Previously we applied a double-strand break repair (DSBR) assay to analyze aspects of homologous recombination mediated by the phage protein pairs, RecE/RecT and Redα/Redβ 24. With the intention to explore the DSBR mechanism further, we developed a DNA repair assay using a mutated kanamycin resistance gene (neo) present in pGKneo (Fig. 1A). pGKneo was cut with Nco1 and either filled in to create a 4 nucleotide insertion (pGKneo*), or resected to create a four nucleotide deletion (pGKneoΔ). Oligonucleotides (oligos) containing the wild type sequence across the Nco1 site will, if incorporated correctly into pGKneo* or pGKneoΔ, restore kanamycin resistance and thus be easily detected. Most of the following experiments were performed with both pGKneo templates. Since virtually identical results were obtained for both, except that results with pGKneo* consistently yielded slightly more correctly repaired products, only results obtained with pGKneoΔ are presented. In the first experiment, a 46 nt double stranded oligo, containing 21 bps of homologous sequences on both sides of the intact Nco1 site, was used to evaluate the frequency of repair in the presence or absence of either RecE/RecT or Redα/Redβ protein pairs. Repair was dependent on expression of phage proteins and both insertion and deletion substrates were suitable (Fig. 1B, and data not shown). Since Red/ET DSBR requires linearised, double stranded DNA and does not work with single stranded DNA 1, we expected that the corresponding single stranded oligos (ss oligos) would serve as good negative controls in this experiment. Surprisingly, each ss oligo delivered notable levels of phage protein-dependent repair (Fig. 1B). This unexpected result suggested that the phage proteins mediate a repair reaction different from their activities in DSBR and prompted further analysis.

In addition to the requirement for double stranded DNA, Red/ET DSBR requires the co-expression of an orthologous phage protein pair, either RecE/RecT or Redα/Redβ 24. Since the ss oligo repair (ssOR) activity was unexpected, we examined the requirement for expression of an orthologous pair. As also shown in Fig. 1B, ssOR was mediated by either phage annealing protein alone without the need for its orthologous exonuclease partner. This presents a second piece of evidence that the ssOR activity is distinct from Red/ET DSBR. In contrast to the results of Ellis et al 29, ssOR by either annealing protein alone was less efficient than that obtained when the cognate exonuclease partner was co-expressed (Fig. 1B). Since it is unlikely that the exonuclease activity of RecE or Redα is beneficial, this result may reflect an aspect of the specific protein/protein interaction between these protein pairs 2430. Alternatively, it is possible that the difference between our results and those of Ellis et al on this point reflect an operational aspect of experimental design, such as protein expression levels or stabilities, either in our experiments or those of Ellis et al. Notably, the lagging oligo (that is, the oligo that would prime lagging strand synthesis) delivered better efficiency than the leading for all configurations (Fig. 1B). Also notable is the observation that the double stranded (ds) oligo delivered better efficiency than either ss oligo in all cases. In the cases where either phage protein pair was co-expressed, this appears to be simply the additive outcome of both DSBR and ssOR activities. In the cases in which only one annealing protein was expressed, this may reflect a simple addition of lagging and leading ssOR. Alternatively, it could reflect an operational parameter such as stabilization of the oligos against decay, or a beneficial contribution of a presumptive ds oligo unwinding step. To focus on the ssOR activity, further experiments were performed with ss oligos.

To evaluate the requirements for the ssOR activity in more detail, a series of differently configured E. coli hosts were examined (Table 1). No significant activity could be found in the absence of a phage annealing protein, including in the wild type E. coli strain, MM294, the recBC strain JC5519, or recA strain JC9366. Furthermore, no significant activity was found in several sbcBC strains. Importantly, ssOR in the presence or absence of RecBC activity was the same. This conclusion is established by comparing strains with or without RecBC (MM294, JC8679, JC5519, JC9366) and with or without expression of the RecBC inhibitor, Redγ 31. The independence of ssOR from RecBC presents a third operational difference to Red/ET DSBR, since phage DSBR is diminished by the presence of RecBC. The results in Table 1 also show that ssOR on plasmids is independent from RecA, which is neither required nor an impediment.

Interestingly, the P22 phage annealing protein, Erf, also mediates efficient ssOR (Table 1). The P22 recombination system, which includes Erf, Arf, Abc1 and Abc2, shares some mechanistic similarities with that of the RecE/RecT and Redα/Redβ phage protein pairs 3233 but does not appear to include a 5'-3' exonuclease activity. Consistent with this absence, we have been unable to find notable DSBR activity with any combination of these four P22 proteins (unpublished results). The observation that Erf alone, like RecT and Redβ, delivers ssOR is a fourth piece of evidence that this activity is distinct from Red/ET DSBR.

The contribution of ss DNA to ssOR was evaluated in four ways.

First, the relationship between length of homology and repair efficiencies was determined by use of a series of lagging oligos from 16 – 160 nucleotides, each with the repair site in the center (Fig. 2). A little ssOR mediated by Redβ was observed with the 22 mer ss oligo (i.e. 9 nt homology arms either side of the inner 4 bps of the Nco1 site) and efficiencies increased to an apparent maximum near 120 nts. RecT displayed a very similar profile except that a slightly longer oligo (30 nt) was required before repair was detected. These results concur with, and extend, the chromosomal analysis of Ellis et al 29 who examined oligo length dependence with Redβ in the range 20 – 70. Notably, the efficiencies of both Redβ and RecT ss oligo repair were reduced at the longest length examined. This may reflect an implicit limit of ssOR, or an operational parameter such as oligonucleotide quality. Interestingly, the relationship between total homology included in the oligos and ssOR efficiencies is very similar to the relationship observed for single homology arm length and Red/ET DSBR efficiencies 124, including the shortest lengths required (around 27) and the apparent maximums observed (around 120 nts).

Second, the relative contributions of homologies on the 5' and 3' sides of the repair site were evaluated. No repair was observed when the repair site was located at either the 5' or 3' ends, regardless of the length of the single-sided homology region, up to 100 nt (Fig. 3A and not shown). Hence homology regions on both sides of the repair site are required. Next, a series of six 50 mers were synthesized, (3 pairs for lagging and leading) differing in the relative position of the repair site within the oligo (Fig. 3B). For both lagging and leading oligos, the centrally positioned repair site (23/4/23) was most efficient. Again the lagging oligo delivered better efficiency than the leading. For both lagging and leading oligos, more homology 5' to the repair site (35/4/11) worked better than oligos with more 3' homology (11/4/35). Notably, the 11/4/35 and 35/4/11 oligos functioned with RecT whereas the 11/4/11 26 mer oligo did not (Fig. 2). This indicates that the stability of hybrid formation on one side of the repair enhances the efficacy of the hybrid formed on the other side.

In a third variation, three new substrate plasmids were created that had larger deletions around the Nco1 site, being deletions of 15, 33 and 60 nucleotides (Fig. 3B). Oligos were synthesized that retained 22 nts homology on either side of the deletions and included the extra 4, 15, 33 or 60 nts required for repair of the neo gene for kanamycin resistance. Repair efficiencies decreased with the increasing size of the deletion. Hence ssOR is less efficient when more of the oligo itself needs to be inserted. In contrast, Ellis et al 29 obtained a very similar efficiency of ssOR in the converse situation, namely when more of the template was deleted. They showed equivalent efficiencies when repairing a point mutation or deleting 3.3 kb with the same oligo. Together these data imply that oligo/template hybrid formation is differentially sensitive. Looping out of the oligo from the template appears to be more deleterious than looping out of the template from the oligo.

In a fourth experiment, additional point mutations were introduced in the homology region near to the repair site. The point mutations were chosen to be silent with respect to the kanamycin resistance protein reading frame, and also to be easily identifiable by alteration of the restriction digestion pattern. The restriction digestion pattern therefore will display complete incorporation during ssOR, or further repair, of the oligo. In all configurations of this experiment, the point mutation reduced ssOR efficiencies (Fig. 3C and data not shown) and was removed in all but 2 cases out of 168 examined. Both of these two cases were found with the 44/14/29 lagging oligo repairing pGKneo* (2/28 cases examined; data not shown).

Taken together, the data of Fig. 2 and Table 3 imply that the efficiencies of ssOR simply reflects the stability of the hybrid formed between the entire oligo and the template on both the 5' and 3' sides of the repair site, up to an optimum size of approximately 120 nts. Whereas ssOR may not be impaired by intervening, non-homologous sequence in the template, it appears to be impaired by non-homologous sequence in the oligo.

Since the above characterization of ssOR simply highlighted the importance of stable hybrid formation, we reasoned that it may also work in any host, including eukaryotes. On the other hand, a failure to work in a non-prokaryotic host may indicate a specific requirement for other prokaryotic factors. Hence an experiment in mouse ES cells was performed (Table 2). The defective neo* gene was cloned into pcDNA to create pcDNA/PGK-neo*. Then redβ was cloned in to create pcDNA-redβ/PGK-neo*. Both vectors were stably integrated into ES cells by selection for hygromycin resistance and 12 independent colonies each were taken, electroporated with a repairing oligo, followed by selection for G418 resistance. No G418R colonies were observed with any pcDNA/PGK-neo* clone, whereas half of the pcDNA-redβ/PGK-neo* clones gave rise to G418 resistant colonies. Hence Redβ can function in a eukaryotic context to mediate ssOR and no factor specific to E. coli is required. Similar results in ES cells were obtained with RecT (data not shown).

To evaluate the utility of ssOR in DNA engineering, two experiments were performed with BACs in E. coli. In the first, the neo gene was interrupted, at its Nco1 site, by inserting a gene encoding for zeocin resistance, and this cassette was integrated, by Red/ET DSBR, into a BAC containing 143 kb of mouse DNA including most of the Mll gene (Fig. 4). Ss oligo repair on the endogenous BAC will delete the zeocin gene and restore kanamycin resistance. Unlike the co-transfer plasmid assay used above, where the calculation of absolute efficiencies is complicated by other parameters (such as the high-copy number of the plasmid target and variable co-transformation efficiencies), this assay presents a simple way to evaluate absolute ssOR efficiencies. The total number of chloramphenicol resistant colonies scores the total number of endogenous BAC targets in the experiment and kanamycin resistant colonies represents the number of ssOR events. Five oligos with increasing lengths of homology either side of the Nco1 site were evaluated. The most efficient was a 106 mer, that is with 55 nt homology either side of the zeocin gene to be deleted. The longer oligos did not give better results. A remarkable efficiency of 3% was observed with the 106 mer. At these efficiencies, it is clearly straightforward to identify correct ssOR products by physical methods such as colony PCR or hybridization.

In the second BAC experiment, the merits of concerted usage of antibiotic selection and counterselection were examined. A cassette containing the rpsL and neo genes was integrated into the Mll BAC using Red/ET DSBR by selection for kanamycin resistance (Fig. 5). Two oligos with 25 nts homology arms were used for ssOR. In the centre of these oligos, either an additional 6 nts encoding an XhoI site, or an additional 34 nts encoding the minimal FRT site, were included. Candidate colonies containing the correctly modified BACs were identified by selection for streptomycin resistance (i.e. elimination of the rpsL gene in HS996 host background). In both cases 20/22 colonies examined by restriction digestion analysis of BAC DNAs showed the correct ssOR event without any apparent, unintended, secondary recombinations elsewhere in the BAC (data not shown). Hence this selection/counterselection strategy is qualitatively very efficient. Furthermore this strategy does not rely on the absolute efficiencies required for physical screening methods, such as colony PCR, but permits a practical way to use suboptimal ssOR oligos. In this experiment, the oligos were suboptimal since they included both significantly shorter regions of homology than optimal (Fig. 2, Fig. 4) and centrally located non-homologous sequences that impair absolute efficiency (Fig. 3B).

Most oligo sequences can be deduced from the descriptions in the text and the sequence of the longest lagging oligo used, namely the 160 mer of Fig. 2, which, with central Nco1 site in bold, is – 5'GCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCG

C

G

The silent point mutant oligos used in the experiment of Fig. 3C are underlined and bold, being C to T to destroy an Sph1 site and G to A to create a BglII site.

The oligos used to replace rpsL-neo cassette in the BAC were:

XhoI site: 5' GTCGTAACCTGTAGAACGGAGTAACCTCGAGTGAATTGTAATACGACTCACTATAG 3'

FRT site: 5' GTCGTAACCTGTAGAACGGAGTAACGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGAATTGTAATACGACTCACTATAG 3'

pGKneo was linearised with NcoI. To generate pGKneo* or pGKneoΔ, the 5' overhangs of the NcoI site were filled in using Klenow and nucleotides, or removed using Mung Bean nuclease according to supplier's instructions (New England Biolabs), followed by ligation to generate an intact circular plasmid. To generate pGKneoΔ15, pGKneoΔ33 and pGKneoΔ60, NcoI digested pGKneo was treated with BAL-31 nuclease according to manufacturer's instructions (New England Biolabs).

pSC101-BAD-γβα (tet) was generated by PCR of the lambda red operon and cloning into pBAD24 (Invitrogen) between NcoI and HindIII sites to form pBAD-γβα. The pSC101 origin and repA gene were copied by PCR using pMAK-705 (49) plasmid as a template. The tetracyclin gene flanked by homology arms to the pSC101 ori + repA cassette was generated by a PCR reaction from pBR322, and the two PCR fragments were recombined in YZ2000 cells (6) to generate pSC101-tet. A pSC101-repA-tet cassette flanked with homology arms to the red operon of pBAD-γβα was generated by PCR reaction using pSC101-tet as a template. pSC101-BAD-gba (tet) was generated by replacing the ColE1 ori plus amp in pBAD-gba with pSC101-repA-tet cassette mediated by Red/ET recombination (6).

pBADErf was generated by PCR using P22 phage DNA as a template and insertion into pBAD24 followed by sequencing.

The PGKneo* cassette from pGKneo* was inserted into the Bst 1107I site of the pcDNA31/Hygro mammalian expression vector (Stratagene) to form pcDNA/PGK-neo*. The redβ gene was inserted under the CMV promoter between NheI and HindIII sites in pcDNA-PGKneo* to form pcDNA-redβ/PGK-neo*.

After linearization, 20 μgs of pcDNA/PGK-neo* or pcDNA-redβ/PGK-neo* were electroporated into ES cells as described 3, followed two days later by selection with hygromycin (200 μg/ml). Twelve independent clones were picked from each transfected line. For repairing the neo*, 1 nmol of repairing oligo carrying 28 nt of homology either side of the NcoI site was used for electroporation and selection with G418 (80 μg/ml) using the same conditions.