pools. A. Comparisons of the completely possible sets of HKGs which included <it>ACT11</it>, <it>ACT2/7</it>, <it>G6PD</it>, <it>ELF1B</it>, <it>UBC2</it>; B. Comparisons of the completely possible sets of HKGs, which included <it>ELF1A</it>, <it>TUB</it>, <it>TUA</it>, <it>CYP2 </it>and <it>UBQ10</it>.</p>
               </text>
               <graphic file="1471-2199-9-59-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p><it>GmBFT </it>expression</p>
            </st>
            <p>The relative expression level of <it>GmBFT </it>(<it>Glycine max </it>brother of FT and TFL1) <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, an ortholog of <it>Arabidopsis BFT </it><abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, was detected to validate the HKGs selected in the present study under certain conditions according to the geNorm manual. The geometric average of the most stable HKGs (<it>ACT2/7</it>, <it>TUA </it>and <it>ELF1A</it>) in the developmental stage series selected by geNorm was used as an internal control. The relative expression of <it>GmBFT </it>increased after a 25-day SD treatment in unifoliate leaves, being 5.5-fold higher than that at 1-day SD treatment (Figure <figr fid="F5">5A</figr> b and a, Table <tblr tid="T2">2</tblr> b and a). Similarly, <it>GmBFT </it>expression level was also higher in shoot tips after a 25-day SD treatment compared to the 1-day SD treatment (Figure <figr fid="F5">5A</figr> d and c, Table <tblr tid="T2">2</tblr> d and c). In the same way, using the geometric average of the most stable HKGs (<it>ACT11 </it>and <it>ELFIB</it>) in the photoperiodic treatment selected by geNorm as an internal control, it was found that the relative expression of <it>GmBFT </it>expression in both unifoliate leaves and shoot tips at 25-day under SD treatment was higher than that under LD treatment. The expression level of <it>GmBFT </it>in unifoliate leaves under 25-day SD treatment was 2.98 fold higher than that under 25-day LD treatment (Figure <figr fid="F5">5B</figr> b and e, Table <tblr tid="T3">3</tblr> a and b). Likewise, <it>GmBFT </it>expression level in shoot tips under 25-day SD treatment was 25.3 fold higher than that under 25-day LD treatment (Figure <figr fid="F5">5B</figr> d and f, Table <tblr tid="T3">3</tblr> c and d). As shown previously by geNorm in the present study, <it>GAPD </it>and <it>UBQ10 </it>were the most variable HKGs for the developmental stage and photoperiodic treatment series. The relative expression of <it>GmBFT </it>in unifoliate leaves and shoot tips was also detected using the two HKGs as internal controls and no significant difference was found.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Relative quantification of <it>GmBFT </it>expression using different HKGs as internal controls under different developmental stages and photoperiod conditions</p>
               </caption>
               <text>
                  <p><b>Relative quantification of <it>GmBFT </it>expression using different HKGs as internal controls under different developmental stages and photoperiod conditions</b>. Relative quantification of <it>GmBFT </it>expression was detected using two or three of the most stable HKGs or the most variable HKGs selected by geNorm as internal controls. The geometric average of <it>ACT2/7</it>, <it>TUA </it>and <it>ELF1A</it>, <it>UBQ10 </it>and <it>G6PD </it>were used as internal controls for developmental stage (A), the geometric average of <it>ACT11 </it>and <it>ELF1B</it>, <it>UBQ10 </it>and <it>G6PD </it>were used as internal controls for photoperiod treatment (B). a, SD 1-day leaves; b, SD 25-day leaves; c, SD 1-day shoot tips; d, SD 25- day shoot tips; e, LD 25-day leaves; f, LD 25-day shoot tips.</p>
               </text>
               <graphic file="1471-2199-9-59-5"/>
            </fig>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Relative expression of <it>GmBFT </it>at different developmental stages</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>Tissue sample</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Relative expression of <it>GmBFT </it>using different HKG(s) as internal controls (mean &#177; StdDev)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <it>ACT2/7+TUA+ELF1A</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>UBQ10</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>G6PD</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>a</p>
                     </c>
                     <c ca="center">
                        <p>0.47 &#177; 0.35</p>
                     </c>
                     <c ca="center">
                        <p>1.08 &#177; 0.13</p>
                     </c>
                     <c ca="center">
                        <p>0.92 &#177; 0.18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>b</p>
                     </c>
                     <c ca="center">
                        <p>2.59 &#177; 0.09</p>
                     </c>
                     <c ca="center">
                        <p>0.85 &#177; 0.10</p>
                     </c>
                     <c ca="center">
                        <p>1.18 &#177; 0.23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>c</p>
                     </c>
                     <c ca="center">
                        <p>0.25 &#177; 0.12</p>
                     </c>
                     <c ca="center">
                        <p>0.95 &#177; 0.34</p>
                     </c>
                     <c ca="center">
                        <p>1.16 &#177; 0.13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>d</p>
                     </c>
                     <c ca="center">
                        <p>2.56 &#177; 0.35</p>
                     </c>
                     <c ca="center">
                        <p>1.24 &#177; 0.25</p>
                     </c>
                     <c ca="center">
                        <p>0.97 &#177; 0.21</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>a, SD 1-day leaves; b, SD 25-day leaves; c, SD 1-day shoot tips; d, SD 25- day shoot.</p>
               </tblfn>
            </tbl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Relative expression of <it>GmBFT </it>under different photoperiodic treatments</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>Tissue sample</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Relative expression of <it>GmBFT </it>using different HKG(s) as internal controls (mean &#177; StdDev)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <it>ACT11+ELF1B</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>UBQ10</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>G6PD</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>a</p>
                     </c>
                     <c ca="center">
                        <p>2.59 &#177; 0.45</p>
                     </c>
                     <c ca="center">
                        <p>0.98 &#177; 0.09</p>
                     </c>
                     <c ca="center">
                        <p>0.75 &#177; 0.12</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>b</p>
                     </c>
                     <c ca="center">
                        <p>0.87 &#177; 0.08</p>
                     </c>
                     <c ca="center">
                        <p>1.32 &#177; 0.15</p>
                     </c>
                     <c ca="center">
                        <p>1.00 &#177; 0.15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>c</p>
                     </c>
                     <c ca="center">
                        <p>2.78 &#177; 0.34</p>
                     </c>
                     <c ca="center">
                        <p>1.15 &#177; 0.04</p>
                     </c>
                     <c ca="center">
                        <p>1.13 &#177; 0.08</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>d</p>
                     </c>
                     <c ca="center">
                        <p>0.11 &#177; 0.12</p>
                     </c>
                     <c ca="center">
                        <p>0.54 &#177; 0.12</p>
                     </c>
                     <c ca="center">
                        <p>0.63 &#177; 0.11</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>a, SD 25-day leaves; b, LD 25-day leaves; c, SD 25- day shoot tips; d, LD 25-day shoot tips.</p>
               </tblfn>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>qRT-PCR has become a powerful tool for gene expression analysis because of its high throughput, sensitivity and accuracy <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B4">4</abbr></abbrgrp>. The use of suitable HKGs to normalize the variation made by RNA preparation, cDNA synthesis or PCR processing would make the results more reliable. In order to select suitable HKG(s) for normalization, many procedures such as geNorm <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>, Normfinder <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, &#916;Ct approach <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and 'Stability index' <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> have been used. Since all methods mentioned above are based on the Ct value, which is determined mostly by the quantity of cDNA <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>, the prerequisite for selecting a set of reliable HKG(s) is based on the equal input cDNA when doing qRT-PCR. In early studies, the most commonly used method to measure the input cDNA was by a spectrophotometer such as NanoDrop ND-1000 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>. Considering the importance of input cDNA, more than one method should be used to detect its quantity and quality to ensure the cDNA equality for each PCR run in order to get reliable results for HKG(s) expression stability analysis. In the present study, cDNA was verified by measurements on both the ND-1000 and SMA3000 spectrophotometers to ensure the equality of cDNA in the PCR reactions and reliability of the results when using Ct values for analysis.</p>
         <p>When gene expression stability in soybean was analyzed by geNorm, the most stable genes in the seven series were different as shown in Figure <figr fid="F3">3</figr>. In all seven series analyzed, <it>ELF1B </it>was the most stable HKG. <it>UBQ10 </it>and <it>G6PD </it>were the most variable ones, so these genes should be avoided as internal controls when doing gene expression studies in soybean. Our findings were in accordance with the result that <it>UBQ10 </it>exhibited the least stable expression in different tissues or cell types at different developmental stages in rice <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Similarly, in the development of grape berry, <it>UBQ10 </it>was not the recommended HKG for normalization <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. However, in an earlier study in <it>Arabidopsis</it>, <it>UBQ10 </it>showed highly stable expression <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. An ubiquitin tag is not only used to mark particular proteins for proteolytic elimination, but can also have non-proteolytic functions <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> which may lead to the variable expression of ubiquitin in different plants. <it>G6PD </it>was suggested to be an inappropriate internal control in qRT-PCR studies of estrogens effects in fish <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> and it also showed significant differences in expression between malignant and nonmalignant pairs (at least p &lt; 0.04) of human bladder cancer <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. There are few published works using <it>G6PD </it>as an internal control. This may be because <it>G6PD </it>not only acts as a component of the glycolytic pathway but also participates in other processes as well. Thus, the expression profile of <it>G6PD </it>might change according to the corresponding experimental conditions. In the present study, <it>TUA </it>was found to be one of the most stable HKGs with the lowest M value in the developmental series in soybean. This result was consistent with an earlier study in poplar with <it>TUA </it>as one of the most stable HKGs <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Other most commonly used HKGs, like <it>TUB</it>, displayed an unacceptably high variable expression pattern limiting its use as an internal control except in the different cultivar series where all the other HKGs showed relatively stable expression. Taken together, these results suggested that these HKGs were regulated differently in each plant species and may exhibit differential expression patterns. Therefore, a HKG with stable expression in one organism may be not suitable to normalize gene expression in another organism under a given set of conditions and thus needs to be validated before its use.</p>
         <p>To further verify the suitability of HKGs selected in the present study, <it>GmBFT </it>expression levels were detected at different developmental stages and under different photoperiodic conditions in soybean (Figure <figr fid="F5">5</figr>). In unifoliate leaves, <it>GmBFT </it>expression after a 25-day SD treatment was significantly higher than after a 1-day SD treatment, and was also higher than after a 25-day LD treatment. The case was similar in the shoot tips of soybean using HKGs selected in corresponding conditions as internal controls. The fact that this result is in accordance with earlier work by Sun et al. <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> means that the HKGs identified in this study are suitable at various development stages and photoperiodic conditions. The relative expression of <it>GmBFT </it>was also analyzed using <it>UBQ10 </it>and <it>G6PD </it>as internal controls (Figure <figr fid="F5">5</figr>). No significant expression difference of <it>GmBFT </it>was observed in unifoliate leaves at different developmental stages or under different photoperiodic conditions. The result was similar in shoot tips. Obviously, <it>UBQ10 </it>and <it>G6PD </it>are not suitable HKGs to normalize gene expression in soybean under such conditions.</p>
         <p>The &#916;Ct approach <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and 'Stability index' <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> were also used to analyze gene expression stability in all 21 sample pools in soybean to compare the accuracy of these three methods. Results obtained from the &#916;Ct method were very similar to that from the geNorm analysis. <it>ELF1B </it>was the most stable HKG followed by <it>CYP2</it>, while <it>UBQ10 </it>was the most variable HKG followed by <it>G6PD</it>. When 'Stability index' was used to measure the stability of HKG(s), results changed, with <it>ACT11 </it>being the most stable HKG followed by <it>CYP2</it>, while <it>TUA </it>and <it>ELF1A </it>became the least stable ones in all the 21 sample pools in soybean. An explanation might be that the 'Stability index'did not take the PCR efficiency into account, which played an important role in the data analysis. Thus, in order to get a reliable result by only comparing Ct deviation for the individual genes in the tested tissue samples, the HKGs analyzed should have similar PCR efficiency.</p>
         <p>Although gene expression stability analyzed by the &#916;Ct approach was similar to that by geNorm, it was still not the first choice to get accurate normalization especially for the research which can get enough samples. The &#916;Ct method can be used to detect the most stable HKG as geNorm provides; however, it could not provide the number of HKGs necessary for accurate normalization. Some studies may require more than one HKG to be included, and using the single most stable HKG for normalization might not get the most accurate result. Indeed, as shown in Figure <figr fid="F3">3A</figr>, when all 21 sample pools were analyzed by geNorm, the geometric average of four HKGs (<it>ELF1B</it>, <it>CYP2</it>, <it>ACT11 </it>and <it>TUA</it>) was recommended as the normalization factor to get accurate results in soybean. However, the analysis by &#916;Ct method only indicated that the most stable HKG was <it>ELF1B</it>, and it could not be used to find out the optimal number of HKGs. Thus, gene expression accuracy might be undermined if the result is only based on <it>ELF1B</it>. It is true that the &#916;Ct method is useful for validating the most stable HKG in some specific tissue samples or cell types for which it is difficult to obtain enough material, such as reticulocytes <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. However, for material where RNA samples are easy to obtain, such as plants, geNorm is recommended because it is easy to determine the optimal number of stable HKGs for accurate normalization.</p>
         <p>Selection of suitable HKG(s) is necessary for accurate gene expression, but it is quite expensive and time-consuming. To avoid the additional expense and labor of using multiple internal control genes, a potential strategy suggested by Brunner <it>et al</it>. <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> was to design a PCR primer pair which could amplify two or more members of a control gene family. However, for two members of the same HKG family, their expression pattern and stability might vary. Therefore, results may be questionable for gene expression based on these two HKGs. For example, <it>UBQ5 </it>was one of the most suitable HKGs in a given set of tissue samples in rice, while <it>UBQ10 </it>expressed variably <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. A similar situation was observed for the actin gene family in the developmental stage series in the present study. <it>ACT2/7 </it>was stably expressed, while <it>ACT11 </it>showed variable profiling. Thus, using primer pair sets to amplify two or more members of a HKG family for qRT-PCR may not be recommendable. After all, the accuracy of the results should always be given first priority.</p>
         <p>The photoperiod plays an important role throughout the life cycle of soybean <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B46">46</abbr></abbrgrp>. The sensitivity of different cultivars of soybean to photoperiod is quite variable. Understanding the mechanisms involved in this process will be beneficial in the molecular breeding of soybean. In the present study, the most stable HKG in the different cultivar series under the same photoperiodic conditions and developmental stage was <it>UBC2</it>, whereas <it>ACT2/7 </it>was the most variable one. The difference of average expression stability among the ten HKGs in this series was smaller than that in the other series. Thus, the gene expression would be similar using any of the ten HKGs as internal controls when studying different cultivar. It would be helpful to understand the mechanisms involved in differential sensitivities to photoperiod for different cultivars.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>A large number of studies have been carried out concerning the validation of HKG(s) in many different tissue samples and cell types. However, there is no correlative report in soybean, a SD dicot. Our data showed the variable expression profiles of ten commonly used HKGs in different tissue samples and under different photoperiodic conditions in soybean. Based on geNorm and &#916;Ct methods, <it>ELF1B </it>and <it>CYP2 </it>appears to be the most suitable HKGs to normalize gene expression during the development of soybean, while <it>UBQ10 </it>and <it>G6PD </it>seems to be unsuitable as reference genes. Under some conditions, more than one HKG should be used as internal controls to normalize gene expression in soybean in order to get the most reliable results.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Sample collection and RNA extraction</p>
            </st>
            <p>ZGGG, a soybean (<it>Glycine max </it>[L.] Merr.) cultivar from Sichuan Province, South China, was used as the main material. This cultivar is late maturing and sensitive to photoperiod <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. HH27, a soybean cultivar from Heilongjiang Province, which is not sensitive to photoperiod; ZH24, a soybean cultivar from Beijing and SN14, another soybean cultivar from Heilongjiang, were also used as the materials. After the unifoliate leaves expanded, the seedlings were transferred to LD (16 h light/8 h dark) and SD (12 h light/12 h dark) conditions, respectively <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. The samples were collected and then frozen in liquid N<sub>2 </sub>and stored at -80&#176;C until RNA extraction. All the sample pools used for this research were provided in Table <tblr tid="T4">4</tblr> and each pool contained at least 30 seedlings.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Soybean tissues used for gene expression analysis</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="center">
                        <p>No.</p>
                     </c>
                     <c ca="center">
                        <p>Cultivar</p>
                     </c>
                     <c ca="center">
                        <p>Organ</p>
                     </c>
                     <c ca="center">
                        <p>Photoperiod</p>
                     </c>
                     <c ca="center">
                        <p>Time after photoperiodic treatment for seeding</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Root</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Root</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Root</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Stem</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Stem</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Stem</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Shoot tip</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Shoot tip</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Root nodule</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Root nodule</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>2 h</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>6 h</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>10 h</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Flower</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>25d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Pod</p>
                     </c>
                     <c ca="center">
                        <p>SD</p>
                     </c>
                     <c ca="center">
                        <p>32d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>ZGDD</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>HH27</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>ZH24</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>SN14</p>
                     </c>
                     <c ca="center">
                        <p>Leaf</p>
                     </c>
                     <c ca="center">
                        <p>LD</p>
                     </c>
                     <c ca="center">
                        <p>1d</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Total RNA was extracted using Trizol (Invitrogen) according to the Manufacture's Instruction with little modification. One more chloroform extraction step was added to the RNA extraction process. RNA was quantified by the absorbance at OD<sub>260 </sub>using NanDrop ND-1000 spectrophotometer. The absorbance ratio at OD<sub>260/280 </sub>and OD<sub>260/230 </sub>were used to assess the purity of all the RNA samples. Only RNA samples with OD<sub>260/280 </sub>ratio (protein contamination) between 1.8&#8211;2.0 and OD<sub>260/230 </sub>(organic pollutant) higher than 2.0 was used for the further analysis. RNA integrity was verified by 2% agar gel electrophoresis and ethidium bromide staining. The samples with 25S/18S ribosomal RNA between 1.5&#8211;2.0 and absence of smears were used for the following experiment.</p>
         </sec>
         <sec>
            <st>
               <p>cDNA synthesis and quantification</p>
            </st>
            <p>Before cDNA synthesis, 5 &#956;g total RNA was treated with RQ1 RNase-free DNase (Promega) according to the Manufacture's Instruction to ensure no DNA contamination, and then cDNA synthesis was carried out with the purified RNA using the SuperScript III First-Strand Synthesis System (Invitrogen) following the instruction. The RT reaction was performed using Mastercycler Gradient (Eppendorf). Briefly, 1 &#956;g RNA, 50 &#956;M oligo<sub>dT</sub>(20) and 10 mM dNTP mix were added together to incubate at 65&#176;C for 5 min, then placed on ice for at least 1 min. After that, 2 &#956;l 10 &#215; RT buffer, 1 &#956;l 25 mM MgCl<sub>2</sub>, 2 &#956;l 0.1 M DTT, 40 U RNaseOUT and 200 U SuperScript III were added and then incubated at 50&#176;C for 50 min. The RT reaction was terminated by incubating at 85&#176;C for 5 min and the residual RNA was removed by incubated at 37&#176;C for 20 min with the addition of 1 &#956;l RNaseH. After cDNA was synthesized, it was used as the template for PCR amplification. This amplification was made using primer pair sets which span an intron to detect DNA contamination.</p>
            <p>cDNA was 2&#215; diluted before quantification and the quantity and quality of input cDNA were determined by the SMA3000 and NanDrop ND-1000 spectrophotometer to make sure the cDNA amount for each PCR run is equal. For each method, the measurement was done in duplicate. The slope of the regression line of the concentrations measured with both methods did not differ indicating the equality of cDNA measurement with both methods for the qRT-PCR reaction (Yconc.ND-1000 = 1.0444 &#215; Xconc.SMA3000+0.5443; n = 21; r = 0.9763). To reduce the system error, all the cDNA was diluted to about 2.3 ng/&#956;l, so there were 20 ng/8.8 &#956;l cDNA for the real-time RT-PCR reaction. All the cDNA were stored at -20&#176;C until PCR.</p>
         </sec>
         <sec>
            <st>
               <p>Selection of soybean sequences, primer design and PCR optimization</p>
            </st>
            <p>Sequences for the primer design were selected according to Brunner <it>et al</it>. <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> to identify soybean homologs for genes which are commonly used as internal controls. The soybean EST database <abbrgrp><abbr bid="B47">47</abbr></abbrgrp> was queried with the relevant <it>Arabidopsis </it>protein using TBLASTN. Selected soybean ESTs were then used to query the <it>Arabidopsis </it>protein database using BLASTX. Primers were designed with Primer Premier 5 <abbrgrp><abbr bid="B48">48</abbr></abbrgrp> with melting temperature between 60&#8211;62&#176;C, 18&#8211;20 bp and about 50% GC content. The primers were used to query soybean EST database with BLASTN to ensure the specificity for the selected gene family member (Table <tblr tid="T5">5</tblr>). Since there is little known about the genomic DNA sequence of soybean, alignments were made with DNA sequence of relevant orthologs in <it>Arabidopsis </it>before primer design to ensure the primer pairs span at least one intron. The primer sequence, primer positions (indicating that the primers span an intron) and amplicon length were provided in Table <tblr tid="T6">6</tblr>. Before qRT-PCR, the primer pairs were tested by standard PCR reaction with Mastercycler Gradient (Eppendorf) to find out the best suitable conditions. Amplicons of expected size were verified by 2% agarose gel electrophoresis and ethidium bromide staining.</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Description of soybean genes for qRT-PCR</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="center">
                        <p>Name<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>Soybase Accession Number</p>
                     </c>
                     <c ca="center">
                        <p><it>Arabidopsis </it>homolog locus<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p><it>Arabidopsis </it>locus description</p>
                     </c>
                     <c ca="center">
                        <p>Function</p>
                     </c>
                     <c ca="center">
                        <p>BLASTX score/E Value</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT11</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC204137</p>
                     </c>
                     <c ca="center">
                        <p>AT3G12110</p>
                     </c>
                     <c ca="center">
                        <p>Actin11</p>
                     </c>
                     <c ca="center">
                        <p>Cytoskeletal structural protein</p>
                     </c>
                     <c ca="center">
                        <p>740/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT2/7</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC204150</p>
                     </c>
                     <c ca="center">
                        <p>AT5G09810</p>
                     </c>
                     <c ca="center">
                        <p>Actin2/7</p>
                     </c>
                     <c ca="center">
                        <p>Cytoskeletal structural protein</p>
                     </c>
                     <c ca="center">
                        <p>739/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G6PD</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC224599</p>
                     </c>
                     <c ca="center">
                        <p>AT5G40760</p>
                     </c>
                     <c ca="center">
                        <p>Glucose-6-phosphate dehydrogenase</p>
                     </c>
                     <c ca="center">
                        <p>Glucose metabolic process</p>
                     </c>
                     <c ca="center">
                        <p>903/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1B</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC203623</p>
                     </c>
                     <c ca="center">
                        <p>AT5G19510</p>
                     </c>
                     <c ca="center">
                        <p>Eukaryotic elongation factor 1-beta</p>
                     </c>
                     <c ca="center">
                        <p>Translational elongation</p>
                     </c>
                     <c ca="center">
                        <p>245/2e-65</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBC2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC214734</p>
                     </c>
                     <c ca="center">
                        <p>AT2G02760</p>
                     </c>
                     <c ca="center">
                        <p>Ubiquitin-conjugating enzyme E2</p>
                     </c>
                     <c ca="center">
                        <p>Ubiquitin-dependent protein catabolic process</p>
                     </c>
                     <c ca="center">
                        <p>314/5e-86</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1A</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC203954</p>
                     </c>
                     <c ca="center">
                        <p>AT5G60390</p>
                     </c>
                     <c ca="center">
                        <p>Eukaryotic elongation factor 1-alpha</p>
                     </c>
                     <c ca="center">
                        <p>Translational elongation</p>
                     </c>
                     <c ca="center">
                        <p>469/e-132</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUB</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC203804</p>
                     </c>
                     <c ca="center">
                        <p>AT1G50010</p>
                     </c>
                     <c ca="center">
                        <p>Beta-tubulin</p>
                     </c>
                     <c ca="center">
                        <p>Structural constituent of cytoskeleton</p>
                     </c>
                     <c ca="center">
                        <p>847/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>AY907702</p>
                     </c>
                     <c ca="center">
                        <p>AT5G19780</p>
                     </c>
                     <c ca="center">
                        <p>Tubulin alpha-5</p>
                     </c>
                     <c ca="center">
                        <p>Structural constituent of cytoskeleton</p>
                     </c>
                     <c ca="center">
                        <p>803/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>CYP2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC224926</p>
                     </c>
                     <c ca="center">
                        <p>AT2G21130</p>
                     </c>
                     <c ca="center">
                        <p>Cyclophilin</p>
                     </c>
                     <c ca="center">
                        <p>Protein folding</p>
                     </c>
                     <c ca="center">
                        <p>283/9e-77</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBQ10</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TC203625</p>
                     </c>
                     <c ca="center">
                        <p>AT4G05320</p>
                     </c>
                     <c ca="center">
                        <p>Ubiquitin 10</p>
                     </c>
                     <c ca="center">
                        <p>Protein binding, protein modification process</p>
                     </c>
                     <c ca="center">
                        <p>734/0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>GmBFT</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>EF532597</p>
                     </c>
                     <c ca="center">
                        <p>AT5G62040</p>
                     </c>
                     <c ca="center">
                        <p>Brother of FT and TFL1 protein</p>
                     </c>
                     <c ca="center">
                        <p>Phosphatidylethanola -mine binding</p>
                     </c>
                     <c ca="center">
                        <p>231/4e-61</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>All soybean sequences except <it>TUA </it>were ESTs based on the <it>Arabidopsis </it>proteins determined via BLASTX. <sup>b</sup>Closest <it>Arabidopsis </it>homolog identified using Tair BLAST <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. AGI protein database was queried with soybean nucleotide sequences using BLASTX.</p>
               </tblfn>
            </tbl>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Primers and amplicons for each of the 10 HKGs and <it>GmBFT</it></p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="center">
                        <p>Name</p>
                     </c>
                     <c ca="center">
                        <p>Forward Primer Sequence [5'-3']</p>
                     </c>
                     <c ca="center">
                        <p>Reverse Primer Sequence [5'-3']</p>
                     </c>
                     <c ca="center">
                        <p>Amplicon Length (bp)</p>
                     </c>
                     <c ca="center">
                        <p>Primer location<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>E(%)</p>
                     </c>
                     <c ca="center">
                        <p>R<sup>2</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT11</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CGGTGGTTCTAT CTTGGCATC</p>
                     </c>
                     <c ca="center">
                        <p>GTCTTTCGCTTCAA TAACCCTA</p>
                     </c>
                     <c ca="center">
                        <p>142</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>98.04</p>
                     </c>
                     <c ca="center">
                        <p>0.9979</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ACT2/7</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CTTCCCTCAGCA CCTTCCAA</p>
                     </c>
                     <c ca="center">
                        <p>GGTCCAGCTTTCA CACTCCAT</p>
                     </c>
                     <c ca="center">
                        <p>119</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>109.56</p>
                     </c>
                     <c ca="center">
                        <p>0.9979</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>G6PD</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACTCCTTGATAC CGTTGTCCAT</p>
                     </c>
                     <c ca="center">
                        <p>GTTTGTTATCCGCC TACAGCCT</p>
                     </c>
                     <c ca="center">
                        <p>126</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>98.59</p>
                     </c>
                     <c ca="center">
                        <p>0.9990</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1B</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GTTGAAAAGCCA GGGGACA</p>
                     </c>
                     <c ca="center">
                        <p>TCTTACCCCTTGA GCGTGG</p>
                     </c>
                     <c ca="center">
                        <p>118</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>93.15</p>
                     </c>
                     <c ca="center">
                        <p>0.9883</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBC2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TCCCCTCACACC CTTCCTC</p>
                     </c>
                     <c ca="center">
                        <p>CCATCCCAAGGGG TGTCAT</p>
                     </c>
                     <c ca="center">
                        <p>155</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>100.60</p>
                     </c>
                     <c ca="center">
                        <p>0.9988</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>CYP2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CGGGACCAGTGTGCTTCTTCA</p>
                     </c>
                     <c ca="center">
                        <p>CCCCTCCACTACAAAGGCTCG</p>
                     </c>
                     <c ca="center">
                        <p>154</p>
                     </c>
                     <c ca="center">
                        <p>S</p>
                     </c>
                     <c ca="center">
                        <p>82.31</p>
                     </c>
                     <c ca="center">
                        <p>0.9848</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>ELF1A</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GACCTTCTTCGT TTCTCGCA</p>
                     </c>
                     <c ca="center">
                        <p>CGAACCTCTCAAT CACACGC</p>
                     </c>
                     <c ca="center">
                        <p>195</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>98.21</p>
                     </c>
                     <c ca="center">
                        <p>0.9981</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUB</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CCTCGTTCGAAT TCGCTTTTTG</p>
                     </c>
                     <c ca="center">
                        <p>CAACTGTCTTGTC GCTTGGCAT</p>
                     </c>
                     <c ca="center">
                        <p>161</p>
                     </c>
                     <c ca="center">
                        <p>S</p>
                     </c>
                     <c ca="center">
                        <p>100.84</p>
                     </c>
                     <c ca="center">
                        <p>0.9956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>TUA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>AGGTCGGAAACT CCTGCTGG</p>
                     </c>
                     <c ca="center">
                        <p>AAGGTGTTGAAGG CGTCGTG</p>
                     </c>
                     <c ca="center">
                        <p>159</p>
                     </c>
                     <c ca="center">
                        <p>S</p>
                     </c>
                     <c ca="center">
                        <p>85.75</p>
                     </c>
                     <c ca="center">
                        <p>0.9829</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>UBQ10</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CGCCTCTAATCT CGCAGTTCC</p>
                     </c>
                     <c ca="center">
                        <p>GTTGTCAATGGTG TCGGAGGA</p>
                     </c>
                     <c ca="center">
                        <p>114</p>
                     </c>
                     <c ca="center">
                        <p>S</p>
                     </c>
                     <c ca="center">
                        <p>120.28</p>
                     </c>
                     <c ca="center">
                        <p>0.9663</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <it>GmBFT</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CCAAGGGAAATT GTGAGGTA</p>
                     </c>
                     <c ca="center">
                        <p>CTACTAAAAAGCC CCACAGC</p>
                     </c>
                     <c ca="center">
                        <p>191</p>
                     </c>
                     <c ca="center">
                        <p>S</p>
                     </c>
                     <c ca="center">
                        <p>101.65</p>
                     </c>
                     <c ca="center">
                        <p>0.9985</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>D, the two primers were located on different exons; S, the two primers were located on the same exon.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>qRT-PCR</p>
            </st>
            <p>qRT-PCR was conducted on ABI PRISM 7000 Sequence Detection System using power SYBR Green Mix (Applied Biosystems, USA). Each reaction was run in a 20 &#956;l volume which contained 8.8 &#956;l cDNA equal to 20 ng, 10 &#956;l 2 &#215; power SYBR mix, 0.6 &#956;l each primer to a final concentration of 300 nM. All the reactions were performed as the following conditions: 2 min at 50&#176;C, 10 min at 95&#176;C, and 40 cycles of 10 s at 95&#176;C, and 1 min at 60&#176;C in 96-well optical reaction plates (Applied Biosystems, USA). To verify the specificity of the amplicon for each primer pair, a melting curve was made from 60&#176;C to 95&#176;C at the end of each PCR run and all the ten primer pairs amplified a single product. The PCR efficiencies showed in Table <tblr tid="T6">6</tblr> for each gene was determined with the slope of a liner regression model. Each cDNA sample pool was bulked and then used as the PCR template in a range of 50, 25, 10, 5, and 2 ng <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The corresponding real-time PCR efficiencies were calculated according to the equation: E = 10<sup>-1/slope </sup><abbrgrp><abbr bid="B4">4</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Data processing</p>
            </st>
            <p>Expression levels of the ten HKGs in all the sample pools were determined by the number of cycles (Ct) needed for the amplification related fluorescence to reach a specific threshold level of detection <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. The raw Ct value obtained from ABI 7000 after each PCR run was converted into relative quantities using the PCR efficiencies for each gene according to the requirement of geNorm software <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B49">49</abbr></abbrgrp> to calculate gene expression stability (M). The expression stability of the ten HKGs was also determined by the 'Stability index' <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> and &#916;Ct approach <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> to compare the three methods in all the 21 sample pools.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>HKG, housekeeping gene; qRT-PCR, quantitative real-time PCR; <it>ACT11</it>, <it>actin11</it>; <it>ACT2/7</it>, <it>actin2/7</it>; <it>G6PD</it>, <it>glucose-6-phosphate dehydrogenase</it>; <it>ELF1B</it>, <it>eukaryotic elongation factor 1-beta</it>; <it>UBC2</it>, <it>ubiquitin-conjugating enzyme E2</it>; <it>ELF1A</it>, <it>eukaryotic elongation factor 1-alpha</it>; <it>TUB</it>, <it>beta-tubulin</it>; <it>TUA</it>, <it>alpha-tubulin </it>; <it>CYP2</it>, <it>cyclophilin</it>; <it>UBQ10</it>, <it>ubiquitin 10</it>; ZGGG, Zigongdongdou; HH27, Heihe No. 27; ZH24, Zhonghuang No. 24; SN14, Suinong No. 14; SD, short day; LD, long day; StdDev, standard deviation; CV, coefficient variation; <it>GmBFT</it>, <it>Glycine max brother of FT and TFL1</it>.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>BJ performed all the experimental procedures, data analysis, draft the manuscript and was the primary author of the manuscript. BL participated in data analysis, tables and figures drawing and manuscript revising. YB designed the study. WH participated in the experimental process and provided technical support throughout the experimental process. CW performed the sample preparation. TH supervised the study, revised the manuscript critically and gave financial support to the study.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Hongbo Sun and Shikui Song for suggestions in performing the experiment and Jiantian Leng and Ying Wang for assistance in data analysis. We especially thank Charles H. Leseberg and Tore Brembu for reading the manuscript and their suggestions for the writing process. This work was supported by the National Natural Science Foundation of China (30471054), National High Technology Research and Development Program of China (2007AA10Z133) and Beijing Natural Science Foundation (5042019).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays</p>
            </title>
            <aug>
               <au>
                  <snm>Bustin</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Journal of molecular endocrinology</source>
            <pubdate>2000</pubdate>
            <volume>25</volume>
            <fpage>169</fpage>
            <lpage>193</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1677/jme.0.0250169</pubid>
                  <pubid idtype="pmpid" link="fulltext">11013345</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream</p>
            </title>
            <aug>
               <au>
                  <snm>Ginzinger</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Experimental hematology</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <issue>6</issue>
            <fpage>503</fpage>
            <lpage>512</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0301-472X(02)00806-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12063017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Real-time PCR quantitation of hepatitis B virus DNA using automated sample preparation and murine cytomegalovirus internal control</p>
            </title>
            <aug>
               <au>
                  <snm>Garson</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Grant</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Ayliffe</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Ferns</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Tedder</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Journal of virological methods</source>
            <pubdate>2005</pubdate>
            <volume>126</volume>
            <issue>1&#8211;2</issue>
            <fpage>207</fpage>
            <lpage>213</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jviromet.2005.03.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">15847939</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Guideline to reference gene selection for quantitative real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Radonic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Thulke</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mackay</snm>
                  <fnm>IM</fnm>
               </au>
               <au>
                  <snm>Landt</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Siegert</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Nitsche</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biochemical and biophysical research communications</source>
            <pubdate>2004</pubdate>
            <volume>313</volume>
            <issue>4</issue>
            <fpage>856</fpage>
            <lpage>862</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.bbrc.2003.11.177</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Comparison of real-time polymerase chain reaction and end-point polymerase chain reaction for the analysis of gene expression in preimplantation embryos</p>
            </title>
            <aug>
               <au>
                  <snm>Gal</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Carnwath</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Dinnyes</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Herrmann</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Niemann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wrenzycki</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Reproduction, fertility, and development</source>
            <pubdate>2006</pubdate>
            <volume>18</volume>
            <issue>3</issue>
            <fpage>365</fpage>
            <lpage>371</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1071/RD05012</pubid>
                  <pubid idtype="pmpid" link="fulltext">16554012</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Jung</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ramankulov</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Roigas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Johannsen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ringsdorf</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kristiansen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>BMC molecular biology</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <fpage>47</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1913536</pubid>
                  <pubid idtype="pmpid" link="fulltext">17559644</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-8-47</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes</p>
            </title>
            <aug>
               <au>
                  <snm>de Kok</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Roelofs</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Giesendorf</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Pennings</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Waas</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Feuth</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Swinkels</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Span</snm>
                  <fnm>PN</fnm>
               </au>
            </aug>
            <source>Laboratory investigation; a journal of technical methods and pathology</source>
            <pubdate>2005</pubdate>
            <volume>85</volume>
            <issue>1</issue>
            <fpage>154</fpage>
            <lpage>159</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15543203</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Housekeeping genes as internal standards: use and limits</p>
            </title>
            <aug>
               <au>
                  <snm>Thellin</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Zorzi</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Lakaye</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>De Borman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Coumans</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hennen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Grisar</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Igout</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Heinen</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Journal of biotechnology</source>
            <pubdate>1999</pubdate>
            <volume>75</volume>
            <issue>2&#8211;3</issue>
            <fpage>291</fpage>
            <lpage>295</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-1656(99)00163-7</pubid>
                  <pubid idtype="pmpid">10617337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Schmittgen</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Zakrajsek</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Journal of biochemical and biophysical methods</source>
            <pubdate>2000</pubdate>
            <volume>46</volume>
            <issue>1&#8211;2</issue>
            <fpage>69</fpage>
            <lpage>81</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0165-022X(00)00129-9</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies</p>
            </title>
            <aug>
               <au>
                  <snm>Tricarico</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pinzani</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bianchi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Paglierani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Distante</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Pazzagli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bustin</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Orlando</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Analytical biochemistry</source>
            <pubdate>2002</pubdate>
            <volume>309</volume>
            <issue>2</issue>
            <fpage>293</fpage>
            <lpage>300</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0003-2697(02)00311-1</pubid>
                  <pubid idtype="pmpid" link="fulltext">12413463</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes</p>
            </title>
            <aug>
               <au>
                  <snm>Vandesompele</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Preter</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Pattyn</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Poppe</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Van Roy</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>De Paepe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Speleman</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Genome biology</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <issue>7</issue>
            <fpage>RESEARCH0034</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">126239</pubid>
                  <pubid idtype="pmpid" link="fulltext">12184808</pubid>
                  <pubid idtype="doi">10.1186/gb-2002-3-7-research0034</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase</p>
            </title>
            <aug>
               <au>
                  <snm>Singh</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1993</pubdate>
            <volume>259</volume>
            <issue>5093</issue>
            <fpage>365</fpage>
            <lpage>368</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">8420004</pubid>
                  <pubid idtype="doi">10.1126/science.8420004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Evidence that glyceraldehyde-3-phosphate dehydrogenase is involved in age-induced apoptosis in mature cerebellar neurons in culture</p>
            </title>
            <aug>
               <au>
                  <snm>Ishitani</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sunaga</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hirano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Katsube</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Chuang</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Journal of neurochemistry</source>
            <pubdate>1996</pubdate>
            <volume>66</volume>
            <issue>3</issue>
            <fpage>928</fpage>
            <lpage>935</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8769851</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets</p>
            </title>
            <aug>
               <au>
                  <snm>Andersen</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Jensen</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Orntoft</snm>
                  <fnm>TF</fnm>
               </au>
            </aug>
            <source>Cancer research</source>
            <pubdate>2004</pubdate>
            <volume>64</volume>
            <issue>15</issue>
            <fpage>5245</fpage>
            <lpage>5250</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-0496</pubid>
                  <pubid idtype="pmpid" link="fulltext">15289330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Silver</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Best</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Thein</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>BMC molecular biology</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <fpage>33</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1609175</pubid>
                  <pubid idtype="pmpid" link="fulltext">17026756</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-7-33</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Validating internal controls for quantitative plant gene expression studies</p>
            </title>
            <aug>
               <au>
                  <snm>Brunner</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Yakovlev</snm>
                  <fnm>IA</fnm>
               </au>
               <au>
                  <snm>Strauss</snm>
                  <fnm>SH</fnm>
               </au>
            </aug>
            <source>BMC plant biology</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>14</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">515301</pubid>
                  <pubid idtype="pmpid" link="fulltext">15317655</pubid>
                  <pubid idtype="doi">10.1186/1471-2229-4-14</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos</p>
            </title>
            <aug>
               <au>
                  <snm>Goossens</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Van Poucke</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Van Soom</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Vandesompele</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Van Zeveren</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Peelman</snm>
                  <fnm>LJ</fnm>
               </au>
            </aug>
            <source>BMC developmental biology</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>27</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1315359</pubid>
                  <pubid idtype="pmpid" link="fulltext">16324220</pubid>
                  <pubid idtype="doi">10.1186/1471-213X-5-27</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Expression profiling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (<it>Salmo salar</it> L.)</p>
            </title>
            <aug>
               <au>
                  <snm>Ingerslev</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Pettersen</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Jakobsen</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Petersen</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Wergeland</snm>
                  <fnm>HI</fnm>
               </au>
            </aug>
            <source>Molecular immunology</source>
            <pubdate>2006</pubdate>
            <volume>43</volume>
            <issue>8</issue>
            <fpage>1194</fpage>
            <lpage>1201</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.molimm.2005.07.009</pubid>
                  <pubid idtype="pmpid" link="fulltext">16139890</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes</p>
            </title>
            <aug>
               <au>
                  <snm>Ding</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Journal of agricultural and food chemistry</source>
            <pubdate>2004</pubdate>
            <volume>52</volume>
            <issue>11</issue>
            <fpage>3372</fpage>
            <lpage>3377</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1021/jf049915d</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Jain</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nijhawan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tyagi</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Khurana</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Biochemical and biophysical research communications</source>
            <pubdate>2006</pubdate>
            <volume>345</volume>
            <issue>2</issue>
            <fpage>646</fpage>
            <lpage>651</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.bbrc.2006.04.140</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Normalization of reverse transcription quantitative-PCR with housekeeping genes in rice</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Nam</snm>
                  <fnm>HY</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>SU</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>SI</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>YJ</fnm>
               </au>
            </aug>
            <source>Biotechnology letters</source>
            <pubdate>2003</pubdate>
            <volume>25</volume>
            <issue>21</issue>
            <fpage>1869</fpage>
            <lpage>1872</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1026298032009</pubid>
                  <pubid idtype="pmpid" link="fulltext">14677714</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress</p>
            </title>
            <aug>
               <au>
                  <snm>Nicot</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hausman</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Hoffmann</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Evers</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Journal of experimental botany</source>
            <pubdate>2005</pubdate>
            <volume>56</volume>
            <issue>421</issue>
            <fpage>2907</fpage>
            <lpage>2914</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jxb/eri285</pubid>
                  <pubid idtype="pmpid" link="fulltext">16188960</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Genome-wide identification and testing of superior reference genes for transcript normalization in <it>Arabidopsis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Czechowski</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Stitt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Altmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Udvardi</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Scheible</snm>
                  <fnm>WR</fnm>
               </au>
            </aug>
            <source>Plant physiology</source>
            <pubdate>2005</pubdate>
            <volume>139</volume>
            <issue>1</issue>
            <fpage>5</fpage>
            <lpage>17</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203353</pubid>
                  <pubid idtype="pmpid" link="fulltext">16166256</pubid>
                  <pubid idtype="doi">10.1104/pp.105.063743</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Effect of the relative length of day and night and other factors of the environment on growth and reproduction in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Garner</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Alland</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Agric Res</source>
            <pubdate>1920</pubdate>
            <volume>18</volume>
            <fpage>553</fpage>
            <lpage>606</lpage>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Influence of photoperiods upon the differentiation of meristems and the blossoming of Biloxi soybeans</p>
            </title>
            <aug>
               <au>
                  <snm>Borthwick</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Bot Gaz</source>
            <pubdate>1938</pubdate>
            <volume>99</volume>
            <fpage>825</fpage>
            <lpage>839</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1086/334749</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The effect of maternal photoperiod on seasonal dormancy in <it>Arabidopsis thaliana</it> (Brassicaceae)</p>
            </title>
            <aug>
               <au>
                  <snm>Munir</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dorn</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Donohue</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Schmitt</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Am J Bot</source>
            <pubdate>2001</pubdate>
            <volume>88</volume>
            <issue>7</issue>
            <fpage>1240</fpage>
            <lpage>1249</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2307/3558335</pubid>
                  <pubid idtype="pmpid" link="fulltext">11454624</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Postflowering photoperiod regulates vegetative growth and reproductive development of soybean</p>
            </title>
            <aug>
               <au>
                  <snm>Han</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tong</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Mentreddy</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Tan</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Gai</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Enviromental and Experimental Botany</source>
            <pubdate>2006</pubdate>
            <volume>55</volume>
            <fpage>120</fpage>
            <lpage>129</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.envexpbot.2004.10.006</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>In situ expression of the <it>GmNMH7</it> gene is photoperiod-dependent in a unique soybean (<it>Glycine max</it> [L.] Merr.) flowering reversion system</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Yam</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Cheung</snm>
                  <fnm>MY</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Chong</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Planta</source>
            <pubdate>2006</pubdate>
            <volume>223</volume>
            <issue>4</issue>
            <fpage>725</fpage>
            <lpage>735</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00425-005-0130-y</pubid>
                  <pubid idtype="pmpid" link="fulltext">16208488</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Short photoperiod induces dormancy in Lotus (<it>Nelumbo nucifera</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>Masuda</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Urakawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ozaki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Okubo</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Annals of botany</source>
            <pubdate>2006</pubdate>
            <volume>97</volume>
            <issue>1</issue>
            <fpage>39</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/aob/mcj008</pubid>
                  <pubid idtype="pmpid" link="fulltext">16287906</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Photoperiod sensitivity after flowering and seed number determination in indeterminate soybean cultivars</p>
            </title>
            <aug>
               <au>
                  <snm>Kantolic</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Slafer</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>Field Crops Res</source>
            <pubdate>2001</pubdate>
            <volume>72</volume>
            <fpage>109</fpage>
            <lpage>118</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0378-4290(01)00168-X</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Development and seed number in indeterminate soybean as affected by timing and duration of exposure to long photoperiods after flowering</p>
            </title>
            <aug>
               <au>
                  <snm>Kantolic</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Slafer</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>Annals of botany</source>
            <pubdate>2007</pubdate>
            <volume>99</volume>
            <issue>5</issue>
            <fpage>925</fpage>
            <lpage>933</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/aob/mcm033</pubid>
                  <pubid idtype="pmpid" link="fulltext">17452381</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The CONSTANS gene of <it>Arabidopsis</it> promotes flowering and encodes a protein showing similarities to zinc finger transcription factors</p>
            </title>
            <aug>
               <au>
                  <snm>Putterill</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Robson</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Coupland</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1995</pubdate>
            <volume>80</volume>
            <issue>6</issue>
            <fpage>847</fpage>
            <lpage>857</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(95)90288-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">7697715</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>The flowering integrator FT regulates <it>SEPALLATA3</it> and <it>FRUITFULL</it> accumulation in <it>Arabidopsis</it> leaves</p>
            </title>
            <aug>
               <au>
                  <snm>Teper-Bamnolker</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Samach</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2005</pubdate>
            <volume>17</volume>
            <issue>10</issue>
            <fpage>2661</fpage>
            <lpage>2675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1242264</pubid>
                  <pubid idtype="pmpid" link="fulltext">16155177</pubid>
                  <pubid idtype="doi">10.1105/tpc.105.035766</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>FT protein movement contributes to long-distance signaling in floral induction of <it>Arabidopsis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Corbesier</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Vincent</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Jang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fornara</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Fan</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Searle</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Giakountis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Farrona</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gissot</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Turnbull</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Coupland</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2007</pubdate>
            <volume>316</volume>
            <issue>5827</issue>
            <fpage>1030</fpage>
            <lpage>1033</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">17446353</pubid>
                  <pubid idtype="doi">10.1126/science.1141752</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The GIGANTEA-Regulated MicroRNA172 Mediates Photoperiodic Flowering Independent of CONSTANS in <it>Arabidopsis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Jung</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Seo</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Seo</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Yun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chua</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2007</pubdate>
            <volume>19</volume>
            <issue>9</issue>
            <fpage>2736</fpage>
            <lpage>2748</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2048707</pubid>
                  <pubid idtype="pmpid" link="fulltext">17890372</pubid>
                  <pubid idtype="doi">10.1105/tpc.107.054528</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Selection of reliable reference genes for qPCR studies on chondroprotective action</p>
            </title>
            <aug>
               <au>
                  <snm>Toegel</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Piana</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Wirth</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Goldring</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Gabor</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Viernstein</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>BMC molecular biology</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <fpage>13</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1820791</pubid>
                  <pubid idtype="pmpid" link="fulltext">17324259</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-8-13</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Cloning and characterization of GmBFT, a soybean BFT homologue encoding the phosphatidylethanolamine-binding protein</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hou</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cao</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>DNA Sequcence</source>
            <pubdate>2008</pubdate>
            <note>
               <b>(accepted)</b>
            </note>
         </bibl>
         <bibl id="B38">
            <title>
               <p>A pair of related genes with antagonistic roles in mediating flowering signals</p>
            </title>
            <aug>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kaya</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Iwabuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Araki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1999</pubdate>
            <volume>286</volume>
            <issue>5446</issue>
            <fpage>1960</fpage>
            <lpage>1962</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10583960</pubid>
                  <pubid idtype="doi">10.1126/science.286.5446.1960</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Tech. Sight. A technique whose time has come</p>
            </title>
            <aug>
               <au>
                  <snm>Walker</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2002</pubdate>
            <volume>296</volume>
            <issue>5567</issue>
            <fpage>557</fpage>
            <lpage>559</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.296.5567.557</pubid>
                  <pubid idtype="pmpid" link="fulltext">11964485</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization?</p>
            </title>
            <aug>
               <au>
                  <snm>Ohl</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Stephan</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rabien</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Burkhardt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nitsche</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kristiansen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Loening</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Radonic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Journal of molecular medicine (Berlin, Germany)</source>
            <pubdate>2005</pubdate>
            <volume>83</volume>
            <issue>12</issue>
            <fpage>1014</fpage>
            <lpage>1024</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16211407</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>DNA and RNA references for qRT-PCR assays in exfoliated cervical cells</p>
            </title>
            <aug>
               <au>
                  <snm>Steinau</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rajeevan</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Unger</snm>
                  <fnm>ER</fnm>
               </au>
            </aug>
            <source>J Mol Diagn</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <issue>1</issue>
            <fpage>113</fpage>
            <lpage>118</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1867570</pubid>
                  <pubid idtype="pmpid" link="fulltext">16436642</pubid>
                  <pubid idtype="doi">10.2353/jmoldx.2006.050088</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development</p>
            </title>
            <aug>
               <au>
                  <snm>Reid</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Olsson</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Schlosser</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Peng</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lund</snm>
                  <fnm>ST</fnm>
               </au>
            </aug>
            <source>BMC plant biology</source>
            <pubdate>2006</pubdate>
            <volume>6</volume>
            <fpage>27</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1654153</pubid>
                  <pubid idtype="pmpid" link="fulltext">17105665</pubid>
                  <pubid idtype="doi">10.1186/1471-2229-6-27</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Evolution and function of ubiquitin-like protein-conjugation systems</p>
            </title>
            <aug>
               <au>
                  <snm>Hochstrasser</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nature cell biology</source>
            <pubdate>2000</pubdate>
            <volume>2</volume>
            <issue>8</issue>
            <fpage>E153</fpage>
            <lpage>157</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35019643</pubid>
                  <pubid idtype="pmpid" link="fulltext">10934491</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Appropriate 'housekeeping' genes for use in expression profiling the effects of environmental estrogens in fish</p>
            </title>
            <aug>
               <au>
                  <snm>Filby</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Tyler</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>BMC molecular biology</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <fpage>10</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1802086</pubid>
                  <pubid idtype="pmpid" link="fulltext">17288598</pubid>
                  <pubid idtype="doi">10.1186/1471-2199-8-10</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Identification and validation of suitable endogenous reference genes for gene expression studies of human bladder cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Ohl</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Radonic</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sachs</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Loening</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Jung</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>The Journal of urology</source>
            <pubdate>2006</pubdate>
            <volume>175</volume>
            <issue>5</issue>
            <fpage>1915</fpage>
            <lpage>1920</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-5347(05)00919-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">16600798</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Studies on the post-flowering photoperiodic responses in soybean</p>
            </title>
            <aug>
               <au>
                  <snm>Han</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Acta Botanica Sinica</source>
            <pubdate>1995</pubdate>
            <volume>37</volume>
            <issue>11</issue>
            <fpage>863</fpage>
            <lpage>869</lpage>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Soybean EST database</p>
            </title>
            <url>http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=soybean</url>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Premierbiosoft</p>
            </title>
            <url>http://www.premierbiosoft.com/faq.html</url>
         </bibl>
         <bibl id="B49">
            <title>
               <p>geNorm</p>
            </title>
            <url>http://medgen.ugent.be/~jvdesomp/genorm/</url>
         </bibl>
         <bibl id="B50">
            <title>
               <p>TAIR BLAST</p>
            </title>
            <url>http://www.arabidopsis.org/Blast/</url>
         </bibl>
      </refgrp>
   </bm>
</art>
